miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/dro/dro_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/dro.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/dro/dro_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/dro/dro_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/dro.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/dro/dro_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
1012.14
911.74
811.44
711.14
610.64
5104
49.44
38.84
2104
15.24
01.34
-10.94
-214
-314
-40.94
-50.94
-60.94
-70.94
-814
-914
-1014





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
DRO_25017_3446 7.1e+6 14097295 14090988 0 6307 yes blast uauugcacuugucccggccugu agguugggaucgguugcaaugcu agguugggaucgguugcaaugcuguguuucuguaugguauugcacuugucccggccugu NW_020090504.1:11566595..11566654:-
DRO_26300_19726 5.6e+6 11007639 10695311 0 312328 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaaaaaaaccaccgaccguugacuguacc NW_020091914.1:10396048..10396109:+
DRO_27871_37941 5.4e+6 10695984 10695872 0 112 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaauuaaagucaaaaccaucgaccguugauuguacc NW_020093619.1:14241574..14241636:-
DRO_25749_14697 1.6e+6 3210231 3210092 1 138 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc NW_020091304.1:1354691..1354764:-
DRO_28008_42332 1.6e+6 3208295 3208116 0 179 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuggggcucugcccugcuaugggauaacuauacaaucuacugucuuucc NW_020093767.1:21977707..21977777:+
DRO_27880_38579 6.2e+5 1231467 1205280 0 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaagccgcagaugggcuuucagucggauguuugcagc NW_020093628.1:9375785..9375848:-
DRO_24984_2417 6.2e+5 1217561 1196180 26 21355 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuucccacuagauugugagcuccugga NW_020090470.1:47627002..47627064:+
DRO_27088_22875 6.1e+5 1208677 771589 0 437088 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu NW_020092766.1:4889905..4889964:+
DRO_27423_25162 5.6e+5 1113192 1106954 0 6238 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugaggauguccaggaucacaggugagguucuugggagc NW_020093133.1:2380997..2381056:+
DRO_24984_2601 4.6e+5 914039 913941 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuauacccugggaguuaacuguacaaccuucuagcuuucc NW_020090470.1:19364591..19364658:-
DRO_25749_14389 4.4e+5 872082 862596 95 9391 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgccuuguucacaguggcuaaguucug NW_020091304.1:2344848..2344910:+
DRO_27874_38233 4.4e+5 864234 862521 18 1695 yes blast ugagguaguaguuugugcuguu cugcgcaagcuacugccuug ugagguaguaguuugugcuguuggucggguugugacauugcccgcuguggagauaacugcgcaagcuacugccuug NW_020093622.1:9708582..9708658:-
DRO_27088_23322 3.9e+5 774992 774201 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu NW_020092766.1:6420794..6420854:-
DRO_27390_25007 3.2e+5 630933 629267 0 1666 yes blast caacggaaucccaaaagcagcug cugcacuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuucagcugcacuuggauuucguuccc NW_020093099.1:31262728..31262792:-
DRO_27753_34593 3.0e+5 602932 601147 138 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaagaaauuuuguggucacaaauucguaucuaggggaau NW_020093491.1:2922734..2922796:-
DRO_27874_38082 2.5e+5 509964 509958 0 6 yes blast uucaaguaauccaggauaggcu ccuauucuugauuacuuguuuc uucaaguaauccaggauaggcuauuuccaucugugaggccuauucuugauuacuuguuuc NW_020093622.1:13292238..13292298:+
DRO_27390_24586 2.5e+5 507513 507383 4 126 yes blast uucaaguaauccaggauaggcu ccuauucucgguuacuugcacg uucaaguaauccaggauaggcugugcaggucccgaugggccuauucucgguuacuugcacg NW_020093099.1:24902511..24902572:+
DRO_26259_18800 2.1e+5 414755 414555 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguaucgauauagucacagauucgauucuaggggaaua NW_020091871.1:5112672..5112734:+
DRO_27998_41891 2.0e+5 403220 402723 0 497 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgaggcucuucacugcgcccggcucggggcagcucaguacaggau NW_020093757.1:1593164..1593227:-
DRO_27998_41700 2.0e+5 402269 402005 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagccgggcgcagugaagagccucggggcagcucaguacaggau NW_020093757.1:1593165..1593228:+
DRO_27742_33721 1.6e+5 331953 328470 0 3483 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcugc uguaaacauccccgacuggaagcuguaagacacagcugagcuuucagucagauguuugcugc NW_020093479.1:43439814..43439876:-
DRO_27753_34717 1.5e+5 306442 286167 0 20275 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugacucucauggcaacagcagucgaugggcugu NW_020093491.1:13177789..13177848:-
DRO_27880_38575 1.5e+5 303580 281203 0 22377 yes blast uguaaacauccuacacucucagcu cugggagaaggcuguuuacucu uguaaacauccuacacucucagcuguggaaaguaagaaagcugggagaaggcuguuuacucu NW_020093628.1:9351158..9351220:-
DRO_27423_25158 1.1e+5 227698 216275 0 11423 no blast cacccguagaaccgaccuugcg caagcucgugucuguggguccg cacccguagaaccgaccuugcggggccuucgccgcacacaagcucgugucuguggguccg NW_020093133.1:2380337..2380397:+
DRO_28094_43056 1.0e+5 205288 205269 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc NW_020093861.1:239117..239189:+
DRO_25749_14695 1.0e+5 203634 203577 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguaguuauuuuacccugugcaggagauaacuauacaaucuauugccuuccc NW_020091304.1:1354299..1354377:-
DRO_27423_25160 9.5e+4 187632 186488 35 1109 yes blast ugagguaggagguuguauaguu cuauacggccuccuagcuuucc ugagguaggagguuguauaguugaggaggacacccacggagaucacuauacggccuccuagcuuucc NW_020093133.1:2380573..2380640:+
DRO_24984_2212 8.6e+4 169400 169306 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaauauuaaacaccaauauuauugugcugcuuu NW_020090470.1:26080323..26080387:+
DRO_25017_3737 8.6e+4 169224 169216 0 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaacugugcugcugaa NW_020090504.1:49722077..49722142:-
DRO_27742_33745 6.7e+4 132612 69513 0 63099 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucucagccccuacuagacugaagcuccuugagga NW_020093479.1:46099958..46100016:-
DRO_28094_43125 6.6e+4 129604 129548 0 56 yes blast agcuacaucuggcuacugggucuc ggcucaguagccaguguagauc ggcucaguagccaguguagauccugucuuuuguaaucaguagcuacaucuggcuacugggucuc NW_020093861.1:4864473..4864537:+
DRO_27088_23088 6.3e+4 124164 124097 18 49 yes blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucuuacugaagguuuccuggaaaccacgcacaugcuguugccacuaaccucaaccu NW_020092766.1:15206912..15206991:+
DRO_27698_32248 6.2e+4 122616 107741 1 14874 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga NW_020093431.1:11578690..11578750:-
DRO_26179_17793 5.8e+4 115322 115319 0 3 yes blast aaaagcuggguugagagggcga gccuucucuucccgguucuucccg gccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggcga NW_020091783.1:7450876..7450930:+
DRO_26422_20647 5.0e+4 99776 99691 0 85 yes blast uagguaguuuccuguuguuggg ucgacagcacgauacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgauacugccuuc NW_020092046.1:7004723..7004780:-
DRO_24984_2597 4.6e+4 91114 51846 0 39268 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuuuaguaacaucacaagucaggcucuugggaccu NW_020090470.1:19320514..19320575:-
DRO_27586_26140 4.5e+4 89648 88752 0 896 yes blast caaaacgugaggcgcugcuau cagcagcaauucauguuuugaa cagcagcaauucauguuuugaagugcuuuacauuguucaaaacgugaggcgcugcuau NW_020093308.1:33104022..33104080:-
DRO_25342_9270 4.3e+4 84385 78786 0 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaagagcuuucagucggauguuuacagc NW_020090861.1:27603152..27603216:+
DRO_25342_8857 4.2e+4 83731 77675 1 6055 yes blast uaauacugccugguaaugaugac caucuuacugggcagcauugga caucuuacugggcagcauuggauggugucgggucucuaauacugccugguaaugaugac NW_020090861.1:237528..237587:+
DRO_27851_37310 4.0e+4 78799 78728 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuugaacucggcaacaagaaacugccuga NW_020093597.1:27860628..27860686:+
DRO_27753_34599 3.1e+4 60879 60785 0 94 yes blast uagguaguuucauguuguuggg caacgacauuaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacauuaaaccacccga NW_020093491.1:2992869..2992928:-
DRO_25533_12723 2.9e+4 58116 58100 0 16 yes blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugagaacagaggccagacccaccgagggaugaaugucac NW_020091072.1:3473280..3473344:-
DRO_25573_13187 2.9e+4 57243 52059 0 5184 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccauuuaaauccacggguuaggcucuugggag NW_020091115.1:8361935..8361995:-
DRO_26875_22199 2.7e+4 53738 53027 0 711 yes blast uucaaguaauucaggauagguu ccuguucuccauuacuuggcuc uucaaguaauucaggauagguugugugccauccagccuguucuccauuacuuggcuc NW_020092531.1:15249600..15249657:-
DRO_24984_2210 2.7e+4 53196 52234 0 962 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauucuagucaagaugcgaaucauuauuugcugcucu NW_020090470.1:26080183..26080240:+
DRO_25482_12341 2.5e+4 49220 49167 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc NW_020091016.1:9333042..9333121:-
DRO_27698_32249 2.4e+4 48780 48224 0 556 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuuccaga caaagugcuguucgugcagguagugugauuaucugaccuacugcugagcuagcacuuccaga NW_020093431.1:11578894..11578956:-
DRO_28094_43127 2.4e+4 47153 45507 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguugagcaacagcuacauugucugcuggguuu NW_020093861.1:4865175..4865237:+
DRO_27902_38799 2.2e+4 44521 44359 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc NW_020093652.1:3456717..3456777:+
DRO_25533_12621 2.0e+4 39645 39216 46 383 yes blast uucacaguggcuaaguuccg agggcuuagcugcuugugagca agggcuuagcugcuugugagcagggucugcaccaagucguguucacaguggcuaaguuccg NW_020091072.1:3498595..3498656:+
DRO_25353_10047 1.8e+4 36653 36647 1 5 no blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaacgggauccggugguucuagacuugccaacu NW_020090872.1:9330952..9331016:-
DRO_25749_14387 1.8e+4 36248 36122 0 126 yes blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauuaaaaucacauugccagggauuaccacg NW_020091304.1:2344620..2344681:+
DRO_28008_42071 1.7e+4 35121 33690 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa NW_020093767.1:3777380..3777437:+
DRO_25440_11658 1.4e+4 29086 28949 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac NW_020090969.1:15984215..15984277:-
DRO_27648_29063 1.4e+4 27740 20947 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu NW_020093376.1:19023183..19023239:+
DRO_27927_39813 1.2e+4 24403 24333 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca NW_020093679.1:584112..584173:+
DRO_25749_14693 1.1e+4 23262 17299 6 5957 yes blast agagguaguagguugcauaguu cuauacaaccuacugccuuucu agagguaguagguugcauaguuuuuagggcagggauuuugcccaggaggagguaacuauacaaccuacugccuuucu NW_020091304.1:1352006..1352083:-
DRO_27698_32252 1.0e+4 21035 19049 0 1986 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccuguccaugcuaccgcacuguggguacuugcu NW_020093431.1:11579114..11579174:-
