FastQCFastQC Report
Wed 3 May 2017
mmu_r2.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamemmu_r2.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences52645238
Sequences flagged as poor quality0
Sequence length76
%GC50

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGTCGATTATCGCACTGGTGCGAATGGATACGCGACATCTATCTGATGAC4179150.7938324830063452No Hit
CACTATAGCGATAGACAAGCATGCGCTGCGTCGACTCAGATGAGTGCACG3986170.7571757962230127No Hit
GCGATCGCTCTATCTGCTCATCTGCACTGCATATGAGCACGCTACTGCTA3828650.7272547613898146No Hit
ATAGCGCAGAGCGTGATCATGACTATACATGATCTGTGTGCAGCACATGT3585030.6809789709754945No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN1858040.35293600534202163No Hit
GCTGACCCAGCCTCCAGTCACCATGAAGACTCTCCTGACTCTGGGACTCC710210.13490488921334157No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATAGCG465300.067.85994
CGACGTA467900.067.2313452
ATAGCGC424600.066.882051
GTCGATT501600.066.663442
TAGCGAT473200.066.519226
ATACGCG488050.066.4418728
CGATAGA471100.066.3583159
GCGATAG473300.066.35228
TCGATTA503000.066.305873
TCGACGT478800.066.0991651
GATACGC493550.065.9783427
ACGTATG478550.065.8213154
TACGCGA491600.065.7245429
ACGTCGT461750.065.62469557
AACGTCG464400.065.4870356
CTCGACG495200.065.0744650
TAGCGCA439050.064.979212
ACTCGAC493650.064.8888249
ATAGCGA486050.064.8240665
CGTATGG488300.064.778455