FastQCFastQC Report
Tue 10 Jan 2017
hsa_2.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamehsa_2.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences96093116
Sequences flagged as poor quality0
Sequence length25-101
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GCCCCTCTCCGGCCCCGGCCGGGGGGCGGGCGCCGGCGGCTTTGGTGACT1749070.1820182415564503No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACACG180150.021.702657
GTCTAAC186500.021.0131554
TCTCCGG948350.020.0980076
AACACGT199400.019.5149968
AGCGCTC400600.018.7252589
CTCTCCG1063650.018.1361085
TAGGTCG76200.017.0020987
TCCGGCC1175150.016.4859478
TTATCCG441200.015.70632658
ACGTCTC288800.015.04095820-21
AGTCTAA269050.014.8743473
GTACTCG292850.014.84244928-29
ATCGCAC792700.014.83748668-69
CTCCGGC1326900.014.8263967
CGATCGC819750.014.48870466-67
TATCCGG483950.014.3474819
CTAACAC281300.014.2102116
CCCCTCT1355600.014.2064022
GAGTCTA293650.014.1935022
CAGCGCT553600.013.8166098