DRO_25533_12725 1.0e+4 20989 18901 0 2088 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc NW_020091072.1:3473456..3473517:-
DRO_27390_24575 9.8e+3 19334 19325 0 9 no blast ucacagugaaccggucucuuu gggggccgaugcacuguacgaga gggggccgaugcacuguacgagagugaguagcaggucucacagugaaccggucucuuu NW_020093099.1:23412900..23412958:+
DRO_26197_18046 9.7e+3 19071 19067 0 4 yes blast uuagggcccuggcuccaucuccu aguggggcuucgacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuucgacccuaacc NW_020091805.1:3365652..3365717:+
DRO_28008_42624 9.0e+3 17659 17658 0 1 yes blast acgcccuucccccccuucuuca aggagggaggagaugggc aggagggaggagaugggccaaguucccucugccuggaacgcccuucccccccuucuuca NW_020093767.1:21321317..21321376:-
DRO_28094_43252 8.9e+3 17526 16913 0 613 yes blast augcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcugucagaaugcaaugcaccugggcaaggauucuga NW_020093861.1:2237590..2237652:-
DRO_28094_43248 8.9e+3 17524 16911 0 613 yes blast augcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcugucagaaugcaaugcaccugggcaaggauucuga NW_020093861.1:2235773..2235835:-
DRO_27586_26137 8.2e+3 16094 12957 0 3137 yes blast gaguguuguuucugcugcccgg uagcagcgggaacaguacug uagcagcgggaacaguacugcagugggugauagguaaucuggaguguuguuucugcugcccgg NW_020093308.1:33103705..33103768:-
DRO_27754_34953 8.0e+3 15708 7144 0 8564 yes blast cacgcucaugcacacacccaca ugagugugugugugugagugu ugagugugugugugugagugugugucgcuccggguccacgcucaugcacacacccaca NW_020093492.1:24093758..24093816:+
DRO_25353_10068 7.2e+3 14257 14226 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauacaauuuucuagcaccaucugaaaucgguua NW_020090872.1:10214099..10214159:-
DRO_27390_24628 6.2e+3 12345 12249 0 96 yes blast agcugguguugugaaucaggccg gcuacuucacaacaccagggu agcugguguugugaaucaggccguugccaaccagagaacggcuacuucacaacaccagggu NW_020093099.1:28481815..28481876:+
DRO_25091_5651 6.2e+3 12205 12196 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagcgcauccucuuacccggcuauuucacgacaccaggguu NW_020090583.1:6476241..6476310:-
DRO_28105_43703 5.9e+3 11600 11594 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu NW_020093872.1:39117360..39117420:+
DRO_25902_16393 5.9e+3 11600 11594 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucaacuguucaauggauuugguccccuucaaccagcugu NW_020091471.1:42355269..42355329:+
DRO_27810_35592 5.8e+3 11542 10259 0 1283 yes blast cacuccuccccucccgucuucu aggacgggaggagaggagggcg aggacgggaggagaggagggcgugguuuucugcagguccucacuccuccccucccgucuucu NW_020093552.1:8054871..8054933:+
DRO_27586_25987 4.9e+3 9680 9661 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucuuaaacaucuagcaaaucauuuuuuacucucca NW_020093308.1:20318921..20318982:-
DRO_27587_27130 4.8e+3 9571 7342 0 2229 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcaaauagaacugucucacacagaaaucgcacccguc NW_020093309.1:3502014..3502079:-
DRO_25533_12619 4.8e+3 9490 9233 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccugucacaaaucacauugccagggauuucca NW_020091072.1:3498423..3498481:+
DRO_25017_3455 4.7e+3 9384 8152 0 1232 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua NW_020090504.1:11567294..11567352:-
DRO_27810_35623 4.1e+3 8225 3528 0 4697 no blast agccacugcccacugcacacug cugugcgugugacagcggcuga agccacugcccacugcacacugcgcugcuccggacccacugugcgugugacagcggcuga NW_020093552.1:9129394..9129454:+
DRO_27020_22605 4.1e+3 8121 7173 0 948 yes blast uccgguucucagggcuccacc aggaagcccuggaggggcuggagg aggaagcccuggaggggcuggaggugauggauguguuccuccgguucucagggcuccacc NW_020092687.1:2960208..2960268:+
DRO_25573_13289 3.8e+3 7568 6730 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau NW_020091115.1:20048970..20049030:-
DRO_28094_43058 3.7e+3 7370 7360 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugggguagggauuugaggccccaauuagaagauaacuauacaacuuacuacuuuccc NW_020093861.1:239978..240058:+
DRO_27742_33719 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaaugcauggauuggcugggagguggauguuuacuuc NW_020093479.1:43434752..43434812:-
DRO_27902_39245 3.4e+3 6758 6722 0 36 yes blast ucccuguccuccaggagcuc cuccucgaggccagagccc ucccuguccuccaggagcucgcugacgucggccgugcgcuccucgaggccagagccc NW_020093652.1:24115926..24115983:-
DRO_26422_20622 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucugaauaugauagaagucagugcacuacagaacuuugu NW_020092046.1:6051125..6051185:-
DRO_25749_14738 3.0e+3 6059 6057 0 2 yes blast gaauaggggacuacaucu cugcguuuucugucugucu cugcguuuucugucugucuuuguggcagcccagauugaauaggggacuacaucu NW_020091304.1:6242912..6242966:-
DRO_24984_2603 2.9e+3 5874 5061 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu NW_020090470.1:19365330..19365390:-
DRO_25353_10051 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa NW_020090872.1:9334949..9335011:-
DRO_25382_10368 2.6e+3 5163 5003 0 160 yes blast gucaacacuugcugguuuccucu gggagccaggaaguauugauguu gggagccaggaaguauugauguuucugcuaguguagcgucaacacuugcugguuuccucu NW_020090905.1:928851..928911:-
DRO_25393_11125 2.5e+3 5064 4982 0 82 yes blast ugagaacugaauuccauaggccgu ugcccuaggaacucaguucug ugagaacugaauuccauaggccgugagcucuagcaaaugcccuaggaacucaguucug NW_020090917.1:21014997..21015055:-
DRO_28094_43258 2.5e+3 5036 4098 0 938 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguuggcaucuuaauuacccucccacacccaaggcuugca NW_020093861.1:2242895..2242954:-
DRO_25017_3454 2.3e+3 4710 4487 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug NW_020090504.1:11567152..11567215:-
DRO_25749_14514 2.2e+3 4430 4429 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc NW_020091304.1:14488538..14488597:+
DRO_27088_23244 2.0e+3 4069 2992 0 1077 yes blast uaaugccccuaaaaauccuuau aaggacuuucaggggcagcugug aaggacuuucaggggcagcuguguuuccuaucuuaggccauaaugccccuaaaaauccuuau NW_020092766.1:2305976..2306038:-
DRO_27587_26204 1.8e+3 3579 3566 0 13 no blast acccgucccgugcguccccggac cgggaacgucgagacuggagc acccgucccgugcguccccggacgcugcucucugccccgggaacgucgagacuggagc NW_020093309.1:2377856..2377914:+
DRO_27088_23246 1.7e+3 3342 2821 0 521 yes blast ugggucuuugugggcgagauga aacuggccuacaaagucccagu ugggucuuugugggcgagaugagagugucagaucaacuggccuacaaagucccagu NW_020092766.1:2315365..2315421:-
DRO_27088_23382 1.6e+3 3296 2963 26 307 no blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauugguguaaagcuggagacccacugccccaggugcugcug NW_020092766.1:10968114..10968170:-
DRO_27902_39002 1.6e+3 3173 3109 0 64 yes blast cuuggcaccuaguaagcacuca agugccugcuaugugccagg cuuggcaccuaguaagcacucaguaaauacuuguugagugccugcuaugugccagg NW_020093652.1:20850033..20850089:+
DRO_27698_32380 1.5e+3 3048 2992 0 56 yes blast uaaugccccuaaaaauccuuau agggacuuuugggggcagaugug agggacuuuugggggcagauguguuucgauuccacuaucauaaugccccuaaaaauccuuau NW_020093431.1:23937636..23937698:-
DRO_25342_8859 1.2e+3 2492 2115 0 377 yes blast uaacacugucugguaacgaugcu caucuuaccggacagugcugga caucuuaccggacagugcuggacuucucggcucggcucuaacacugucugguaacgaugcu NW_020090861.1:238024..238085:+
DRO_25017_3449 1.1e+3 2155 2146 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu NW_020090504.1:11566847..11566906:-
DRO_22988_200 9.1e+2 1785 1781 0 4 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucugaaagguacaguacugugauaacugaa NW_020088466.1:652..709:-
DRO_24921_1212 9.1e+2 1785 1781 0 4 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucugaaagguacaguacugugauaacugaa NW_020090403.1:318025..318082:-
DRO_27243_24020 8.9e+2 1758 1757 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa NW_020092933.1:4350628..4350685:-
DRO_27698_32382 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu NW_020093431.1:23942489..23942548:-
DRO_27088_23324 5.8e+2 1148 1088 1 59 yes blast uaacagucuacagccauggucg accguggcuuucgauuguuacu accguggcuuucgauuguuacugugggaaccggagguaacagucuacagccauggucg NW_020092766.1:6654021..6654079:-
DRO_25573_13292 5.5e+2 1090 926 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu NW_020091115.1:20082213..20082269:-
DRO_25017_3448 5.5e+2 1082 1073 0 9 yes blast ugugcaaauccaugcaaaacuga aguuuugcagguuugcauccagc aguuuugcagguuugcauccagcugugugauguucugcugugcaaauccaugcaaaacuga NW_020090504.1:11566710..11566771:-
DRO_27871_37738 4.9e+2 973 972 0 1 yes blast uguaacagcaacuccaugugga ccaguggggaugcuguu uguaacagcaacuccauguggacuguguacugauuuccaguggggaugcuguu NW_020093619.1:7214035..7214088:+
DRO_25025_3977 4.3e+2 846 844 1 1 yes blast gccauugaugaucguucuu aacgcagucuggguggu gccauugaugaucguucuucucuuccuuuggcagaguaagggagagaacgcagucuggguggu NW_020090515.1:1085808..1085871:-
DRO_27598_28734 4.1e+2 802 472 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg NW_020093320.1:1727165..1727229:+
DRO_27810_35747 4.0e+2 788 767 0 21 yes blast uguaacagcaacuccaugugga ccaauggggcugcuguuaucu uguaacagcaacuccauguggaagugcccacugguuccaauggggcugcuguuaucu NW_020093552.1:3340757..3340814:-
DRO_26300_19850 3.8e+2 752 277 0 475 yes blast cauuauuacuuuugguacgcg ucguaccgugaguaauaaugcg cauuauuacuuuugguacgcgcugugacacuucaaacucguaccgugaguaauaaugcg NW_020091914.1:17204967..17205026:+
DRO_25440_11493 3.5e+2 701 697 2 2 yes blast cuggcccucucugcccuuccgu ggggggcaggaggggcucaggg ggggggcaggaggggcucagggagaaaguaugugaagccccuggcccucucugcccuuccgu NW_020090969.1:18003126..18003188:+
DRO_27587_26817 3.1e+2 615 571 0 44 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagagg augcugacauauuuacuagagggugagauuaauagccuucuaguaagaguggcaguugaag NW_020093309.1:52114329..52114390:+
DRO_25637_13976 2.7e+2 528 527 0 1 yes blast agaguugagucuggacgucccg ugauuguccaaacgcaauucucga ugauuguccaaacgcaauucucgagucucuggcuccggccgagaguugagucuggacgucccg NW_020091182.1:19368156..19368219:-
DRO_27754_34878 2.2e+2 440 420 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca NW_020093492.1:11429428..11429490:+
DRO_26279_19170 2.2e+2 441 440 0 1 no blast uucccuuugucauccuuugccua gcagggacagcaaaggggugc uucccuuugucauccuuugccuagggcucugagaggggcagggacagcaaaggggugc NW_020091892.1:11011377..11011435:+
DRO_24898_835 2.1e+2 423 318 0 105 yes blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua NW_020090379.1:603607..603665:-
DRO_28094_43255 2.0e+2 407 382 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca NW_020093861.1:2242500..2242560:-
DRO_25353_10070 2.0e+2 407 346 4 57 yes blast gcugguuucauuuggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauuuggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu NW_020090872.1:10214418..10214482:-
DRO_27749_33954 2.0e+2 401 372 0 29 yes blast ucuacagugcacgugucuccagu ggagacgcggcccuguuggagu ucuacagugcacgugucuccaguguggcucggaggcuggagacgcggcccuguuggagu NW_020093486.1:14474914..14474973:+
DRO_27753_34576 1.9e+2 374 135 1 238 yes blast agguucugugauacacuccgacu ucagugcaugacagaacuugggc agguucugugauacacuccgacucgggcucugcagcagucagugcaugacagaacuugggc NW_020093491.1:2436121..2436182:-
DRO_25342_9385 1.7e+2 340 339 0 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugagcaauagugaaggaagcaaucagcaaguauacugcccu NW_020090861.1:5367089..5367154:-
