miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/efu/efu_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/efu.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/efu/efu_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/efu/efu_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/efu.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/efu/efu_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
105.16
956
856
74.96
64.96
54.86
44.76
35.16
25.96
11.96
01.16
-10.96
-216
-31.16
-41.16
-51.16
-61.16
-71.16
-81.16
-91.16
-101.16





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
EFU_116_31776 8.2e+6 16248955 15934747 0 314208 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaaaaaaccaccgaccguugacuguacc NW_007370766.1:2031537..2031597:+
EFU_480_40638 8.1e+6 15935707 15935583 0 124 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaguuaaagucaaaaccaucgaccguugauuguacc NW_007371130.1:123052..123114:+
EFU_480_40636 8.1e+6 15935707 15935583 0 124 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaguuaaagucaaaaccaucgaccguugauuguacc NW_007371130.1:117407..117469:+
EFU_140_33677 7.3e+6 14456432 14449954 0 6478 yes blast uauugcacuugucccggccugu agguugggaucaguugcaaugcu agguugggaucaguugcaaugcuguguuucuguaugguauugcacuugucccggccugu NW_007370790.1:96166..96225:+
EFU_155_34611 6.6e+6 13025427 13025346 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguguuuauauauaaaguauugcacuugucccggccugu NW_007370805.1:950957..951019:+
EFU_69_26415 8.4e+5 1654621 1625058 26 29537 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugauuuccccacuagauugugagcuccugga NW_007370719.1:1811840..1811902:+
EFU_1_923 6.2e+5 1231626 1205392 47 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaggccacagaugggcuuucagucggauguuugcagc NW_007370651.1:11968525..11968588:-
EFU_44_21273 6.1e+5 1206857 769711 0 437146 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu NW_007370694.1:9486233..9486292:+
EFU_104_30630 5.7e+5 1127155 1127053 1 101 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc NW_007370754.1:1023986..1024059:+
EFU_101_30361 5.6e+5 1113286 1107048 0 6238 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugaggacguccaggaucacaggugagguucuugggagc NW_007370751.1:793792..793851:-
EFU_33_17960 4.6e+5 915319 915221 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuauacccugggaguuaacuguacaaccuucuagcuuucc NW_007370683.1:519425..519492:+
EFU_104_30637 4.4e+5 872162 862673 100 9389 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgcuuuguucacaguggcuaaguucug NW_007370754.1:1770642..1770704:+
EFU_49_22520 4.4e+5 864986 863273 18 1695 yes blast ugagguaguaguuugugcuguu cugcgcaagcuacugccuug ugagguaguaguuugugcuguuggucggguugugacauugcccgcuguggagauaacugcgcaagcuacugccuug NW_007370699.1:5845038..5845114:+
EFU_44_21402 3.9e+5 774389 773598 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu NW_007370694.1:11019135..11019195:-
EFU_4_3646 3.2e+5 631640 629453 0 2187 yes blast caacggaaucccaaaagcagcug cugcgcuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc NW_007370654.1:39581867..39581931:+
EFU_93_29474 3.0e+5 601946 600186 113 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaaggaauuuuguggucacaaauucguaucuaggggaau NW_007370743.1:3025303..3025365:+
EFU_49_22615 2.6e+5 528911 528905 0 6 yes blast uucaaguaauccaggauaggcu ccuauucuugauuacuuguuuc uucaaguaauccaggauaggcuguuuccaccugugaggccuauucuugauuacuuguuuc NW_007370699.1:2129719..2129779:-
EFU_4_3981 2.6e+5 528841 528711 4 126 yes blast uucaaguaauccaggauaggcu ccuauucucgguuacuugcacg uucaaguaauccaggauaggcugugcaggucccgaugggccuauucucgguuacuugcacg NW_007370654.1:34957145..34957206:-
EFU_24_14985 2.1e+5 414276 413775 5 496 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagguucuucacugcgcccggcucggggcagcucaguacaggau NW_007370674.1:1569374..1569437:-
EFU_8_6527 2.1e+5 413793 413593 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacauagucacagauucgauucuaggggaaua NW_007370658.1:11647068..11647130:-
EFU_24_14832 2.0e+5 402768 402504 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagccgggcgcagugaagaaccucggggcagcucaguacaggau NW_007370674.1:1569375..1569438:+
EFU_7_5866 1.8e+5 363035 361974 566 495 no blast ccucgacacaaggguuugu accugcuucugggucgggguu accugcuucugggucgggguuucauacguagcagagcagcucccucacugcaaucuauugcaagucagcccucgacacaaggguuugu NW_007370657.1:11692379..11692467:-
EFU_144_33925 1.6e+5 332003 328518 0 3485 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcugc uguaaacauccccgacuggaagcuguaagacagaacuaagcuuucagucagauguuugcugc NW_007370794.1:848862..848924:-
EFU_1_919 1.5e+5 307494 285128 0 22366 yes blast uguaaacauccuacacucucagcu cugggagaaggcuguuuacucu uguaaacauccuacacucucagcuguggaaaguagaaaagcugggagaaggcuguuuacucu NW_007370651.1:11936239..11936301:-
EFU_54_23586 1.5e+5 306447 286172 0 20275 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaucucauggcaacagcagucgaugggcugu NW_007370704.1:7640741..7640800:+
