FastQCFastQC Report
Tue 10 Jan 2017
eco1.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenameeco1.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6643709
Sequences flagged as poor quality0
Sequence length25-94
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACAC3584575.395434989702289No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACAC3361415.059538278994459No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACAC1616042.4324364598148414No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACAC1164691.7530719662766685No Hit
ACGCAGCGACGATGAGCGATAAACAAGTTCTTCGAAGCACTCGTAAGAGG1109511.6700159504276904No Hit
ATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC795401.197222816351529No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACGC612470.921879630790572No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACG587820.8847768618402762No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACGC584240.8793883055383672No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACG558700.840945923429217No Hit
TAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCT498350.7501081097922863No Hit
GTTGAGACGACAACGTGAAACACTTCACAGGATGGTCGGAACAACGAAGA439020.660805583146402No Hit
ATTTGCCTGGCGGCCGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC417870.6289709558320511No Hit
AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTA395100.59469793153192No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACT383380.5770571829681281No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACT359000.5403608135154625No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACAT342910.5161424138233628No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACAT328320.4941817891180965No Hit
TTTAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGC325300.48963613547793855No Hit
CCTGAAGGAACGTTGAAGACGACGACGTTGATAGGCCGGGTGTGTAAGCG320160.4818994931897228No Hit
TTTAAAAATCTGGATCAAGCTGAAAATTGAAACACTGAACAACGAAAGTT309680.46612517194838005No Hit
ACTTCCTGAGCCGGAACGAAAAGTTTTATCGGAATGCGTGTTCTGGTGAA289110.4351635509622713No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACGC288150.4337185749706978No Hit
ACACAGCGGGGGTGATTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGA286150.43070820832158657No Hit
TCTCCCTGACTCCTTGAGAGTCCTGAAGGAACGTTGAAGACGACGACGTT284160.42771289350572095No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACACG269070.40499967713817686No Hit
AATGCCCCATTTGCGGGGCTAATTTCTTGTCGGAGTGCCTTAACTGGCTG238500.35898622290651205No Hit
GCGCTGGAGAACTGAGGGGGGCTGCTCCTAGTACGAGAGGACCGGAGTGG235410.3543352064336352No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACGC211750.31872256897464957No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACACG203340.3060639772151369No Hit
TCTCCCTGACCCTTTAAGGGTCCTGAAGGAACGTTGAAGACGACGACGTT183800.2766526950533204No Hit
CTTTAAAAATCTGGATCAAGCTGAAAATTGAAACACTGAACAACGAAAGT180820.2721672487461447No Hit
CCAAGGGTTCCTGTCCAACGTTAATCGGGGCAGGGTGAGTCGACCCCTAA177970.2678774762711612No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACAT172000.2588915318235642No Hit
CCTTAAAGAAGCGTACTTTGTAGTGCTCACACT166790.2510495267026295No Hit
TTAAGTGGGAAACGATGTGGGAAGGCCCAGACAGCCAGGATGTTGGCTTA157920.23769855061382128No Hit
TTAAAGAAGCGTTCTTTGCAGTGCTCACAC154320.23227989064542112No Hit
GCAACGGCGCTAAGCGCCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCG153310.23075965548761995No Hit
ACATTGAGCCTTGATGTGTAGGATAGGTGGGAGGCTTTGAAGTGTGGACG153190.23057903348867329No Hit
ACGTTGAAGACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGC150770.2269364898432487No Hit
GCTGGGTTTAGAACGTCGTGAGACAGTTCGGTCCCTATCTGCCGTGGGCG144990.2182365302273173No Hit
TGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCA144950.21817632289433506No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACAT144660.21773981973021395No Hit
TGAAGACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTG143280.2156626667423272No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACACT140660.21171908643199153No Hit
ATTCCGGAAGTGTGGCCGAGCGGTTGAAGGCACCGGTCTTGAAAACCGGC138530.2085130459506881No Hit
TTAAAGAAGCGTACTTTGCAGTGCTCACAC138520.20849799411744252No Hit
ATCGACACGGCGGATGTGAATCACTTCACACAAACAGCCGGTTCGGTTGA137450.20688744796016806No Hit
TTAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCC135380.20377171847833792No Hit
GACAGTTCGGTCCCTATCTGCCGTGGGCGCTGGAGAACTGAGGGGGGCTG129890.19550826202652766No Hit
AAGACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTGAG129360.19471051486451318No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACAT129150.1943944263663565No Hit
ACTGACACGGAACAACGGCAAACACGCCGCCGGGTCGGCGGGGTTCTCCT125260.18853926323383519No Hit
ATTCGGTGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTGTCACGCAG122850.18491177142165618No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACAG121530.1829249294332428No Hit
CCTTAAAGAAGCGTTCTTTGAAGTGCTCACAT121040.18218738960421055No Hit
ATTTGTCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAAC120770.18178099010658053No Hit
GATTGTCTGATGAAAATGAGCAGTAAAACCTCTACAGGCTTGTAGCTCAG116980.17607634530651478No Hit
GCTACATGGAGATTAACTCAATCTAGAGGGTATTAATAATGAAAGCTACT115230.17344227448854246No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACAG113710.17115439583521797No Hit
GTCAACTCGACAAGCTTTACGTGACGGGGCTATAGCTCAGCTGGGAGAGC103260.15542523009361187No Hit
CTTGAGAGTCCTGAAGGAACGTTGAAGACGACGACGTTGATAGGCCGGGT100460.15121071678485615No Hit
AATTTGCCTGGCGGCCGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAA97140.14621350814733156No Hit
CTTAAAGAAGCGTTCTTTGCAGTGCTCACAC93770.14114104034357916No Hit
ATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAA93660.14097547017787807No Hit
ACGGACGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAA93620.14091526284489583No Hit
AAAACTCATCTTCGGGTGATGTTTGAGATATTTGCTCTTTAAAAATCTGG91470.13767911869710128No Hit
AATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAA89310.13442792271606116No Hit
GATTGTCTGATAGGAAGTGAAAAGCAAGGCGTCTTGCGAAGCAGACTGAT88230.1328023247255411No Hit
CTTAAAGAAGCGTACTTTGCAGTGCTCACAC87080.13107136390230215No Hit
AGAGTGTACCTGCAAAGGTTCACTGCGAAGTTTTGCTCTTTAAAAATCTG86400.13004783924160435No Hit
CCCAGAGGTATTGATAGGTGAAGTCAACTTCGGGTTGAGCACATGAATTA85920.12932535124581768No Hit
TCTTTAATCACCCATGGCTTCGGTGTCCATCGTTTCATTTTTCGGCGGAT85840.1292049365798532No Hit
AAATTGAAGAGTTTGATCATGGCTCAGATTG85660.1289340035814332No Hit
TTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTC84830.12768470142205207No Hit
ATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCA84010.12645045109591646No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACC83150.12515599343679865No Hit
TAAATTGAAGAGTTTGATCATGGCTCAGATTG82950.1248549567718875No Hit
ATGTGTAGGATAGGTGGGAGGCTTTGAAGTGTGGACGCCAGTCTGCATGGAGCCGACCTTGAAATACCACCCTTT82760.12456897194022193No Hit
CTCCTTGAGAGTCCTGAAGGAACGTTGAAGACGACGACGTTGATAGGCCG82230.12377122477820748No Hit
CGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTGAGCTAA81030.12196500478874074No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACC78530.11820204647735175No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACACAAG77480.11662160398656836No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACACAAG76020.11442403633271717No Hit
CCTTAAAGAAGCGTTCTTTGCAGTGCTCACTC74010.1113986178503604No Hit
ACTGAGGGGGGCTGCTCCTAGTACGAGAGGACCGGAGTGGACGCATCACT73240.11023962669045256No Hit
ACGAGAGGACCGGAGTGGACGCATCACTGGTGTTCGGGTTGTCATGCCAA73120.11005900469150591No Hit
CTTGATGTGTAGGATAGGTGGGAGGCTTTGAAGTGTGGACGCCAGTCTGC72950.10980312352633144No Hit
GAAGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAA72170.10862908053317809No Hit
GCAGCGACGATGAGCGATAAACAAGTTCTTCGAAGCACTCGTAAGAGGCG69940.10527252171941909No Hit
GATTGTCTGATAGAAAGTGAAAAGCAAGGCGTCTTGCGAAGCAGACTGAT68020.10238256973627233No Hit
ATTCACCACAGCGATGTGGTAACTTCGGTGAGATTGTGAAAGTTTGCACT67900.10220194773732565No Hit
TTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACT67860.1021417404043434No Hit
ACGACGACGTTGATAGGCCGGGTGTGTAAGCGCAGCGATGCGTTGAGCTA66980.10081717907873448No Hit
CCTTAAAGAAGCGTACTTTGCAGTGCTCACTC66950.10077202357899782No Hit
GCGAAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCT66920.10072686807926115No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTGCTAA92150.0156.222788
TGCAATT34250.0141.3775288
GGAAAGC57700.0135.8241688
AATATTC24650.0126.0378188
AATCGAA33650.0115.8950188
AATCGTA17350.0108.6239188
TAATACC39600.0107.1987588
CCGCCAA19600.0106.6265988
TACTTTA14950.0106.0916788
GCTTAGC17100.091.66144688
GGTCTCC267250.088.0791488
CCACGTG1500.087.07838488
GGACAGC7250.083.6467188
TAATGTA6200.082.7645888
TAATGTT12350.080.0778688
GCCCGAA11000.079.7276188
TCACGGC32800.078.7915288
GGGCTAG405.315108E-575.8884486-87
TAATTAG4450.069.1874888
CCTGCTA117200.068.41022586-87