DRO_27587_26165 1.7e+2 347 343 0 4 no blast cgguucguuucccggucaggg ccuggccgguguggcucag ccuggccgguguggcucagggacugagugccggccuguggaccacaaggucgucgguucguuucccggucaggg NW_020093309.1:261275..261349:+
DRO_25342_9386 1.7e+2 346 339 0 7 no blast uggcagugucuuagcugguuguu ggccagcugugaguguuu ggccagcugugaguguuucuuuggcagugucuuagcugguuguu NW_020090861.1:5367131..5367175:-
DRO_27088_23183 1.5e+2 301 238 1 62 yes blast cagugccucggcagugcagcc gugcauugcuguugcauug gugcauugcuguugcauugcaugugugugaggugggugcagugccucggcagugcagcc NW_020092766.1:21312387..21312446:+
DRO_25932_17112 1.1e+2 229 185 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua NW_020091505.1:17195221..17195285:+
DRO_25789_15575 1.0e+2 202 196 0 6 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguacauaacucaauagccggaagcccuuaccccaaaaagca NW_020091348.1:3688765..3688828:-
DRO_25353_9776 1.0e+2 199 197 0 2 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaag cuuuuugcggucugggcuugcuguuccucucaauaguagucaggaagcccuuaccccaaaaag NW_020090872.1:8262690..8262753:+
DRO_27586_26135 8.9e+1 173 167 0 6 yes blast ucggggaucaucaugucacgag ugugacagauugauaacugaaag ucggggaucaucaugucacgagauaccacugugcacuugugacagauugauaacugaaag NW_020093308.1:33098645..33098705:-
DRO_27849_36929 6.6e+1 137 135 0 2 no blast ugaccuggggcucggagagcug gcugcucgauccacuggucc ugaccuggggcucggagagcugcuugcacucauucagcugcucgauccacuggucc NW_020093595.1:10134635..10134691:-
DRO_25353_9809 6.3e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaaccguuuuucauuauugcuccugacc NW_020090872.1:9918294..9918353:+
DRO_27754_35234 5.4e+1 104 102 0 2 yes blast cagggcugggcugggcuggg ggggcuggggccaagccu ggggcuggggccaagccugcccaggggcagggcagggcugggcugggcuggg NW_020093492.1:23811475..23811527:-
DRO_25139_6619 4.3e+1 84 83 0 1 yes blast cucucccuuccucucugaa gcagugggggggggggg cucucccuuccucucugaaagcagugggggggggggg NW_020090638.1:20198517..20198554:-
DRO_25749_14752 4.2e+1 81 78 0 3 yes blast uacacacacacacacacacaug auguaugugugugugugugu auguauguguguguguguguauauauauauacauacacacacacacacacacaug NW_020091304.1:9413570..9413625:-
DRO_27594_28034 4.2e+1 90 84 0 6 no blast aaugcgguggaccugggccagau uuggccugggcacacgcauca aaugcgguggaccugggccagaugagcaguuucuacauuggccugggcacacgcauca NW_020093316.1:3661115..3661173:+
DRO_27839_36393 3.5e+1 76 75 0 1 no blast cccuagcugguuuggcucag guucgauucccagucggg cccuagcugguuuggcucaguggauugaauaccaaccugugaaucaaggggucacugguucgauucccagucggg NW_020093585.1:11864811..11864886:-
DRO_26777_21675 3.4e+1 66 61 4 1 yes blast uuggcccuggcuggucuggcu auucccagucagggcac uuggcccuggcuggucuggcucaguggauugagugccagccuacaaaccaaaaggucgcugguucgauucccagucagggcac NW_020092423.1:16030454..16030537:-
DRO_27849_36717 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucauuuccugcccuggcccgagggaccgacu NW_020093595.1:7390334..7390395:+
DRO_27088_23377 3.3e+1 62 23 0 39 yes blast uagcagcacagaaauauuggca ccaauauuggcugagcugcuccag uagcagcacagaaauauuggcacugggaagagugucugccaauauuggcugagcugcuccag NW_020092766.1:10724133..10724195:-
DRO_28187_45021 3.2e+1 60 39 0 21 yes blast uuauaaagcaaugagacugauc uccgucucaguuacuuuauagcc uuauaaagcaaugagacugaucgucaugugucgagugugggauccgucucaguuacuuuauagcc NW_020093960.1:877411..877476:-
DRO_25533_12664 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucagggggcucugaauguguacaguagucugcacauugguu NW_020091072.1:966765..966827:-
DRO_27749_34133 3.0e+1 56 46 0 10 yes blast agcggacuggccgccugcuucu agccaggcggucaauacgcug agcggacuggccgccugcuucucguucagcagagccaggcggucaauacgcug NW_020093486.1:14937265..14937318:-
DRO_27902_38789 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu NW_020093652.1:3255555..3255609:+
DRO_25342_9046 2.5e+1 60 59 0 1 no blast gucaucguugucaucauca ccugguggggggggggc gucaucguugucaucaucaccugguggggggggggc NW_020090861.1:14845878..14845914:+
DRO_25139_6152 1.8e+1 59 58 0 1 no blast gaugaugcucuaaccaacugacc cagggccccaguaucuc gaugaugcucuaaccaacugacccaccuggccagggccccaguaucuc NW_020090638.1:22989804..22989852:+
DRO_27728_32672 1.5e+1 29 27 0 2 yes blast cccuucaguccacaggcug gcauguguccugacugggaaucaaa gcauguguccugacugggaaucaaacuggcgacccuucaguccacaggcug NW_020093464.1:694863..694914:-
DRO_25342_9439 1.5e+1 36 35 0 1 no blast agcccggcugguguggcucagu cagggcacaugccuggguu agcccggcugguguggcucaguggauucaggaccgacugugaaccaaaggggugccaguucgauucccagucagggcacaugccuggguu NW_020090861.1:7869140..7869230:-
DRO_25815_15792 1.4e+1 27 26 0 1 yes blast uauauauauauauguacguaug uacguagauauauauguauuu uauauauauauauguacguauguguauaugaauguauacguagauauauauguauuu NW_020091377.1:1478588..1478645:+
DRO_27851_37293 1.3e+1 30 29 0 1 no blast uccgccccgucccccucccaga gucggagggugcgcgggguugaaggcg gucggagggugcgcgggguugaaggcgggccgcuccgccccgucccccucccaga NW_020093597.1:27386794..27386849:+
DRO_27975_40944 1.3e+1 23 21 0 2 yes blast uuacaguuguucaaccaguuacu uaaccaguugaacaacugaaccc uuacaguuguucaaccaguuacuaaucuaacuaauuguaaccaguugaacaacugaaccc NW_020093731.1:9141231..9141291:+
DRO_28155_44945 1.1e+1 20 15 0 5 yes blast ucaaaugcucagacuccuguggu ccacggauguuugagcaugugcua ucaaaugcucagacuccugugguggcugcucaugcaccacggauguuugagcaugugcua NW_020093927.1:4590540..4590600:-
DRO_26300_19941 1.1e+1 34 30 0 4 no blast ugcaggaggcagcugauggau cgauguuucucucugucucuccu ugcaggaggcagcugauggauguuccucucauaucgauguuucucucugucucuccu NW_020091914.1:7904879..7904936:-
DRO_27088_23287 1.1e+1 19 10 0 9 yes blast ugaggggccucagaccgagcuu gucucgcucucugccccucagc ugaggggccucagaccgagcuuuuggaaaauagaaaagucucgcucucugccccucagc NW_020092766.1:4889903..4889962:-
DRO_25341_8821 1.0e+1 16 8 0 8 yes blast ugccccccgccccccgcccca gggagaggggcgggcggc ugccccccgccccccgccccaggauggcauuggcgcagaguucacgggcgcacagacuggggagaggggcgggcggc NW_020090860.1:8072652..8072729:-
DRO_27698_31953 8.3 17 11 0 6 yes blast uaauuuuauguauaagcuagu gagcuuauucauaaaaguacag gagcuuauucauaaaaguacaguauaauccaauaaaccuguaauuuuauguauaagcuagu NW_020093431.1:14896117..14896178:+
DRO_24984_2159 7.8 12 11 0 1 yes blast agggcacguaccuggguugcaggc cugcgaaucagaggguc cugcgaaucagagggucgcugguuugauuccccgucuagggcacguaccuggguugcaggc NW_020090470.1:22645137..22645198:+
DRO_25533_12562 7.7 12 10 0 2 yes blast uaaccaaugugcagacuacugu agguagucugaacacuggg uaaccaaugugcagacuacuguacacauucagagcccccugaacagguagucugaacacuggg NW_020091072.1:966764..966827:+
DRO_24984_1983 5.7 9 8 0 1 yes blast uuagcaucuggcacuauggacu caccauggacucccagauguuagcgacu caccauggacucccagauguuagcgacuagcucuauggauucccagauguuagcaucuggcacuauggacu NW_020090470.1:2598452..2598523:+
DRO_27871_37913 5.2 15 14 0 1 no blast gccgcugccgcugcugcug aggcgcgggggcggggc gccgcugccgcugcugcuguuuguggcagggagcgcacagccccauuuauaaaggcggaggcgcgggggcggggc NW_020093619.1:11936735..11936810:-
DRO_25212_7286 4.5 19 18 0 1 no blast uggguugagagggcgag ggccgcuggacccaagg uggguugagagggcgagaaacaaguaaaagucaagugcaccccaaggcuucggccgcuggacccaagg NW_020090717.1:2520145..2520213:+
DRO_26279_19527 3.8 12 9 0 3 no blast ugccccccgccccccgccccc aggagccgggcggccug ugccccccgccccccgcccccaguauggagcgaugguuggcgaucccccgagugaggagccgggcggccug NW_020091892.1:12200900..12200971:-
DRO_27749_34136 3.3 11 10 0 1 no blast gagcuggguguugucugcag ugcuggccccgcucugucucca ugcuggccccgcucugucuccagagccuccacccuggcuuggagcuggguguugucugcag NW_020093486.1:14939361..14939422:-
DRO_27739_32808 3.0 11 7 0 4 no blast uuggcccuggcuggcguggcuc auucccggucagggcac uuggcccuggcuggcguggcucaguugguuggugcuuuguccugcagaguggaaggucgccaguuuaauucccggucagggcac NW_020093476.1:2336407..2336491:+
DRO_25091_5513 3.0 5717 5715 2 0 yes blast gaggggggccaggguggg cugcuggcucuccuugg cugcuggcucuccuuggcucggugcuugugcuucuuguggccgaggggggccaggguggg NW_020090583.1:10597089..10597149:+
DRO_27648_28998 2.9 17 11 0 6 yes blast cuuccccccucagccccug cggggguuggggggggg cuuccccccucagccccuggacugugaacggggguuggggggggg NW_020093376.1:12947919..12947964:+
DRO_25341_8621 2.9 16 16 0 0 yes blast cucagccacacugggac cugugguggccugggug cugugguggccugggugcaggcgguggcacugccuggcucagccacacugggac NW_020090860.1:7324107..7324161:+
DRO_27810_35612 2.9 54 54 0 0 yes blast ggaggggcagggagcgagacu ucaaggguccaggccccuccgc ggaggggcagggagcgagacugcgaggucaaggguccaggccccuccgc NW_020093552.1:8560122..8560171:+
DRO_27851_37313 2.9 42566 39299 0 3267 yes blast uccgagccugggucucccucu ggggguccccggugcucggau ggggguccccggugcucggaucucgagagugcucauuguucgguccgagccugggucucccucu NW_020093597.1:27902165..27902229:+
DRO_26300_19973 2.9 34 34 0 0 yes blast gccgccgccgccgcccgcc ugggagaggggcggggccu gccgccgccgccgcccgcccacuuccgggccauaccggaaccggaaguacaggugggagaggggcggggccu NW_020091914.1:10536504..10536576:-
DRO_27934_39907 2.9 49 49 0 0 yes blast gugugugugugugagugu gcaugcacagcgcacacac gugugugugugugaguguggcuaccucuccuccggccccuggccgggggccgcgcaugcacagcgcacacac NW_020093688.1:1263937..1264009:-
DRO_27088_22890 2.8 125 125 0 0 yes blast cgcgggagccccgggga ccuucgggguggcagcc cgcgggagccccggggagaggcgauccgcugccuccucccuucgggguggcagcc NW_020092766.1:5878439..5878494:+
DRO_27088_23534 2.8 14 10 4 0 yes blast cuggggcaggggcaggggcag ccuucuguucucacgcccuggcu ccuucuguucucacgcccuggcugaggccccagccuacauggacccugggggcugggccuggcugcuggggcaggggcaggggcag NW_020092766.1:21346103..21346189:-
DRO_27587_26802 2.7 16688 16660 3 25 yes blast gcgcgccuguagucccagcuacuc cugggcuguagugcgcu gcgcgccuguagucccagcuacucgggagguugaggcaggaggagcgcuugagcccaggaguacugggcuguagugcgcu NW_020093309.1:51619331..51619411:+
DRO_25139_6576 2.7 21 21 0 0 yes blast ucgggcucgggcuggggcucg uucuccagccugaccucccc uucuccagccugaccuccccucgcugucucugcugcugcuuugugagcugggcucgggcucgggcuggggcucg NW_020090638.1:16375786..16375860:-
DRO_25465_11900 2.7 17 11 0 6 yes blast cagccccagccccagccccag ggcaggcggcgggccggc ggcaggcggcgggccggcggcgcucccccucgcucaccucugcugccccagccccagccccagccccag NW_020090996.1:4034971..4035040:-
DRO_25128_5891 2.7 20 20 0 0 yes blast aaauaauuuuaagacug guguugaaauuacauucg aaauaauuuuaagacuguauaaauguaacuacuccuuaacuguuaagguguugaaauuacauucg NW_020090627.1:4613576..4613641:-
DRO_25482_12018 2.7 58 58 0 0 yes blast cggcggcagcagcggcggc cgcggcgcugccgagcu cggcggcagcagcggcggcgacggcgucugcgcaggguaaacgugguaccgcggcgcugccgagcu NW_020091016.1:5302760..5302826:+
DRO_27753_34598 2.6 27 26 0 1 yes blast uugaccccagcccucuccaggc gggggugggguaggggc gggggugggguaggggcaaagcugugauacccucuuugaccccagcccucuccaggc NW_020093491.1:2992063..2992120:-
DRO_25052_5290 2.6 27 26 0 1 yes blast uugaccccagcccucuccaggc gggggugggguaggggc gggggugggguaggggcaaagcugugauacccucuuugaccccagcccucuccaggc NW_020090542.1:3363135..3363192:-
DRO_25533_12703 2.6 60 60 0 0 yes blast cggggcugggcugggcugggu cucucugcucaucucugcu cggggcugggcugggcuggguagagccagcugcugcagagcuggcugaccucucugcucaucucugcu NW_020091072.1:2670645..2670713:-
DRO_27088_23379 2.6 254 249 5 0 yes blast cagcagcacacugugguuugua caaaccacacugugguguuagagcgag cagcagcacacugugguuuguacggcacuguggccacguccaaaccacacugugguguuagagcgag NW_020092766.1:10724446..10724513:-
