FastQCFastQC Report
Wed 3 May 2017
eco.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameeco.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7943130
Sequences flagged as poor quality0
Sequence length94
%GC40

[FAIL]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACAAAAAAAAAAAAAAAAAA3847384.84365734918099No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACAAAAAAAAAAAAAAAAAA3589554.519062384727431No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACACAAAAAAAAAAAAAAAAAA1722222.1681881072071088No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACACAAAAAAAAAAAAAAAAAA1251781.5759278772977403No Hit
ACGCAGCGACGATGAGCGATAAACAAGTTCTTCGAAGCACTCGTAAGAGG1213121.5272568873982926No Hit
ATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC848581.0683194156459732No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACGCAAAAAAAAAAAAAAAAAA664650.8367608235040846No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACGAAAAAAAAAAAAAAAAA637190.8021900686505193No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACGCAAAAAAAAAAAAAAAAAA631930.7955679939771853No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACGAAAAAAAAAAAAAAAAA603330.7595620366278785No Hit
TAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCT572050.7201820944640211No Hit
GTTGAGACGACAACGTGAAACACTTCACAGGATGGTCGGAACAACGAAGA462620.5824152443684039No Hit
AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTA459230.5781474053679092No Hit
ATTTGCCTGGCGGCCGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC446760.5624483043837882No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACTAAAAAAAAAAAAAAAAA410030.51620708713064No Hit
TTTAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGC394550.4967185479779382No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACTAAAAAAAAAAAAAAAAA382900.4820517856311051No Hit
TTTAAAAATCTGGATCAAGCTGAAAATTGAAACACTGAACAACGAAAGTT376130.4735286971256923No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACATAAAAAAAAAAAAAAAAAA366230.4610650965047784No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACATAAAAAAAAAAAAAAAAAA350460.44121146198035277No Hit
CCTGAAGGAACGTTGAAGACGACGACGTTGATAGGCCGGGTGTGTAAGCG338580.42625514123525615No Hit
ACACAGCGGGGGTGATTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGA319840.40266242652455647No Hit
ACTTCCTGAGCCGGAACGAAAAGTTTTATCGGAATGCGTGTTCTGGTGAA317930.40025783286941047No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACGCAAAAAAAAAAAAAAAAAA309330.389430866673465No Hit
TCTCCCTGACTCCTTGAGAGTCCTGAAGGAACGTTGAAGACGACGACGTT304430.3832620138408914No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACACGAAAAAAAAAAAAAAAAA290480.3656996675114218No Hit
GCAACGGCGCTAAGCGCCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCG272710.34332813387166017No Hit
AATGCCCCATTTGCGGGGCTAATTTCTTGTCGGAGTGCCTTAACTGGCTG256640.32309681447993427No Hit
GCGCTGGAGAACTGAGGGGGGCTGCTCCTAGTACGAGAGGACCGGAGTGG256170.32250510818783024No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACGCAAAAAAAAAAAAAAAAAA231350.29125798016650867No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACACGAAAAAAAAAAAAAAAAA219840.27676747075774916No Hit
CTTTAAAAATCTGGATCAAGCTGAAAATTGAAACACTGAACAACGAAAGT208630.26265464621629003No Hit
TCTCCCTGACCCTTTAAGGGTCCTGAAGGAACGTTGAAGACGACGACGTT197470.24860476915271437No Hit
CCAAGGGTTCCTGTCCAACGTTAATCGGGGCAGGGTGAGTCGACCCCTAA192470.242310021364374No Hit
TGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCA190580.23993060670038135No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACATAAAAAAAAAAAAAAAAAA182880.23023669510633718No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACACTAAAAAAAAAAAAAAAAA177530.22350131497281298No Hit
ATGTGTAGGATAGGTGGGAGGCTTTGAAGTGTGGACGCCAGTCTGCATGG170370.21448723613990958No Hit
TTAAGTGGGAAACGATGTGGGAAGGCCCAGACAGCCAGGATGTTGGCTTA168660.21233443239629715No Hit
ATTCCGGAAGTGTGGCCGAGCGGTTGAAGGCACCGGTCTTGAAAACCGGC167350.21068520847575203No Hit
ACATTGAGCCTTGATGTGTAGGATAGGTGGGAGGCTTTGAAGTGTGGACG163880.2063166535106438No Hit
ACGTTGAAGACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGC161730.20360991196165745No Hit
GCTGGGTTTAGAACGTCGTGAGACAGTTCGGTCCCTATCTGCCGTGGGCG155420.1956659402527719No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACATAAAAAAAAAAAAAAAA154320.19428109573933702No Hit
TGAAGACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTG154190.19411743229684014No Hit
TTAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCC154100.19400412683665005No Hit
ATCGACACGGCGGATGTGAATCACTTCACACAAACAGCCGGTTCGGTTGA152890.19248079787187167No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACACTAAAAAAAAAAAAAAAAA149970.1888046651634809No Hit
GACAGTTCGGTCCCTATCTGCCGTGGGCGCTGGAGAACTGAGGGGGGCTG140760.17720973973735793No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACATAAAAAAAAAAAAAAAA137300.17285377426782642No Hit
CTCGCGACAGTGAGCTGAAAGCCGCGTCGCAACTGCTCTTTAACAATTTA135850.1710282974092077No Hit
ACTGACACGGAACAACGGCAAACACGCCGCCGGGTCGGCGGGGTTCTCCT134910.1698448848249997No Hit
ATTTGTCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC134870.169794526842693No Hit
GATTGTCTGATGAAAATGAGCAGTAAAACCTCTACAGGCTTGTAGCTCAG131230.16521195045278123No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACAGAAAAAAAAAAAAAAAA130730.16458247567394718No Hit
ATTCGGTGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTGTCACGCAG129700.16328575762954906No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACATAAAAAAAAAAAAAAAAAA129460.16298360973570872No Hit
GAAGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAA124510.15675180942525177No Hit
GCTACATGGAGATTAACTCAATCTAGAGGGTATTAATAATGAAAGCTACT123940.15603420817738098No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACAGAAAAAAAAAAAAAAAA122340.15401988888511203No Hit
GTCAACTCGACAAGCTTTACGTGACGGGGCTATAGCTCAGCTGGGAGAGC116800.1470453083356309No Hit
AGAGTGTACCTGCAAAGGTTCACTGCGAAGTTTTGCTCTTTAAAAATCTG112860.1420850470784187No Hit
AATTTGCCTGGCGGCCGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAA105570.13290730480301846No Hit
CTCGCGACAGTGCGCTAAAGCGCGTCGCAACTGCTCTTTAACAATTTATC104730.1318497871745773No Hit
ACGGACGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAA102530.12908009814770752No Hit
CTTGAGAGTCCTGAAGGAACGTTGAAGACGACGACGTTGATAGGCCGGGT102050.12847580236002684No Hit
ATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAA100320.12629781962526107No Hit
GATTGTCTGATAGGAAGTGAAAAGCAAGGCGTCTTGCGAAGCAGACTGAT100050.1259579032446907No Hit
AAAACTCATCTTCGGGTGATGTTTGAGATATTTGCTCTTTAAAAATCTGG99540.12531583897027998No Hit
AATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAA96730.1217781907132327No Hit
TAAATTGAAGAGTTTGATCATGAAAAAAAAAAAAAAAAAAAAAAAAAAAA95170.1198142294032705No Hit
AAATTGAAGAGTTTGATCATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA94190.11858045883675579No Hit
TCTTTAATCACCCATGGCTTCGGTGTCCATCGTTTCATTTTTCGGCGGAT92050.1158863067833461No Hit
CCCAGAGGTATTGATAGGTGAAGTCAACTTCGGGTTGAGCACATGAATTA91940.11574782233200263No Hit
ATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCA91520.11521906351778202No Hit
AAATTGAAGAGTTTGATCATGGCTCAGATTGAAAAAAAAAAAAAAAAAAA89790.11304108078301627No Hit
CGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTGAGCTAA88750.11173177324304148No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACCAAAAAAAAAAAAAAAAA88440.11134149888016437No Hit
TAAATTGAAGAGTTTGATCATGGCTCAGATTGAAAAAAAAAAAAAAAAAA86810.10928941110116541No Hit
AAGACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTGAG86380.10874806279136814No Hit
CTCCTTGAGAGTCCTGAAGGAACGTTGAAGACGACGACGTTGATAGGCCG85580.10774090314523367No Hit
TGTGGGCACTCGAAGATACGGATTCTTAACGTCGCAAGACGAAAAATGAA85220.10728768130447318No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACCAAAAAAAAAAAAAAAAA83640.10529854100335762No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACAAGAAAAAAAAAAAAAAA83280.10484531916259711No Hit
GCGAAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCT82560.1039388754810761No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACAAGAAAAAAAAAAAAAAA82260.10356119061377567No Hit
GATTGTCTGATAGAAAGTGAAAAGCAAGGCGTCTTGCGAAGCAGACTGAT80240.10101811250728618No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCTAGGT202.4964622E-588.381882
CTTAAAG1977850.086.32412
GAAGCGT2028400.085.1234368
AAGCGTT1007900.084.327089
AGAAGCG2050100.084.314697
TTAAAGA2064350.083.682973
TAAAGAA2073500.083.323784
AAAGAAG2081950.083.010955
ATTGTCT61150.082.239232
CCTTAAA2071800.081.418531
AAGAAGC2125150.081.308126
CTGCTAA137350.080.44189588
TTGAGAC55800.079.82882
AAGCGTA1101500.079.633459
ACGCAGC143250.078.733171
TGAGACG63500.078.573533
CGACGAT150000.077.746637
ATCGGCT49650.077.5301361
GACGATG151550.076.922448
GATTGTC65750.076.223521