FastQCFastQC Report
Wed 3 May 2017
hsa_r1.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamehsa_r1.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences97548052
Sequences flagged as poor quality0
Sequence length101
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGTCTGATGAGCGTCGGCATCGGGCGCCTTAACCCGGCGTTCGGTTCATC984300.10090411646559584No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTACGAA320550.023.6300561
TAGATCG165050.021.667028
TACCGCG219700.017.4984151
TGCGTCG503750.016.9226829
CGGGTGT331300.016.5443041
ACGAACG337800.016.14991228-29
GTGCGTC571650.015.6852548
GCGGGTT209150.015.1052411
ACGTACG142850.015.01060436-37
TACGAAT508650.014.975452
CGGTATA173950.014.9342254
CGTACGA159250.014.71730936-37
TACGTAC162500.014.58367434-35
GCGGTGT565750.014.5811082
TTTAGCG375050.014.53692210-11
GTCCGAA139900.014.45402051
ACTATCG227600.014.27947658-59
CTATACC458300.013.897367594-95
GAACGTG404300.013.80841230-31
CCGAACG119400.013.5236643