DRO_27088_23326 2.6 59 59 0 0 yes blast uaacagucuccagucacggcu ccuuggcuguagacugccuacc ccuuggcuguagacugccuaccgccggggccacccucaguaacagucuccagucacggcu NW_020092766.1:6655972..6656032:-
DRO_25342_8985 2.6 105 105 0 0 yes blast cagggcugggcugggcuggg ucugccgagaacgagaacggg ucugccgagaacgagaacgggaggcuccuagccacaggagcucccagggcugggcugggcuggg NW_020090861.1:10426564..10426628:+
DRO_26422_20456 2.6 rRNA 61 61 0 0 yes blast aaaaaaaaaaaaaaaaa uuuuuuuuuuuuuuuaa aaaaaaaaaaaaaaaaauuuuuuuuuuuuuuuuuaa NW_020092046.1:4657541..4657577:+
DRO_26300_20051 2.6 877 876 0 1 yes blast ucccugcccuccaggagcucac gcugagggagggcggga ucccugcccuccaggagcucacagcccaggagagaagaacagcgcuguggggaaagggggcaggugcugagggagggcggga NW_020091914.1:16456630..16456712:-
DRO_25037_4505 2.5 25871 25871 0 0 yes blast ucccuguucgggcgcca guccgugcagguccu guccgugcagguccugaaagucccuguucgggcgcca NW_020090527.1:14731304..14731341:+
DRO_26300_19745 2.5 126 126 0 0 yes blast agccagcagcgggugugagc uucccgcuggggaggcccc uucccgcuggggaggccccuccuccucggagggggagccagcagcgggugugagc NW_020091914.1:10899892..10899947:+
DRO_25342_9346 2.5 12 12 0 0 yes blast gcgacccacucuugguuucc aaauccagagcgggugaggccu aaauccagagcgggugaggccugucugaccguuucuaggcgacccacucuugguuucc NW_020090861.1:1811247..1811305:-
DRO_27849_36925 2.5 37 35 2 0 yes blast agcccuggcugguguggcucag gaguugcuggccaggucccc agcccuggcugguguggcucaguggauggagcgcuggccugcgaaucaaaggguuaccaguucgauucccagucuagggcacaugccugaguugcuggccaggucccc NW_020093595.1:10030765..10030873:-
DRO_25533_12727 2.5 28 28 0 0 yes blast uguuccugcugaacugagccag guguuucagcucaguaggcacggg uguuccugcugaacugagccagucuguacaaaucaacuguguuucagcucaguaggcacggg NW_020091072.1:3498735..3498797:-
DRO_25128_5815 2.5 433 433 0 0 yes blast aauggcgccacuaggguug acccuaggagaucgugccauuca acccuaggagaucgugccauucacauagacaauaauugaauggcgccacuaggguug NW_020090627.1:6786461..6786518:+
DRO_26179_17920 2.5 52 52 0 0 yes blast ucugcuugcucugguggagu ucccaccagaggaggcccagg ucccaccagaggaggcccaggcugcggggcugaauuggaguuggcucgccccgaaccucugcuugcucugguggagu NW_020091783.1:4438342..4438419:-
DRO_26259_18797 2.5 18 18 0 0 yes blast cagcagcagcagcggcggc agcucggugccugcaagc agcucggugccugcaagcagagccugccucggggucugcagcagcagcagcagcggcggc NW_020091871.1:5112118..5112178:+
DRO_27390_24731 2.5 12075 12018 57 0 yes blast gcgcgccuguagucccagcuacuc guucuggguuguagugugcua gcgcgccuguagucccagcuacucggaaggcugaggcagaaggaucgcuucaguccaggaguucuggguuguagugugcua NW_020093099.1:1237807..1237888:-
DRO_27708_32469 2.5 1889 1843 1 45 yes blast uuaucagaaucuccagggguac ccgggugugauucugauuug uuaucagaaucuccagggguacuuguacuuugaaaaaguaccccgggugugauucugauuug NW_020093442.1:1117336..1117398:-
DRO_27810_35471 2.5 36 36 0 0 yes blast gcgggcgggcgggcuggcc ccaggcuggugcuuggua ccaggcuggugcuugguauacagacagcgggcgggcgggcuggcc NW_020093552.1:1190017..1190062:+
DRO_27998_41892 2.5 402723 402723 0 0 yes blast uccuguacugagcugccccgag cagcggccagcucugaccucguc cagcggccagcucugaccucguccucccugagggauccuguacugagcugccccgag NW_020093757.1:1593205..1593262:-
DRO_28105_44319 2.5 2075 2075 0 0 yes blast gaaauaauuuuaagacugugu ggaguugaaauugcaucca gaaauaauuuuaagacugugugacuguuaacuacuccuuaacugucaaggaguugaaauugcaucca NW_020093872.1:45529895..45529962:-
DRO_24898_578 2.5 16 16 0 0 yes blast uccuucauuccaccggagucugu agauuucaguggagugaaguuca uccuucauuccaccggagucugucucguacccaaccagauuucaguggagugaaguuca NW_020090379.1:2044038..2044097:+
DRO_27594_28614 2.5 11 11 0 0 yes blast cugcucgccgccgcucccaccu gcgggaguggaagcgcgagcagga gcgggaguggaagcgcgagcaggagccgagcccgcucggggcugcucgccgccgcucccaccu NW_020093316.1:34949329..34949392:-
DRO_27658_29887 2.5 29 29 0 0 yes blast cccagggcucugaugugucu ucacagguccuaagggug cccagggcucugaugugucucucacagguccuaagggug NW_020093387.1:1055868..1055907:+
DRO_27849_36601 2.5 17 15 0 2 no blast uggugguggugggggggugc acuugcccaaggcuguua acuugcccaaggcuguuauguugggaucaguuauucugcguguguguggugguggugggggggugc NW_020093595.1:561555..561621:+
DRO_27587_26708 2.5 58 58 0 0 yes blast gggggcggggaggggggca gaccuguccgugccccccu gggggcggggaggggggcaaagguagguaggaccugacauccagaacccucacaggcucuaccugucuggaccuguccgugccccccu NW_020093309.1:44010582..44010670:+
DRO_27658_30503 2.5 29 29 0 0 yes blast cccagggcucugaugugucucu gggcauuggggccaaggagca cccagggcucugaugugucucucacagcuccuaagggugagacccugagggcagaaaguggggggcauuggggccaaggagca NW_020093387.1:949171..949254:-
DRO_26875_21873 2.5 25871 25871 0 0 yes blast ucccuguucgggcgcca guccgugcagguccu guccgugcagguccugaaagucccuguucgggcgcca NW_020092531.1:18247355..18247392:+
DRO_25037_4509 2.5 25871 25871 0 0 yes blast ucccuguucgggcgcca guccgugcagguccu guccgugcagguccugaaagucccuguucgggcgcca NW_020090527.1:15011956..15011993:+
DRO_26422_20694 2.4 12 12 0 0 yes blast gccuggccuguguggcucagu ccacccaccuugggaaaugcug ccacccaccuugggaaaugcugguuagaggaacccaccucuggccuggccuggccuguguggcucagu NW_020092046.1:12911646..12911714:-
DRO_25573_13063 2.4 28 26 0 2 yes blast cagugcaaugauauugucaaagc gcucugacgagguugcacuacu gcucugacgagguugcacuacugugcucugagaagcagugcaaugauauugucaaagc NW_020091115.1:21286086..21286144:+
DRO_25341_8581 2.4 63 63 0 0 yes blast agugccugcuaugugccagg uggcauagauaggagaacuga uggcauagauaggagaacugaugucgaagugccugcuaugugccagg NW_020090860.1:4574395..4574442:+
DRO_27390_25063 2.4 4569 4569 0 0 yes blast gggggccaggguggggggag ucccccacgagucccccgac gggggccaggguggggggagaugagaaggaggagaagcagagagggagagaaucuucccccacgagucccccgac NW_020093099.1:36711119..36711194:-
DRO_28146_44605 2.4 22 22 0 0 yes blast ccccgcgcuggcugucgccuca gggcgacugcuagucccgggaac gggcgacugcuagucccgggaaccgcccccgcgcuggcugucgccuca NW_020093916.1:8922143..8922191:+
DRO_27586_25735 2.4 88 88 0 0 yes blast caguacuguucccgcugcuagg gggcagcagaaacaacacucca gggcagcagaaacaacacuccagauuaccuaucacccacugcaguacuguucccgcugcuagg NW_020093308.1:33103707..33103770:+
DRO_25952_17589 2.4 136 136 0 0 yes blast cgccuguagucccagcuacu cuucugggcuguagggcgcu cgccuguagucccagcuacuugggaagcugaggcaggaggaaugcuugagcccaggacuucugggcuguagggcgcu NW_020091527.1:6605502..6605579:-
DRO_28008_42244 2.4 4326 4302 2 22 yes blast ggggguguagcucagugguagagc ucccuggcaccuccacu ggggguguagcucagugguagagcacgugcuucgcauguacgaggucccugguucgaucccuggcaccuccacu NW_020093767.1:17345387..17345461:+
DRO_27586_25342 2.4 37 37 0 0 yes blast ggggcagggagcgagacuua ccacuccacucccgcccaca ggggcagggagcgagacuuaggggggacacgguaucacacagcaggucgugaaggcuggucucccccuccacuccacucccgcccaca NW_020093308.1:1468678..1468766:+
DRO_25252_8299 2.4 49 46 3 0 yes blast cagccccagccccagccccagcu cuuggcagggguggacuggg cuuggcagggguggacuggggcauguccagugaacccuuguuuccucugccccagccccagccccagccccagccccagcu NW_020090761.1:4440327..4440408:+
DRO_27594_28124 2.4 81 81 0 0 yes blast gcggcggcggcggcggc cgagcagcggccgcac gcggcggcggcggcggcggagacgcacgagcagcggccgcac NW_020093316.1:8530368..8530410:+
DRO_27586_25824 2.4 16 16 0 0 yes blast cagggcagggcagggaaggg cuugccacugcugugccuuuga cuugccacugcugugccuuugacagaaaagccucucuccacucccagggcagggcagggaaggg NW_020093308.1:5050095..5050159:-
DRO_26568_20836 2.4 50 50 0 0 yes blast ucuggcugcuauggcccccucc gaggugccauucugagggccaggagu gaggugccauucugagggccaggaguuugauuaugugucacucuggcugcuauggcccccucc NW_020092200.1:2211352..2211415:-
DRO_25342_9654 2.4 92 92 0 0 yes blast gcgggcgggcgggaggcg cugucgcgcaccacccgcag cugucgcgcaccacccgcaggguacugcgggcgggcgggaggcg NW_020090861.1:25595880..25595924:-
DRO_25637_13760 2.4 167 167 0 0 yes blast uugguccccuucaaccagc ugguaaaacggaaccaagu ugguaaaacggaaccaaguccgucuuccugagagguuugguccccuucaaccagc NW_020091182.1:3505557..3505612:-
DRO_27982_41481 2.4 18 18 0 0 yes blast acucaaacugugggggcacuu gugccgccauuuuuugaguuc acucaaacugugggggcacuuucgguucugaggagaaagugccgccauuuuuugaguuc NW_020093738.1:395940..395999:-
DRO_27698_32195 2.4 20 20 0 0 yes blast uuacaguugugaguaugugaaag uuccauacucacaacuguaaac uuacaguugugaguaugugaaaguuuauuuuugugucauuauuuauuaauuaugguuuuauuuuccauacucacaacuguaaac NW_020093431.1:4206640..4206724:-
DRO_27587_27291 2.4 66 65 1 0 yes blast gccgccgccgccgccgcug gcggccccggggagcggccg gccgccgccgccgccgcugcugccuccuuagcugacaaggccaccgucuugaccccgacugguggcggcggccccggggagcggccg NW_020093309.1:20158218..20158305:-
DRO_27934_39860 2.4 17 17 0 0 yes blast uggggcugggggcggugggg cuacagaccccgggcagggccagg uggggcugggggcgguggggacugguaccaaggaagucagggcuuccguggggcgagguugcuacagaccccgggcagggccagg NW_020093688.1:1391243..1391328:+
DRO_27243_24267 2.4 34 34 0 0 yes blast gcgggagggcgcggcggcc ucagccucgccgagcccggaa gcgggagggcgcggcggccgccuaguugugggggaggggucugcagagcagcagcuucccgggggucagccucgccgagcccggaa NW_020092933.1:36034135..36034221:-
DRO_27594_28391 2.4 186 186 0 0 yes blast uggaagacuagugauuuuguuguu caacaagucacagcuuccuca uggaagacuagugauuuuguuguucugguguacuaugacaacaagucacagcuuccuca NW_020093316.1:1598665..1598724:-
DRO_25686_14156 2.4 3933 3933 0 0 yes blast uguguauguguguguauauaug uauauacauacaccaaauauaua uguguauguguguguauauauguauauauauuuauguauauauauauacauacaccaaauauaua NW_020091235.1:15227693..15227758:+
DRO_25139_6394 2.3 41 41 0 0 yes blast gggagggcggcggcggc cgccgaguccaguccgc gggagggcggcggcggcggcccgccgaguccaguccgc NW_020090638.1:53548680..53548718:+
DRO_27753_34517 2.3 34 34 0 0 yes blast uguguguguacguguguau gcauguauacaugcaug gcauguauacaugcaugugugcaugugugcauggugggugcauguagguacacauguguauauguguguguguacguguguau NW_020093491.1:21967765..21967848:+
DRO_25758_14952 2.3 40 40 0 0 yes blast ugauacgccaaggcuguggguuu uccccagucagggcacauucagg ugauacgccaaggcuguggguuugauccccagucagggcacauucagg NW_020091315.1:2342412..2342460:+
DRO_25758_15146 2.3 81 81 0 0 yes blast agaucugcugggaccugcc ccugggugcagaagcug ccugggugcagaagcuggugacagagcuggcagaucugcugggaccugcc NW_020091315.1:4661813..4661863:-
DRO_27880_38435 2.3 rRNA/tRNA 51 47 0 4 yes blast gguucgauucccggucaggg gcugguguagcucagug gcugguguagcucaguggguugagcacaggcuugaaaaccaaaaugucacugguucgauucccggucaggg NW_020093628.1:17170381..17170452:+
DRO_27587_26547 2.3 37 37 0 0 yes blast cagggcauguaccuggguugugggc cugcaaauggaaagguugcugguuugau cugcaaauggaaagguugcugguuugauucucagucagggcauguaccuggguugugggc NW_020093309.1:32144106..32144166:+
DRO_28105_44015 2.3 25 25 0 0 yes blast uggagugugacaaugguguuu acgccauuaucacacuaaaua uggagugugacaaugguguuuguguccaagcuaucaaacgccauuaucacacuaaaua NW_020093872.1:11365414..11365472:-
DRO_25573_13060 2.3 14 13 1 0 yes blast gaaccaagaggucgcuggu aggcccucaguuagg gaaccaagaggucgcugguucaauucccaggcagggcacaugccuggguugcgggacaggcccucaguuagg NW_020091115.1:21246913..21246985:+
DRO_27902_38896 2.3 491 491 0 0 yes blast ugagaacugaauuccauggguug accugugaaguucaguucuucag ugagaacugaauuccauggguuguaucaaugucagaccugugaaguucaguucuucag NW_020093652.1:11154509..11154567:+
DRO_26279_19321 2.3 652 652 0 0 yes blast uggacggagaacugauaagggu ccuuaucacuuuuccagccagc ccuuaucacuuuuccagccagcuuugagaaucugaguguuggacggagaacugauaagggu NW_020091892.1:22838536..22838597:+
