FastQCFastQC Report
Wed 11 Jan 2017
mmu_2.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamemmu_2.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences43321537
Sequences flagged as poor quality0
Sequence length25-76
%GC50

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CACTATAGCGATAGACAAGCATGCGCTGCGTCGACTCAGATGAGTGCACG3187200.7357079689947288No Hit
ATAGCGCAGAGCGTGATCATGACTATACATGATCTGTGTGCAGCACATGT3022480.6976853106573758No Hit
TGTCGATTATCGCACTGGTGCGAATGGATACGCGACATCTATCTGATGAC2577960.5950758395298855No Hit
GCGATCGCTCTATCTGCTCATCTGCACTGCATATGAGCACGCTACTGCTA2234330.5157550158019555No Hit
GCTGACCCAGCCTCCAGTCACCATGAAGACTCTCCTGACTCTGGGACTCC569790.13152580435915742No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTCGTGC329950.073.9446168
GCGTCGT339550.071.92972666
ACGTCGT404600.069.0024757
CGACGTA413700.068.6232252
AACGTCG406300.068.58156
GTATCAT415700.068.302567
ACGTATG417600.068.2131454
CGTCGTG360200.068.05820567
CGTATGG421400.067.5676855
TCGACGT423250.067.2010251
CTCGACG427500.066.9279150
ACTCGAC433950.065.8766749
TCTCACG436900.065.75770663
TATCATG437000.065.3001768
TATAGCG405600.064.7916954
ATAGCGC374250.064.7382661
CGTCTCA441150.064.69836461
ATACGCG432900.064.5590728
GTCGATT435900.064.16862
GCGATAG409650.064.1438