DRO_25902_16123 2.3 34 34 0 0 yes blast cagggcauguaccuggguugcaggc ugguguggcucaguggauugagugccagcc ugguguggcucaguggauugagugccagccugugaaucaaaaggucaccaguucaaaucccaggcagggcauguaccuggguugcaggc NW_020091471.1:23809042..23809131:+
DRO_27902_39179 2.3 420 420 0 0 yes blast uugugcuugaucuaaccaugug caugguucugucaagcaccgcg uugugcuugaucuaaccaugugguggaacgauggaaacggaacaugguucugucaagcaccgcg NW_020093652.1:16618495..16618559:-
DRO_25902_15936 2.3 12 12 0 0 yes blast gguucgauucccugucgggg ccagaucggggugugccag gguucgauucccugucggggcacauaccuggguugugggccagguccccagaucggggugugccag NW_020091471.1:9670797..9670863:+
DRO_25139_6839 2.3 12 12 0 0 yes blast gccuggccuguguggcucagu auucccaguccgggcacaggccu gccuggccuguguggcucaguggacugagcgcgggcugugaccaaagggucggucgcuaguucaauucccaguccgggcacaggccu NW_020090638.1:58293518..58293605:-
DRO_27749_33820 2.3 27 27 0 0 yes blast guggcuaaguucugcaa gcagaaggucgcug guggcuaaguucugcaaagcagaaggucgcug NW_020093486.1:4407674..4407706:+
DRO_27975_40969 2.3 57 57 0 0 yes blast cccuccuuucccuuccucu aauggugggaaaggcccagg aauggugggaaaggcccaggcaggugcuucaggcugggcugcaccacucuacccuccuuucccuuccucu NW_020093731.1:10624684..10624754:+
DRO_27924_39533 2.3 24 17 5 2 yes blast ccgggcugggcugggcugggc ccaagccccuggggccu ccaagccccuggggccuucccuucuccccuccccgccccgccccuccgggcugggcugggcugggc NW_020093675.1:1577651..1577717:+
DRO_24984_2555 2.3 131952 131952 0 0 yes blast uuaaugcuaaucgugauagggguu cuccuacauguuagcauuaaca uuaaugcuaaucgugauagggguuuuuaccuccgacugacuccuacauguuagcauuaaca NW_020090470.1:13864791..13864852:-
DRO_25017_3517 2.3 37 37 0 0 yes blast caccaaaagguugcugguuu accaguucccugguugggguugug caccaaaagguugcugguuugauuccuggccauggcacaugccuggguugcagaccaguucccugguugggguugug NW_020090504.1:23786836..23786913:-
DRO_26300_19651 2.3 17409 16372 2 1035 yes blast gcaguccaugggcauauacacu uaugugccuuuggacuacaucg uaugugccuuuggacuacaucgugggagccagcaccaugcaguccaugggcauauacacu NW_020091914.1:1993225..1993285:+
DRO_27698_32047 2.3 19 19 0 0 yes blast uccacaccugaccccuggcau uccagggaacaggugcagagg uccagggaacaggugcagaggcucaucgcagagcacccuccacaccugaccccuggcau NW_020093431.1:20470193..20470252:+
DRO_25252_8360 2.3 3328 3328 0 0 yes blast uccggaugugcugaccccugcga ccagggcgaggcucauccauugc ccagggcgaggcucauccauugcgcuccggaugugcugaccccugcga NW_020090761.1:1866580..1866628:-
DRO_25758_14931 2.3 49 49 0 0 yes blast gaggaggaggaggaggaggaggag gaaccuccaggagcaacggccgccucag gaaccuccaggagcaacggccgccucagaagaugaggaggaggaggaggaggaggag NW_020091315.1:1534662..1534719:+
DRO_25749_14382 2.3 995 995 0 0 yes blast ggcaguagguuguauaguua acuaugcaaccuacuaccuc ggcaguagguuguauaguuaccuccuccugggcaaaaucccugcccuaaaaacuaugcaaccuacuaccuc NW_020091304.1:1352011..1352082:+
DRO_24984_2368 2.3 103 33 0 70 yes blast ccccaccuccucucuccucagg gugaggacucgggagguggag gugaggacucgggagguggaggguggcguugccagggccagggcacugucucagcucacuucuccccccaccuccucucuccucagg NW_020090470.1:43870124..43870211:+
DRO_27754_34856 2.3 30 30 0 0 yes blast gccuguggacugaaggguc cuguucgauucccagucag gccuguggacugaagggucaccuguucgauucccagucag NW_020093492.1:6144627..6144667:+
DRO_25749_14707 2.2 28 28 0 0 yes blast uguuccugcugaacugagccag gauaucagcucaguaggcaccgg uguuccugcugaacugagccaguguguaaaaugagaacugauaucagcucaguaggcaccgg NW_020091304.1:2345385..2345447:-
DRO_26979_22473 2.2 24 24 0 0 yes blast ggggugugcucagagcagg ugguuuaugacacacccaac ggggugugcucagagcagggggccugaagcaguggcccugugguuuaugacacacccaac NW_020092643.1:2250044..2250104:-
DRO_25139_6025 2.2 294 278 16 0 yes blast uguguauguguguguguauaug uguacaugcauauguguguaug uguacaugcauauguguguauguguguauguguguguauaugcguguguauguguguguguauaug NW_020090638.1:8874857..8874923:+
DRO_27587_27116 2.2 12 12 0 0 yes blast aauauaacacagauggccugu agguugucugugaugaguucg agguugucugugaugaguucgcgucauuaaugccgaauauaacacagauggccugu NW_020093309.1:2711945..2712001:-
DRO_24881_256 2.2 952 950 0 2 yes blast ugagugugugugugucagugg ucccuggcccugcacccc ugagugugugugugucagugggggucaccucccuggcccugcacccc NW_020090361.1:3231211..3231258:+
DRO_27658_29890 2.2 29 29 0 0 yes blast cccagggcucugaugugucucu gggcaggaacuggggggacugggac cccagggcucugaugugucucucacggcuccuaagggugagaccuugagggcaggaacuggggggacugggac NW_020093387.1:1074822..1074895:+
DRO_27941_39981 2.2 187 187 0 0 yes blast cacccugccugagcucuaaag cugggguuuccuggguggc cugggguuuccuggguggcucagggcaaggucagcccucaucuguguuuugccuggggccacccugccugagcucuaaag NW_020093695.1:6859788..6859868:+
DRO_27658_30519 2.2 160 160 0 0 yes blast ugagugugugagugugaguguga ccgcugcacacaggacagacacc ugagugugugagugugagugugagcagcccacagcuccgcugcacacaggacagacacc NW_020093387.1:1188525..1188584:-
DRO_26300_20002 2.2 58 58 0 0 yes blast acaguagucugcacauugguu ccaguguuuagacuaucuguuc ccaguguuuagacuaucuguucaggacucccaauuguacaguagucugcacauugguu NW_020091914.1:13022087..13022145:-
DRO_28105_43600 2.2 206 206 0 0 yes blast ggggccagggugggggg ucuggcccuggcgucag ggggccaggguggggggaaauuggucauugccucuggcccuggcgucag NW_020093872.1:28070685..28070734:+
DRO_25789_15644 2.2 14 14 0 0 yes blast ggguucaauucuggucagggc cucagcugguuggaacgucaucccau cucagcugguuggaacgucaucccauaaccaaaagguugcggguucaauucuggucagggc NW_020091348.1:12138650..12138711:-
DRO_25393_10751 2.2 53841 47357 0 6484 yes blast cucggcguggcgucggucgugg ucgaccggaccucgaccggcu ucgaccggaccucgaccggcucgucucuguugccaaucgacucggcguggcgucggucgugg NW_020090917.1:20292823..20292885:+
DRO_27982_41463 2.2 109 109 0 0 yes blast gaaccucugccccucccccaga agggggaggggcugggaguccu agggggaggggcugggaguccuggauaccuggguucucauuaggaaccucugccccucccccaga NW_020093738.1:109199..109264:+
DRO_27586_26116 2.2 12662174 12662174 0 0 yes blast uauugcacuugucccggccugu aggcggggacugguugcauuacu aggcggggacugguugcauuacuuguguuauauauaaaguauugcacuugucccggccugu NW_020093308.1:32848702..32848763:-
DRO_25025_4003 2.2 2097 2097 0 0 yes blast ucuuugguuaucuagcuguauga auaaagcuagauaaccgaaagua ucuuugguuaucuagcuguaugagugguguggagucuucauaaagcuagauaaccgaaagua NW_020090515.1:2672045..2672107:-
DRO_26777_21649 2.2 2097 2097 0 0 yes blast ucuuugguuaucuagcuguauga auaaagcuagauaaccgaaagua ucuuugguuaucuagcuguaugaguguauuggucuucauaaagcuagauaaccgaaagua NW_020092423.1:11354852..11354912:-
DRO_27586_26119 2.2 162 162 0 0 yes blast caaagugcucauagugcagguag acugcagugugggcacuuccag caaagugcucauagugcagguaguuuugccauuauucuacugcagugugggcacuuccag NW_020093308.1:32848966..32849026:-
DRO_28105_43453 2.2 414 414 0 0 yes blast ggguucgauucccggucaggg cuggcugggcaucaucccgc cuggcugggcaucaucccgcaaagugaaagguuguggguucgauucccggucaggg NW_020093872.1:11556572..11556628:+
DRO_27243_24043 2.2 74129 74127 0 2 yes blast caaagaauucuccuuuugggcuu cccaaaggugaauuuuuugggaa caaagaauucuccuuuugggcuuucuaaguuuauuuuaagcccaaaggugaauuuuuugggaa NW_020092933.1:9035364..9035427:-
DRO_25342_9413 2.1 15 11 0 4 yes blast ucgauucccagucagggaag gguccccgguugggggugugcaaga ucgauucccagucagggaagguacauggcuugugggccagguccccgguugggggugugcaaga NW_020090861.1:6813752..6813816:-
DRO_27941_39948 2.1 3933 3933 0 0 yes blast uguguauguguguguauauaug uguauauacacacacacauaua uguguauguguguguauauauguguguauauguauauguauauacacacacacauaua NW_020093695.1:3601194..3601252:+
DRO_25952_17476 2.1 145 145 0 0 yes blast ggucugaggccccucag guggggcaggaccuc ggucugaggccccucagcaaaugucccaggguauaccaagucuagcuacaccuugccaugugcccacagaccuuugugguggggcaggaccuc NW_020091527.1:8078816..8078909:+
DRO_25091_5680 2.1 17 17 0 0 yes blast ccuuucagucugcaggccg gccugcagcccaggcc gccugcagcccaggccugugccccaaccaggaaucaaaccggcgcccuuucagaccuuucagucugcaggccg NW_020090583.1:8925421..8925494:-
DRO_27587_27120 2.1 375 375 0 0 yes blast ucggauccgucugagcuugg aagcucagagggcucugauu aagcucagagggcucugauucagaaagaucaucggauccgucugagcuugg NW_020093309.1:2863493..2863544:-
DRO_27390_24649 2.1 130 130 0 0 yes blast ucaguggucuggggugc ucccuggaucgccuagg ucccuggaucgccuagggaugucugugcccccugccacccugagguccugauucaguggucuggggugc NW_020093099.1:29500024..29500093:+
DRO_28105_43628 2.1 20 20 0 0 yes blast uuacaguugugaguaugugaaag uuccauacaaacaacuauaaac uuacaguugugaguaugugaaaguuuauucuuguguuauuauuuauuauuauauuauuuuccauacaaacaacuauaaac NW_020093872.1:31384510..31384590:+
DRO_27687_31290 2.1 41 41 0 0 yes blast cccugccugagcucuaaag uuggagauucccaggaag cccugccugagcucuaaagcaagcugagauggcugcuacuugugcuggcuuuggagauucccaggaag NW_020093419.1:16092598..16092666:+
DRO_27739_32879 2.1 47 47 0 0 yes blast gugugugugugugagugu aauaggcauagcacacacag gugugugugugugaguguuugugcauguguguguauguguguuuagcaaauaauaggcauagcacacacag NW_020093476.1:4185126..4185197:-
DRO_25353_9954 2.1 38854 38853 0 1 yes blast gggagagaacgcagucugaguggu accauugaugauuguucu accauugaugauuguucuucucuuccuuuggaagaguaagagggagagaacgcagucugaguggu NW_020090872.1:1438453..1438518:-
DRO_27871_37939 2.1 2391484 2391484 0 0 yes blast aacauucauugcugucgguggg cgcugaacaaugaaugcaac aacauucauugcugucgguggguugaauuguguggacaagcucgcugaacaaugaaugcaac NW_020093619.1:14241392..14241454:-
DRO_27586_26118 2.1 1090 1089 0 1 yes blast ugugcaaauccaugcaaaacuga uuaguuuugcagguuug uuaguuuugcagguuugcauuucagcguauaucuguauauauggcugugcaaauccaugcaaaacuga NW_020093308.1:32848839..32848907:-
DRO_26197_18705 2.1 20 18 2 0 yes blast caaaggguccuggguuugau caggccagguacccagugga caaaggguccuggguuugauucucauuuagggcaagugccuggguugcaggccagguacccagugga NW_020091805.1:34722425..34722492:-
DRO_25212_7992 2.1 16 16 0 0 yes blast ucacuccugucagagacuagucccu ggacuguucuccagggguugag ggacuguucuccagggguugaguggagccaagagcccacuucacuccugucagagacuagucccu NW_020090717.1:28924933..28924998:-
DRO_27810_35745 2.1 3025 3025 0 0 yes blast ugaccuaugaauugacagccagu uggcugccaauuccauaggucaca ugaccuaugaauugacagccagugcucucaucuccccucuggcugccaauuccauaggucaca NW_020093552.1:3340546..3340609:-
DRO_28094_43345 2.1 333 333 0 0 yes blast cccuccgucccccucagugua caguguaggggguaucuggcu cccuccgucccccucaguguaaacggggaccacugugacaguguaggggguaucuggcu NW_020093861.1:8224879..8224938:-
DRO_26340_20396 2.1 37 37 0 0 yes blast cagggcauguaccuggguugugggc cugcaaaccuaaagguugcaaguucgac cugcaaaccuaaagguugcaaguucgacucccagucagggcauguaccuggguugugggc NW_020091958.1:19443566..19443626:-
DRO_27651_29624 2.1 39 39 0 0 yes blast ccacugauuggcugccuccug agaaccagccacucaggggug ccacugauuggcugccuccugcgcgccccgaccggggaaagaaccagccacucaggggug NW_020093379.1:15853514..15853574:+
DRO_27975_41225 2.1 116 116 0 0 yes blast auuuggaggcuucugcuguggu cacugcagaaauuuccgaacag auuuggaggcuucugcugugguuuuugucauuaaucacugcagaaauuuccgaacag NW_020093731.1:4918601..4918658:-
DRO_27598_28838 2.1 22 17 5 0 yes blast cuggaggaggaggaggagc ugcugcugauucuggcugggg ugcugcugauucuggcugggggguccuuggccuucauccugcugaggaggaggaggaggaagagcccuggaggaggaggaggagc NW_020093320.1:2322695..2322780:-
DRO_27687_31306 2.0 14 14 0 0 yes blast ccuuucagucugcaggccg gccugcaacccagguc gccugcaacccaggucugugcucugauugggaaucagaaccagcagccuuucagucugcaggccg NW_020093419.1:516705..516770:-
DRO_27851_37513 2.0 36 35 1 0 yes blast uggcccugacugaagacc uuucaagcagaggcccaa uggcccugacugaagaccagcaguuacacgauagcuguugguuucaagcagaggcccaa NW_020093597.1:23541019..23541078:-
DRO_28094_43057 2.0 7360 7360 0 0 yes blast ugagguaguaaguuguauuguu uacgaccucuugccuacugcc uacgaccucuugccuacugcccuugcuagaagauugcuugugccagggugagguaguaaguuguauuguu NW_020093861.1:239930..240000:+
DRO_27954_40544 2.0 rRNA/tRNA 11956 11954 1 1 yes blast ggggauguagcucagugguaga gagguccuggguucaau ggggauguagcucagugguagagugcaugcuuagcauguaugagguccuggguucaau NW_020093709.1:4386592..4386650:+
DRO_27880_38489 2.0 152 151 1 0 yes blast ugugugugugugugugugugu acagauacaaagacagacaga ugugugugugugugugugugugcuugagagagagagacaggcagacagauacaaagacagacaga NW_020093628.1:493426..493491:-
DRO_27739_32800 2.0 385 385 0 0 yes blast uggcaguguauuguuagcuggu cagcuaacacgcaacugcuauc uggcaguguauuguuagcugguugaugugcaaaugacaucagcuaacacgcaacugcuauc NW_020093476.1:1859438..1859499:+
DRO_28008_42138 2.0 80 80 0 0 yes blast acuccuggcuggcuggcca guuggugcuuauuuuuc acuccuggcuggcuggccaucuugugggugguuggugcuuauuuuuc NW_020093767.1:9680679..9680726:+
DRO_28094_43249 2.0 51 51 0 0 yes blast aauccuuggaaccuaggugugagu acacaccuauucaaggguuca aauccuuggaaccuaggugugagugcuauuucagugcaacacaccuauucaaggguuca NW_020093861.1:2237066..2237125:-
DRO_27658_31053 2.0 41 41 0 0 yes blast agccuccagcucuguggcug guuacauggcuuugu agccuccagcucuguggcuguugaacaaggaucugccuuugauuccuggcucagcuguuacauggcuuugu NW_020093387.1:20870877..20870948:-
DRO_27742_33036 2.0 111 111 0 0 yes blast ugugugugugugugugugugu auauauacauauauacaauau ugugugugugugugugugugucuguauaugugauauauauacauauauacaauau NW_020093479.1:13937344..13937399:+
DRO_24921_1216 2.0 46 46 0 0 yes blast gguucgauucccggucaggg uugacccauguggcucag uugacccauguggcucaguugguugaguguccuguugcaaagggaaagcucacugguucgauucccggucaggg NW_020090403.1:394475..394549:-
DRO_24898_658 2.0 12 12 0 0 yes blast auauauguauguguguaugugu auaugcacacguacauguauua auauauguauguguguauguguguauguguauaaacacacauacauauauaugcacacguacauguauua NW_020090379.1:8082507..8082577:+
DRO_25902_16414 2.0 46 46 0 0 yes blast uucccggacgcagcacca guccuguguccccgccgc guccuguguccccgccgccaugagguugcccaagccauaacacugcggcaucaacucuggguuucccggacgcagcacca NW_020091471.1:1847866..1847946:-
DRO_25353_9802 1.9 68 68 0 0 yes blast uuauggcccuucgguaauucacug gugaauucuaccagugccauacac uuauggcccuucgguaauucacugaccgagacuguucacagugaauucuaccagugccauacac NW_020090872.1:9334950..9335014:+
DRO_26279_19395 1.9 70 70 0 0 yes blast gcgggccccucuccucuccg gagagaaacggggccuaaau gcgggccccucuccucuccgacuuucggacccuuugaugggcuauuugcgaauuugcgggagagaaacggggccuaaau NW_020091892.1:6760027..6760106:-
DRO_27587_26327 1.9 1987 1987 0 0 yes blast uccuggcuggcucgcca gcuggccagccacaggaag gcuggccagccacaggaagcuggggaccacugaucagauuccccagaccagauccuuuccuggcuggcucgcca NW_020093309.1:15483670..15483744:+
DRO_25573_13195 1.9 23 23 0 0 yes blast aacccguagauccgaacuugug caagcuugugucuauagguaug aacccguagauccgaacuuguggugauaguccacacaagcuugugucuauagguaug NW_020091115.1:8422732..8422789:-
DRO_26300_19728 1.9 2409716 2409688 0 28 yes blast aacauucauugcugucgguggg cucacugaucaaugaaugcaaa aacauucauugcugucgguggguuugagucugaaucaacucacugaucaaugaaugcaaa NW_020091914.1:10397273..10397333:+
DRO_25139_6174 1.9 4127 4127 0 0 yes blast cgggugcuguaggcuuu ugccugcacugccugua cgggugcuguaggcuuucuucuccuaacgugccugcacugccugua NW_020090638.1:28936909..28936955:+
DRO_25573_13193 1.9 3211359 3211356 0 3 yes blast ugagguaguagguuguauaguu uacagccuccuagcuuuccu ugagguaguagguuguauaguuuagaauuacaucaagggagauaacuguacagccuccuagcuuuccu NW_020091115.1:8416327..8416395:-
DRO_25637_13841 1.9 281 281 0 0 yes blast ugagugugugugugugag cgcaugcacgggugagc ugagugugugugugugagaugcuuugagucuggugugucuucgcaugcacgggugagc NW_020091182.1:10413220..10413278:-
DRO_27586_25761 1.9 64 64 0 0 yes blast ugggugugugagugugugugg ccaaacgcuuucacaaacacu ugggugugugagugugugugggagugggaguguguaucuauuugcuuccgauccaaacgcuuucacaaacacu NW_020093308.1:1221434..1221507:-
DRO_27587_27670 1.9 122 122 0 0 yes blast ggaugaugcucuaaccaacugacc ucaguucuuuuauaugccc ucaguucuuuuauaugcccugaccagguauggauccccaaccuuggcauauggggaugaugcucuaaccaacugacc NW_020093309.1:49231211..49231288:-
DRO_27742_33271 1.9 58 58 0 0 yes blast gugugugugugugagugu acuauucggcacagcacuc acuauucggcacagcacucugccugugugugugugugagugu NW_020093479.1:38077416..38077458:+
DRO_27390_24935 1.9 138 138 0 0 yes blast ucccugguggucuagug ugggauucaggugagg ucccugguggucuagugguugggauucaggugagg NW_020093099.1:27463917..27463952:-
DRO_27651_29688 1.9 43184 43184 0 0 yes blast caccugguugauccugcc cagagucaccaggugcu cagagucaccaggugcuguuucagcucagacaugucgucauguaucagccaacucaccugguugauccugcc NW_020093379.1:3334236..3334308:-
DRO_26179_17926 1.8 14 14 0 0 yes blast uuugauuccuggucagggca accuagauugcagguucgaucc uuugauuccuggucagggcacauaccuagauugcagguucgaucc NW_020091783.1:5358190..5358235:-
DRO_27742_32961 1.8 92 77 15 0 yes blast gcauaauuugugguagu ugcacaugaugugcug ugcacaugaugugcugaccccugagauuuccccaaaugugggaaacucaaaugcauaauuugugguagu NW_020093479.1:8025287..8025356:+
DRO_26875_22072 1.8 480 480 0 0 yes blast gucccggcggagucgcca gccucucagcccaggcagcc gccucucagcccaggcagccaaugggacuccccaccaaauacccacacuucccggagagucccaaagugggucccggcggagucgcca NW_020092531.1:969810..969898:-
DRO_27998_41890 1.8 53 53 0 0 yes blast auucagaguccucaguc cacugcugaaggu cacugcugaaggucagauucagaguccucaguc NW_020093757.1:1405566..1405599:-
DRO_25037_4561 1.8 45 45 0 0 yes blast uguguguguacguguguau auauauguacacacacaca auauauguacacacacacacaaguauauaugugcauguauucugccacuacuuauauauguguguguguacguguguau NW_020090527.1:18841703..18841782:+
DRO_27698_32144 1.8 94 94 0 0 yes blast gcccugacugguuuggcucag aguucaauuccuagucagggcac gcccugacugguuuggcucaguugguugggcuuuucugcugcaaagcaaaagguuaccaguucaauuccuagucagggcac NW_020093431.1:27180122..27180203:+
DRO_28155_44958 1.8 11 11 0 0 yes blast ucugagccucaguuuccccacu gcugggagcuggcacucaggcc gcugggagcuggcacucaggccuggcgaugccacuacugccuagcacagcacagcccuugucugagccucaguuuccccacu NW_020093927.1:5506828..5506910:-
DRO_27658_30936 1.8 11 11 0 0 yes blast cugggcuggggaggggaggg uuccacucacagcuucuuc uuccacucacagcuucuuccugucauccugagacuggacaggaaguaccugggcuggggaggggaggg NW_020093387.1:13916346..13916414:-
DRO_25139_6698 1.8 rRNA 893 871 0 22 yes blast ccugguuaguacuuggaug gaagcuaagcagggucgg gaagcuaagcagggucggaccugguuaguacuuggaug NW_020090638.1:33476530..33476568:-
DRO_25252_8426 1.8 3916 3916 0 0 yes blast uguguauguguguguauauaug ugaguacauaggcauauauagg ugaguacauaggcauauauagguauauacuguguauguguguguauauaug NW_020090761.1:5235710..5235761:-
DRO_27871_37886 1.8 18 18 0 0 yes blast gaagcccuggaggggcuggagg cacagcuucaacagggugaucag cacagcuucaacagggugaucagauuuggggaucagugaggaucaaugaagcccuggaggggcuggagg NW_020093619.1:8152755..8152824:-
DRO_26422_20658 1.8 36 36 0 0 yes blast uaggucgcugguucgauucc guauggaucaguuaguugga guauggaucaguuaguuggagcaucaucccauaggucgcugguucgauucc NW_020092046.1:7959177..7959228:-
DRO_26197_18223 1.8 49 49 0 0 yes blast agaggaugaggagagggacacu ggccucuccgauccccaaa ggccucuccgauccccaaaaccaggaggucagaggaugaggagagggacacu NW_020091805.1:16769578..16769630:+
DRO_27849_36669 1.8 76 76 0 0 yes blast uacacacacacacacacacaug gggaugugaaugugcuuguaua gggaugugaaugugcuuguauacaccuacacacacacacacacacaug NW_020093595.1:5559770..5559818:+
DRO_25139_6267 1.7 3086 3086 0 0 yes blast gggagaggacgcaguccgagugg acugaagaucguuccucucuuccuu acugaagaucguuccucucuuccuuuggaagaguaagagggagaggacgcaguccgagugg NW_020090638.1:40423040..40423101:+
DRO_27742_33112 1.7 6331 6331 0 0 yes blast gauaauuuggguuggga ccaaucccauuuuugauc gauaauuuggguugggaaaagagauauggaggagggguuguuuauucuuuuauguacuuuuacccaaucccauuuuugauc NW_020093479.1:21486299..21486380:+
DRO_25482_12431 1.7 564 564 0 0 yes blast cccacccagggacgccu gugggaggggugguua cccacccagggacgccucuguuacucucuggaaguaaaauggggcagaaggaggugggaggggugguua NW_020091016.1:18100995..18101064:-
DRO_25393_10657 1.7 29 29 0 0 yes blast cuguccuccaggaggucacu uggcauucaggagauaagga uggcauucaggagauaaggaacacgguccuguccuccaggaggucacu NW_020090917.1:11156364..11156412:+
DRO_25902_16139 1.7 11 11 0 0 yes blast gguuugauucccggucagggaacuu guuugauuggcuggagcgucaucccgu guuugauuggcuggagcgucaucccguauaccaaaagguugaggguuugauucccggucagggaacuu NW_020091471.1:24754107..24754175:+
DRO_24898_838 1.7 158 57 0 101 yes blast uagcaccauuugaaaucaguguu cugguuucacaugguggcuuagau cugguuucacaugguggcuuagauuuuuccaucuuuguaucuagcaccauuugaaaucaguguu NW_020090379.1:604154..604218:-
DRO_25139_6207 1.7 12 12 0 0 yes blast auauauguauguguguaugugu acacacacacuauauguguca acacacacacuauaugugucauauauguauauguaugacauguauacauauggauauauguauguguguaugugu NW_020090638.1:35994206..35994281:+
DRO_27998_41995 1.7 60 60 0 0 yes blast gugugugugugugugugu ccaugcauauacacauau gugugugugugugugugugaauaguaacccaugcauauacacauau NW_020093757.1:18023156..18023202:-
DRO_24881_255 1.7 950 950 0 0 yes blast ugagugugugugugucagugg auuguaacaugcuaucucaau auuguaacaugcuaucucaauggcucaaagcugagugugagugugugugugucagugg NW_020090361.1:3231174..3231232:+
DRO_26300_20084 1.7 10 10 0 0 yes blast ugcagaugaggaaacugaggccu gccucguccuuucucauccacg gccucguccuuucucauccacgucuggugcagaugaggaaacugaggccu NW_020091914.1:18305804..18305854:-
DRO_27995_41637 1.7 29 29 0 0 yes blast ggcccuggcuggucuggcuc gccuucgaaccaaagggucac ggcccuggcuggucuggcucaguggauucacugucagccuucgaaccaaagggucac NW_020093752.1:1575248..1575305:-
DRO_27658_29948 1.7 15 15 0 0 yes blast cagggaagcugaccucugguu cccuuagcgggucaguuucccuuua cagggaagcugaccucugguuucaugugucugauuggaaauagaaaugccuggagcccuuagcgggucaguuucccuuua NW_020093387.1:2849859..2849939:+
DRO_25902_16540 1.7 52730 52725 1 4 yes blast agcagcauuguacagggcu agcuucuuuacagugcugccuug agcuucuuuacagugcugccuuguagcauucaggucaagcagcauuguacagggcu NW_020091471.1:18262846..18262902:-
DRO_27687_31242 1.7 27 27 0 0 yes blast uccugacugguuuggcucag aaaccaaaaggucacugguu uccugacugguuuggcucaguggguugggcauuguucccacaaaccaaaaggucacugguu NW_020093419.1:9742471..9742532:+
DRO_27594_27985 1.7 109 109 0 0 yes blast gcccugacugguuuggcucag gauaaauucagucagcaggaccg gauaaauucagucagcaggaccgagggcgaagaauuucaucugggcccugacugguuuggcucag NW_020093316.1:1690105..1690170:+
DRO_27871_37740 1.7 292 292 0 0 yes blast augaccuaugaauugacagacu ucugucacuucuauaggccaaua augaccuaugaauugacagacuguggcugagugugucugucacuucuauaggccaaua NW_020093619.1:7214296..7214354:+
DRO_25789_15763 1.7 86 86 0 0 yes blast aucgaggcuagagucacgcuu gugugcuagaguccucgaaga aucgaggcuagagucacgcuuggguaucagcuauugccuuagugugcuagaguccucgaaga NW_020091348.1:28964216..28964278:-
DRO_25128_5896 1.7 3165 3165 0 0 yes blast aucccaccagagucgcca ccaacucuagggggguca ccaacucuaggggggucagccugccacaggcagcuaggaucccaccagagucgcca NW_020090627.1:5208007..5208063:-
DRO_26775_21376 1.6 41106 41103 0 3 yes blast agcagcauuguacagggcu agcuucuuuacaguguugccuug agcuucuuuacaguguugccuuguggcauggaguucaagcagcauuguacagggcu NW_020092421.1:4046809..4046865:-
DRO_27088_22800 1.6 119 119 0 0 yes blast ccucucccuuccucucugug caaggcacaggaaggcagauuggg ccucucccuuccucucuguggcuaccacaaggcacaggaaggcagauuggg NW_020092766.1:802835..802886:+
DRO_27651_29550 1.6 21 21 0 0 yes blast uagaucugggguggggccu gugcuacugcuucauggucuacg uagaucugggguggggccugaaaauuugcuuuucuaacaaguucccaggugcuacugcuucauggucuacg NW_020093379.1:7784859..7784930:+
DRO_27587_26255 1.6 59 59 0 0 yes blast uuggcugcacauuagaaucaccu aggguucaauggccucaagg aggguucaauggccucaagguuccuuggcugcacauuagaaucaccu NW_020093309.1:7362522..7362569:+
DRO_25440_11574 1.6 177 177 0 0 yes blast ugugugugugugugugugugu acacacuuuauauauauaua acacacuuuauauauauauauauacacucuuuugugauaguugugugugugugugugugugugu NW_020090969.1:4730187..4730251:-
DRO_26279_19556 1.5 20 20 0 0 yes blast uucaaacccaugcuguucaagg uugagcucagguucgaacu uugagcucagguucgaacuguguggcucaguugaaaaaaaaaucugcauauaaauggacccacauaguucaaacccaugcuguucaagg NW_020091892.1:15926946..15927035:-
DRO_24898_923 1.5 189 189 0 0 yes blast cacccugccugagcucuaaag cuugugcuagguuuggagac cacccugccugagcucuaaagcaaucugagauggcugcuacuugugcuagguuuggagac NW_020090379.1:10751749..10751809:-
DRO_27902_38879 1.5 208 198 10 0 yes blast ugugugugugugugugugugu augugccagacaccacauu augugccagacaccacauuaaguuaauacaugagugugugugugugugugugugugugugugugugugugugu NW_020093652.1:10111690..10111763:+
DRO_27587_26845 1.5 62 62 0 0 yes blast uauccacugagccaaacc uuugguucacgggcuagc uuugguucacgggcuagcacucuauccacugagccaaacc NW_020093309.1:54740553..54740593:+
DRO_27587_26582 1.5 10 10 0 0 yes blast cuggggcaggggcaggggcag acuccuccucugugucagga cuggggcaggggcaggggcaggggcaggauaagguccgccacuccuccucugugucagga NW_020093309.1:34811888..34811948:+
DRO_27390_24670 1.5 13 13 0 0 yes blast ccucgccucgccucgccuc ggcuaucggggacggggau ccucgccucgccucgccucccucuccucuccagucaggcuaucggggacggggau NW_020093099.1:30601217..30601272:+
DRO_26422_20571 1.5 924 923 0 1 yes blast aagguuauagaaauuucagacaguc cgguuugaggccuggcccug cgguuugaggccuggcccugcugcacccagggcaagguuauagaaauuucagacaguc NW_020092046.1:19179606..19179664:+
DRO_25017_3739 1.5 4451 4442 1 8 yes blast uagcagcacauaaugguuug caggccauauugugcugcc uagcagcacauaaugguuuguggguuuugaaaagguacaggccauauugugcugcc NW_020090504.1:49722223..49722279:-
DRO_24984_2669 1.5 82 82 0 0 yes blast uguguauguguguguauguaug uauauacauacaauguaugaua uguguauguguguguauguauguauauauauauauacauacaauguaugaua NW_020090470.1:29056878..29056930:-
DRO_25789_15410 1.5 10 10 0 0 yes blast ucgauucccagucagggaag ucccuguugggggugugaga ucgauucccagucagggaagaagcaacucaguccugguugcgggcuggguucccuguugggggugugaga NW_020091348.1:21689065..21689135:+
DRO_27902_39206 1.5 137 137 0 0 yes blast aaacguugaucggcugccucu agggagaaacaucgauguguga agggagaaacaucgaugugugagagaaacguugaucggcugccucu NW_020093652.1:19249588..19249634:-
DRO_26689_20927 1.5 13 13 0 0 yes blast gcaccaaaagguugcug guggauugagugccc guggauugagugcccaccugugcaccaaaagguugcug NW_020092330.1:9093959..9093997:+
DRO_28008_42102 1.5 22 22 0 0 yes blast ccugcauguuagucuuagguucu gacucgacuagugugcggaca ccugcauguuagucuuagguucugauggaaaugacacacaauugugcugccauguuuucacugucaggacucgacuagugugcggaca NW_020093767.1:6182646..6182734:+
DRO_25952_17592 1.4 720 720 0 0 yes blast cccacugaugaacuugac caagcauuucuucagaggagug caagcauuucuucagaggagugcucaucuucccuguggguucaggccugaugugagcacccacugaugaacuugac NW_020091527.1:6918518..6918594:-
DRO_25952_17594 1.4 720 720 0 0 yes blast cccacugaugaacuugac caagcauuucuucagaggagug caagcauuucuucagaggagugcucaucuucccuguggguucaggccugaugugagcacccacugaugaacuugac NW_020091527.1:6920763..6920839:-
DRO_25353_10105 1.4 11 11 0 0 yes blast gacuagcugugugaccuugggc ccaaggucacagguauu gacuagcugugugaccuugggcaacacaguccaaggucacagguauu NW_020090872.1:13408157..13408204:-
DRO_25749_14566 1.4 16 16 0 0 yes blast aggaggcagcugaucagug uugaugcuucugucucugu aggaggcagcugaucaguguuucucacauugaugcuucugucucugu NW_020091304.1:18727628..18727675:+
DRO_28008_42355 1.4 10 10 0 0 yes blast gaggagggugggugcuggg cugcagcggucacucccacg cugcagcggucacucccacggagacgggaaggaggagggugggugcuggg NW_020093767.1:23802076..23802126:+
DRO_26689_21059 1.3 11 11 0 0 yes blast cccuggcauguguggcucagu uaggggcacauaccuggguu cccuggcauguguggcucaguggauugagugacagccugcaaaccaaagggacgcugauuugauucuccauuaggggcacauaccuggguu NW_020092330.1:12965924..12966015:-
DRO_27687_31425 1.3 13 13 0 0 yes blast uagguugugggcuccaucc uuggagcucauaggagagg uagguugugggcuccauccuuuguuggagcucauaggagagg NW_020093419.1:16134116..16134158:-
DRO_25017_3700 1.3 6063 6052 11 0 yes blast gaauaggggacuacaucu aaaaaaaaccccugugcuu aaaaaaaaccccugugcuuucugucugucuuuguggcagcccagauugaauaggggacuacaucu NW_020090504.1:46349567..46349632:-
DRO_24942_1454 1.3 12 12 0 0 yes blast auauauguauguguguaugugu auauauacacauauauguguau auauauguauguguguauguguguauauauacacauauauguguau NW_020090426.1:5441467..5441513:+
DRO_27586_26123 1.3 330 330 0 0 yes blast aaaagugcuuacagugcagguag acugcaaugcaagcacuucuuac aaaagugcuuacagugcagguagcuuuuugagaucuacugcaaugcaagcacuucuuac NW_020093308.1:32849359..32849418:-
DRO_27586_26133 1.3 40 40 0 0 yes blast uuuugcaauauguuccugaau uugggaacauuuugcaucuau uuuugcaauauguuccugaauaugugauauaaguguauugggaacauuuugcaucuau NW_020093308.1:33097438..33097496:-
DRO_26179_17719 1.3 14 14 0 0 yes blast aggacucagcaaccucccc ggaggugacagcucacucuuaa ggaggugacagcucacucuuaagucccagucuaggccccauucacugagcugcagcuaaggacucagcaaccucccc NW_020091783.1:2113845..2113922:+
DRO_25902_16141 1.3 10 10 0 0 yes blast gccagggcugcagucaucug gcugggcaguucuggcuc gcugggcaguucuggcucaggggucucacaugaggcugcagucgagaugucagccagggcugcagucaucug NW_020091471.1:25011865..25011937:+
DRO_27594_28569 1.2 11 11 0 0 yes blast ugggugaggggcugaggga ccuuggguuuucagaugca ugggugaggggcugagggaagcuucugggugacuggaagguccccuuggguuuucagaugca NW_020093316.1:28167518..28167580:-
DRO_27902_39113 1.2 23 23 0 0 yes blast uguguaugugugugucuaua ugcacaugcaugcauucc uguguaugugugugucuauaaauguguggauuugugcacaugcaugcauucc NW_020093652.1:8144288..8144340:-
DRO_27648_29097 1.2 21 19 0 2 yes blast uauugcuaauugaaaacuuuuccc uucagcaguggcaguauc uucagcaguggcaguaucauagccaaugagguuuguuuaucugaggcgugauuauugcuaauugaaaacuuuuccc NW_020093376.1:21637315..21637391:+
DRO_26422_20503 1.1 10 10 0 0 yes blast gaggagggugggugcuggg uugcgcccaucacugcuaugc uugcgcccaucacugcuaugcuccugacacuggaggagggaggagggugggugcuggg NW_020092046.1:10386802..10386860:+
DRO_26279_19373 1.1 9 9 0 0 yes blast agcccccccaccccccgcccc ggcggcuggacagggggcgucuug agcccccccaccccccgcccccucaaggggcggcuggacagggggcgucuug NW_020091892.1:5536951..5537003:-
DRO_26422_20519 1.1 9 9 0 0 yes blast ucagauuccuggucagggca cccugaccaguggggcu cccugaccaguggggcucaguugguugggcaucaucccacacagcaaaaagucgugggucagauuccuggucagggca NW_020092046.1:11952455..11952533:+
DRO_25266_8452 1.1 10 10 0 0 yes blast gaggagggugggugcuggg uugcgcccaucacugcuaugc uugcgcccaucacugcuaugcuccugacacuggaggagggaggagggugggugcuggg NW_020090775.1:615..673:-
DRO_25139_6138 1.1 11 10 1 0 yes blast acacaggggccucucaugcaaacug gccugccaucugagccagcccuuauaaag acacaggggccucucaugcaaacugcaugucagggagaagccugcacugaacugccugccaucugagccagcccuuauaaag NW_020090638.1:21587485..21587567:+
DRO_27753_34767 1.1 11 11 0 0 yes blast uuaggagggccguccugag cggggcuggcucuuaaagggac uuaggagggccguccugaguacggggcuggcucuuaaagggac NW_020093491.1:17056373..17056416:-
DRO_25637_13613 1.1 10 10 0 0 yes blast guuaagccuugguuguuguug gguacucaaggugcauccuu gguacucaaggugcauccuuugugugggcuaaguaacacacaaaguuaagccuugguuguuguug NW_020091182.1:15748741..15748806:+
DRO_25465_11746 1.0 9 9 0 0 yes blast cagggaggggaggaggggg cauuucuucuccccagg cagggaggggaggagggggcucuucugcuuaggggcagcgauggggaugaguccauuucuucuccccagg NW_020090996.1:3016998..3017068:+
DRO_27587_27880 1.0 15 15 0 0 yes blast cgauguuucugucucuccc gaggggcagcccaugugu gaggggcagcccauguguguuucucuccacaucgauguuucugucucuccc NW_020093309.1:67720887..67720938:-
DRO_26777_21413 1.0 128 128 0 0 yes blast ugugugugugugugugaguguau acauaucauuuaugauauauauguc acauaucauuuaugauauauaugucauaucucucuccauauaugugugugugugugugaguguau NW_020092423.1:838022..838087:+
DRO_27742_33152 1.0 1059 1004 55 0 yes blast aaggauuggcucuaaggg cuuagauacauauucuucu aaggauuggcucuaagggaguauaugcuucuuagauuggcucuaagggcauauaucuucuuagauacauauucuucu NW_020093479.1:24861433..24861510:+
DRO_27587_27443 1.0 11 11 0 0 yes blast ggcccgguagcucaguugguc uacacaagguugcgggcugg ggcccgguagcucaguuggucagagcauuguucugauacacaagguugcgggcugg NW_020093309.1:32610711..32610767:-
DRO_26775_21235 1.0 17 17 0 0 yes blast cagauuucugggccucauc cgaaucccgugauucugaa cgaaucccgugauucugaaaaacacagauuucugggccucauc NW_020092421.1:966041..966084:+
DRO_27851_37335 0.9 6542 6507 0 35 yes blast ucagugcaucacagaacuuugucu gaaguucuguuauacacucaggcu gaaguucuguuauacacucaggcuguggcucucugaaagucagugcaucacagaacuuugucu NW_020093597.1:28159033..28159096:+
DRO_24898_1005 0.9 9 6 3 0 yes blast guguguguguguguggguguau gcuuccgcacagaggacggauuu guguguguguguguggguguaugugcauguacgugcgugggugcgugugcagcuuccgcacagaggacggauuu NW_020090379.1:18577219..18577293:-
DRO_25212_7707 0.9 9 9 0 0 yes blast cggagcccgccgccucccccaga cgggggacacggggaggacagaa cgggggacacggggaggacagaagugaaggccauuucggagcccgccgccucccccaga NW_020090717.1:45946683..45946742:+
DRO_25789_15732 0.9 11 11 0 0 yes blast ugugggacugccaguuuca gugcugggauuucucacucc gugcugggauuucucacucccaagguauccuucccuauuuuaauccaccacaugugggugugggacugccaguuuca NW_020091348.1:23974497..23974574:-
DRO_27088_23173 0.9 9 9 0 0 yes blast cuggguggggggcgggggg ccucucacaccgaguc ccucucacaccgagucagguggucuugggauucaguccucaagggaccgcaagggcuggguggggggcgggggg NW_020092766.1:20602379..20602453:+
DRO_27587_26581 0.8 10 10 0 0 yes blast cuggggcaggggcaggggcag gcccccagcuucucugagga gcccccagcuucucugaggagaccuggggcaggggcaggggcag NW_020093309.1:34811865..34811909:+
DRO_27871_37765 0.8 9 9 0 0 yes blast gcagcauuuaaaaaaaaaaaaaa uuuuucuuugauuaucugcau uuuuucuuugauuaucugcaugaguguugggcuaagcagcauuuaaaaaaaaaaaaaa NW_020093619.1:11183875..11183933:+
DRO_26179_17790 0.8 162 162 0 0 yes blast uuccaugaugagcccugacu gaggguacuugcucauucaggauaa uuccaugaugagcccugacuuuuaggaggguacuugcucauucaggauaa NW_020091783.1:7430933..7430983:+
DRO_25932_17296 0.8 94 94 0 0 yes blast gcccugacugguuuggcucag gacccauacagcacagguuc gacccauacagcacagguucaacuacuaguuaagaagcugagcccugacugguuuggcucag NW_020091505.1:14109360..14109422:-
DRO_25342_8998 0.8 10 10 0 0 yes blast ggaagagcaugugcaaaggc uaugggcagaguggucugaggu ggaagagcaugugcaaaggcccuggggcaggaggagccaugugccucaagcacagagggcuaugggcagaguggucugaggu NW_020090861.1:12346458..12346540:+
DRO_25789_15238 0.8 6057 6057 0 0 yes blast agucgguagagcaucagac cagaugcucgcugaaguacuga agucgguagagcaucagacucuuaauaaauguauuaauccagcagaugcucgcugaaguacuga NW_020091348.1:255434..255498:+
DRO_27839_36276 0.8 15 14 0 1 yes blast acaggagcugaaggugcugugcu aagucacuuucugcucuuggaa acaggagcugaaggugcugugcuggaugaagcuaagaacaucaacaagucacuuucugcucuuggaa NW_020093585.1:24707718..24707785:+
DRO_28105_43622 0.7 9 9 0 0 yes blast cacugggcuggcauggcuc gccacagcuccugcc cacugggcuggcauggcucggcaaugcugcccaaggccacagcuccugcc NW_020093872.1:30758209..30758259:+
DRO_27587_26603 0.7 8 7 0 1 no blast ggaggcagccgaucaauga ugucugucugucugucu ggaggcagccgaucaaugaaugucugucugucugucu NW_020093309.1:36691332..36691369:+
DRO_27753_34747 0.7 40 40 0 0 yes blast ucuggcuguuguggugugcaa gccacacugcaacaccuuaca ucuggcuguuguggugugcaaaacucuguacauugcuauuuugccacacugcaacaccuuaca NW_020093491.1:16125763..16125826:-
DRO_27587_27336 0.7 9 5 4 0 yes blast ccugguugguguggcuc gcacaugccugggu ccugguugguguggcucaguggauugagcaccggccucugaaccagggggucacugguucgauuccagucagagcacaugccugggu NW_020093309.1:22993534..22993621:-
DRO_27658_30308 0.7 10 10 0 0 yes blast aaaguaggcuuacaguuguaau cacaacuauaaaccuacuuuug aaaguaggcuuacaguuguaauacaaauaaauaauacuacaagaauaaacugcguuucauguagacacaacuauaaaccuacuuuug NW_020093387.1:10506748..10506835:+
DRO_27975_41257 0.7 151 150 0 1 yes blast gcccugacugguuuggcucag auucccagucagggcac gcccugacugguuuggcucaguggauuaggugguguuguucugcaaaucaaaaaaagguuaccaauuucauucccagucagggcac NW_020093731.1:8339509..8339595:-
DRO_25482_11956 0.7 8 8 0 0 yes blast gaggagcuggggaccugggc ccaggccccaggcugca gaggagcuggggaccugggcaaggcuggccaggagaagcaguguccuggagccccaggccccaggcugca NW_020091016.1:338781..338851:+
DRO_27753_34756 0.7 11 11 0 0 yes blast uggggaucaagccugcaac ugucucccauuugcacccaga ugucucccauuugcacccagaccagggaucuaaccugcaaccuagguacaugcccugacuggggaucaagccugcaac NW_020093491.1:16489025..16489103:-
DRO_27390_24382 0.7 7230 7230 0 0 yes blast guuguggguuauuguuaa uccaauaaugcauguaaaaaccu guuguggguuauuguuaaacugauuauaagaggaccuccccuccaauaaugcauguaaaaaccu NW_020093099.1:5180102..5180166:+
DRO_24984_2291 0.7 33 33 0 0 yes blast gcaucaaucagcugccuccugc agagagggagagaaacauugaugugu agagagggagagaaacauugaugugugagagaagcaucaaucagcugccuccugc NW_020090470.1:34168315..34168370:+
DRO_27753_34682 0.6 226 211 0 15 yes blast cagugcaauaguauugucaaagc gcucugacuuuauugcacuacu gcucugacuuuauugcacuacuguacuuuauacacuagcagugcaauaguauugucaaagc NW_020093491.1:10343335..10343396:-
DRO_27749_33890 0.6 10 10 0 0 yes blast caucuacugguugccuccug guacccagaccagagaucau caucuacugguugccuccuguugcccagacgguacccagaccagagaucau NW_020093486.1:10673681..10673732:+
DRO_28008_42377 0.6 2175 2175 0 0 yes blast uccccguacgggccacca guggucagugaggugggcu uccccguacgggccaccaaaauguuaggguggucagugaggugggcu NW_020093767.1:193336..193383:-
DRO_27658_29889 0.6 29 29 0 0 no blast gcccagggcucugaugugucucu gggggcucccccacccuauaacuc gggggcucccccacccuauaacucugcuguugucucuuccccaggcagcgacagugcccagggcucugaugugucucu NW_020093387.1:1074766..1074844:+
DRO_25952_17420 0.6 98 98 0 0 yes blast auugugagcuccuggaa gcaucugcuccccuaaaugu auugugagcuccuggaagggcagggccaccucuucacauucuuucccucccuguccauugcaucugcuccccuaaaugu NW_020091527.1:2762464..2762543:+
DRO_28008_42128 0.6 20 20 0 0 yes blast agacuuuuaaucugagggu ccuuacuuaggucacc agacuuuuaaucugaggguguaggguuuaaaucccuauuugggcaucuguggccuuugacccuuacuuaggucacc NW_020093767.1:8933061..8933137:+
DRO_27658_30422 0.6 77 77 0 0 yes blast ccucucccuuccucucuguc cauuccaagggagaacca ccucucccuuccucucugucuaaaaaaguaauguccucauuuugagggcguggcauuccaagggagaacca NW_020093387.1:19815980..19816051:+
DRO_24942_1657 0.5 15 15 0 0 yes blast aacugaaaggucaccuguucg accaguguggcucaguugg accaguguggcucaguugguugaugucagccuggaaaaacugaaaggucaccuguucg NW_020090426.1:22837735..22837793:+
DRO_25382_10443 0.5 47 47 0 0 yes blast agagguaggaguuugugcugu aguagaggcucaaggcagaac agagguaggaguuugugcuguguagggucacaaggauaguagaggcucaaggcagaac NW_020090905.1:6884069..6884127:-
DRO_27088_23286 0.5 9 9 0 0 yes blast aacucugggauggggcccaga ucgcgcccuguuccagagcuac ucgcgcccuguuccagagcuacugaaucaggaacucugggauggggcccaga NW_020092766.1:4889289..4889341:-
DRO_25037_4826 0.5 8 8 0 0 yes blast ucaggucccuguucgggugcca guccgugcagguccugaaa guccgugcagguccugaaaauccucaggucccuguucgggugcca NW_020090527.1:12459950..12459995:-
DRO_27586_25933 0.5 669 659 0 10 yes blast ccgccgugacgacuugaaa gucucuacggaggcuga ccgccgugacgacuugaaauauagcuggcauuggcgauauuugacagucucuacggaggcuga NW_020093308.1:15556137..15556200:-
DRO_27975_41248 0.5 9 9 0 0 yes blast uggggcccaggaaucugcauuu augcagauucccuggguccagu augcagauucccuggguccaguucuagaauuucugauucaaucugucuggggcccaggaaucugcauuu NW_020093731.1:7589832..7589901:-
DRO_27941_40133 0.5 9 9 0 0 yes blast agggcugcucccagagc acugggagggguucuca acugggagggguucucacucacgcagggcugcucccagagc NW_020093695.1:20140183..20140224:+
DRO_26875_22285 0.5 14 14 0 0 yes blast ugaggaggaggaggaagaggag ccucucucucuucuuacccucuga ugaggaggaggaggaagaggaggaugaaaccagacguauagaauaaauaccugaccucucucucuucuuacccucuga NW_020092531.1:25844519..25844597:-
DRO_27910_39483 0.5 10 9 0 1 yes blast ccuaagucgguuagagggugagug uuuuaaagucugauuuuuggug ccuaagucgguuagagggugagugggauaagcaaugccaaacuuuuuaaagucugauuuuuggug NW_020093660.1:12680914..12680979:-
DRO_25482_11955 0.5 8 8 0 0 yes blast gaggagcuggggaccugggc uuggguucagcagaguuc uuggguucagcagaguuccucguuguccuacagggcagcuagaggagcuggaggagcuggggaccugggc NW_020091016.1:338731..338801:+
DRO_27910_39477 0.5 10 9 0 1 yes blast ccuaagucgguuagagggugagug uuuuaaagucugauuuuuggug ccuaagucgguuagagggugagugggauaagcaaugccaaacuuuuuaaagucugauuuuuggug NW_020093660.1:12671178..12671243:-
DRO_27839_36316 0.5 3256 3094 162 0 yes blast ugagugugugugugugaguga accaaccaccauacuugua accaaccaccauacuuguauacacauauggugugugugugugugugugugugugagugugugugugugaguga NW_020093585.1:1474526..1474599:-
DRO_26422_20455 0.4 rRNA 61 61 0 0 yes blast aaaaaaaaaaaaaaaaa uuuuuuuuuuuuuuuaa aaaaaaaaaaaaaaaaauuuuuuuuuuuuuuuuuaa NW_020092046.1:4657541..4657577:+
DRO_27975_40846 0.4 39 39 0 0 yes blast gaggcggcugaucaauguuu acauugaugucccucuc gaggcggcugaucaauguuucugucucacauugaugucccucuc NW_020093731.1:1657891..1657935:+
DRO_27587_27117 0.3 7 7 0 0 yes blast ucuuggaguaggucauugggu uggauggcuccuccaugucu ucuuggaguaggucauuggguggauccuuuauuucccuaugugggccacuggauggcuccuccaugucu NW_020093309.1:2861989..2862058:-
DRO_27871_37818 0.3 9 9 0 0 yes blast uggggcccaggaaucugcauuu cuauggauuccugggcugcuucccaga cuauggauuccugggcugcuucccagaucugcuaaaccgaaaucucugcaguggggcccaggaaucugcauuu NW_020093619.1:646941..647014:-
DRO_25201_7126 0.3 318 318 0 0 yes blast cucccaccccaccccaccccagg aggggcuggggaacauacgugagca aggggcuggggaacauacgugagcacaucccugccucccaccccaccccaccccagg NW_020090706.1:2986295..2986352:-
DRO_25482_12340 0.3 8 8 0 0 yes blast guuccauuccuggucagggcauau gggcccugacuaguguggaucaauug gggcccugacuaguguggaucaauugguucggcacauuguucuacaaggcaaaaggcugcugguuccauuccuggucagggcauau NW_020091016.1:8487442..8487528:-
DRO_27788_35448 0.3 9 9 0 0 yes blast cugagcaugugcccugaccagg ugaccaggcucaaacucacaa ugaccaggcucaaacucacaaccugagcaugugcccugaccagg NW_020093527.1:4520926..4520970:-
DRO_27742_33755 0.3 7 7 0 0 yes blast ccuccugugcccucugcagc gccagggguaugggggggg ccuccugugcccucugcagcugcacacguggggccagggguaugggggggg NW_020093479.1:46835750..46835801:-
DRO_25139_6147 0.3 61 61 0 0 yes blast gugugugugugugugugu gcauguccaugcgaau gcauguccaugcgaauucugaguguauguauguaggcauguguacauauugagaaugugugugugugugugugu NW_020090638.1:22939685..22939759:+
DRO_27975_40902 0.2 43 43 0 0 yes blast aggaaucgaacccgggacccu ugucuaugguucaauccucc aggaaucgaacccgggacccuuuugucuaugguucaauccucc NW_020093731.1:5661801..5661844:+
DRO_25252_8265 0.2 7 6 1 0 yes blast ugcccuggcuggugugacucaau ugggccacaccagccagggccgc ugggccacaccagccagggccgcaauaugcuuuuaaaaaaaaaaauuaaauguauugcccuggcuggugugacucaau NW_020090761.1:3387985..3388063:+
DRO_25212_7878 0.2 8 8 0 0 yes blast gcucugugccuggcccugg aggucaggcaaagaaggg aggucaggcaaagaagggcggauuuggaguucagaggcaacacacugacagcaggcacaccugcucugugccuggcccugg NW_020090717.1:17969193..17969274:-
DRO_27587_26446 0.2 10 10 0 0 yes blast ugaggaggaggaggaagaggag cuucuuuaggggaacuccuggca ugaggaggaggaggaagaggagaaggaaggcgcaagcugcgaggaaguggcaggauggagcucuucuuuaggggaacuccuggca NW_020093309.1:24121735..24121820:+
DRO_27020_22655 0.2 9 9 0 0 yes blast uucucucucucuuccuccca aggggcaugugagaggcaacu aggggcaugugagaggcaacucaucgauguuucucucgaacauugaugcuucucucucucuuccuccca NW_020092687.1:6216969..6217038:+
DRO_27651_29752 0.1 22 22 0 0 yes blast ugggcuggcuuuagcucagc ugggcugaguucuguuucuu ugggcugaguucuguuucuuguuggcauucucauucauauaaaaauaacaacaaugggcuggcuuuagcucagc NW_020093379.1:9722264..9722338:-
DRO_26875_21875 0.1 9 9 0 0 yes blast aacucugggauggggcccaga uaggccucacucccagauucug uaggccucacucccagauucugauucauuaacucugggauggggcccaga NW_020092531.1:18251124..18251174:+
DRO_27941_40053 0.1 7 7 0 0 yes blast caggacacaugcccggguugcag gcgaaccaaaggguugccaguucaauu gcgaaccaaaggguugccaguucaauucucugucaggacacaugcccggguugcag NW_020093695.1:12985384..12985440:+
DRO_25902_16426 0.1 28 26 0 2 yes blast uuuguggcuguggaugaguau cugcagccucugaacaca cugcagccucugaacacauuguucaugcaccucuuuguggcuguggaugaguau NW_020091471.1:3397811..3397865:-
DRO_25212_7921 0.1 16 16 0 0 yes blast ugugugugugugugugug uauauguuuacauacacauauu ugugugugugugugugugcaggaguggguauauauguuuacauacacauauu NW_020090717.1:22204153..22204205:-
DRO_27651_29729 0 11 11 0 0 yes blast aauguccuggcugaugcucuca agacgcaaaugccagguucuuauuag aauguccuggcugaugcucucaagaauaugaacaaugcugaaaagagacgcaaaugccagguucuuauuag NW_020093379.1:7059775..7059846:-
DRO_28105_43803 0 49 49 0 0 yes blast ugacugguuuucuggac ccagaacuccagcaga ugacugguuuucuggacuccagaacuccagcaga NW_020093872.1:48223922..48223956:+
DRO_25342_9474 0 7 7 0 0 yes blast cccccugcccugcccugccc gcuggguucucaggaagggg gcuggguucucaggaaggggccucugcugguaccccccugcccugcccugccc NW_020090861.1:12223273..12223326:-
DRO_26775_21322 0 7 7 0 0 yes blast uggcuccuggcuccuggcuccug gggccagugucuuggaaauuacu uggcuccuggcuccuggcuccuggcucauguugccagggccagugucuuggaaauuacu NW_020092421.1:7216059..7216118:+
DRO_28008_42263 0 12 12 0 0 no blast aaauuggagugguucuggaca uccagucacuccacagaga uccagucacuccacagagauuaaaauacuugcccguuuaagaaauuggagugguucuggaca NW_020093767.1:18206625..18206687:+
DRO_27975_40982 0 7 7 0 0 yes blast cacccugugugugugucugug aggacuacccucaggguguc cacccugugugugugucugugccugugagugggugucccuguguuggggcaugagggcuggccaggacuacccucaggguguc NW_020093731.1:11424326..11424409:+
DRO_27594_28355 0 7 7 0 0 yes blast ccucugccucugccccugc uggggugaugcgacggg uggggugaugcgacgggagggcacagcauuagaguggccuguguccuguccucugccucugccccugc NW_020093316.1:41106275..41106343:+
DRO_25025_3778 0 260 260 0 0 yes blast cucccucucccuuccucucug ggugagggagggaugaaugaaug cucccucucccuuccucucugucuaaagcaaugaaaaaaaugcccucaggugagggagggaugaaugaaug NW_020090515.1:638227..638298:+
DRO_25758_15040 0 844 844 0 0 yes blast gccauugaugaucguucuu acgcaguccgagugguaa gccauugaugaucguucuucucuuccuuugggagaguaagagggagagaacgcaguccgagugguaa NW_020091315.1:10946187..10946254:+