EFU_101_30365 1.1e+5 227698 216275 0 11423 no blast cacccguagaaccgaccuugcg caagcucgugucuguggguccg cacccguagaaccgaccuugcggggccuucgccgcacacaagcucgugucuguggguccg NW_007370751.1:794496..794556:-
EFU_188_36296 1.0e+5 205453 205396 8 49 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucu ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucu NW_007370838.1:1541256..1541328:+
EFU_104_30632 1.0e+5 202955 202898 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguaguuauuuuacccuguucaggagauaacuauacaaucuauugccuuccc NW_007370754.1:1024371..1024449:+
EFU_101_30363 9.4e+4 186183 185039 35 1109 yes blast ugagguaggagguuguauaguu cuauacggccuccuagcuuucc ugagguaggagguuguauaguugaggaggacacccacggagaucacuauacggccuccuagcuuucc NW_007370751.1:794297..794364:-
EFU_17_11802 8.6e+4 169483 169389 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaacauuaaacaccaauauuauugugcugcuuu NW_007370667.1:6223020..6223084:+
EFU_74_27130 8.6e+4 169308 169299 1 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaauuaucuccaguauuaacugugcugcugaa NW_007370724.1:6483913..6483977:+
EFU_144_33937 6.8e+4 135077 71743 0 63334 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucucauccccuacuagacugaagcuccuugagga NW_007370794.1:2438052..2438110:-
EFU_84_28385 6.7e+4 132847 132781 0 66 yes blast agcuacaucuggcuacugggucuc ggcucaguagucaguguagauc ggcucaguagucaguguagauccugucuuuuauaaucaguagcuacaucuggcuacugggucuc NW_007370734.1:1248634..1248698:+
EFU_91_29311 6.3e+4 124630 124563 18 49 yes blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucuuacugaagguuuccuggaaaccacgcacaugcuguugccacuaaccucaaccu NW_007370741.1:907327..907406:-
EFU_15_11092 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga NW_007370665.1:7044817..7044877:-
EFU_68_26299 5.8e+4 115326 115322 0 4 yes blast aaaagcuggguugagagggcga gccuucucuucccgguucuucccg gccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggcga NW_007370718.1:7461991..7462045:+
EFU_125_32570 5.8e+4 114855 114778 0 77 yes blast uauugcacucgucccggccucc agggacgggacgcggugcagugu agggacgggacgcggugcaguguuguucuuucccccgccaauauugcacucgucccggccucc NW_007370775.1:1353213..1353276:-
EFU_3_2530 5.0e+4 99986 99887 0 99 yes blast uagguaguuuccuguuguuggg ucgacagcacgacacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgacacugccuuc NW_007370653.1:10144867..10144924:+
EFU_155_34593 4.5e+4 89646 88752 0 894 yes blast caaaacgugaggcgcugcuau cagcagcaauucauguuuugaa cagcagcaauucauguuuugaaguucuuuacaaugguucaaaacgugaggcgcugcuau NW_007370805.1:652624..652683:+
EFU_33_17962 4.3e+4 84565 45301 0 39264 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuucaguaacaucacaagucaggcucuugggaccu NW_007370683.1:566447..566508:+
EFU_66_26025 4.3e+4 84474 78788 87 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaggagcuuucagucggauguuuacagc NW_007370716.1:8262634..8262698:-
EFU_71_26647 4.2e+4 83721 77666 0 6055 yes blast uaauacugccugguaaugaugac caucuuacugggcagcauugga caucuuacugggcagcauuggaugugucaggucucuaauacugccugguaaugaugac NW_007370721.1:208051..208109:+
EFU_13_9834 4.0e+4 78836 78765 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuugaacucggcaacaagaaacugccuga NW_007370663.1:30451072..30451130:+
EFU_93_29472 3.1e+4 60916 60822 0 94 yes blast uagguaguuucauguuguuggg caacgacauuaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacauuaaaccacccga NW_007370743.1:2973069..2973128:+
EFU_179_35919 2.9e+4 58116 58100 0 16 yes blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugaggacggaggccagacccaccgagggaugaaugucac NW_007370829.1:1151544..1151608:-
EFU_76_27287 2.9e+4 57573 57411 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc NW_007370726.1:1192191..1192251:+
EFU_17_11800 2.7e+4 53187 52224 1 962 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauacuauagucaagaugcgaaucauuauuugcugcucu NW_007370667.1:6222878..6222937:+
EFU_238_38033 2.5e+4 50689 45511 0 5178 no blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuuccguuuaaauccacggguuaggcucuugggag NW_007370888.1:615877..615937:-
EFU_4_3264 2.5e+4 49220 49167 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc NW_007370654.1:521501..521580:+
EFU_15_11093 2.4e+4 48904 48224 0 680 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuucccga caaagugcuguucgugcagguagugugauuaccugaccuacugcugagcuagcacuucccga NW_007370665.1:7045022..7045084:-
EFU_104_30633 2.4e+4 48755 31435 15 17305 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuagggcagggauuuugcccacaaggagguaacuauacgaccugcugccuuucu NW_007370754.1:1026636..1026712:+
EFU_84_28387 2.4e+4 47153 45507 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguuaagcaacagcuacauugucugcuggguuu NW_007370734.1:1249323..1249385:+
EFU_13_9837 2.1e+4 42504 39216 18 3270 yes blast uccgagccugggucucccucu ggggguccccggugcucggau ggggguccccggugcucggaucuugagggugcuuauuguucgguccgagccugggucucccucu NW_007370663.1:30492758..30492822:+
EFU_179_35893 2.0e+4 39654 39219 52 383 yes blast uucacaguggcuaaguuccg agggcuuagcugcuugugagca agggcuuagcugcuugugagcagggucugcaccaagucauguucacaguggcuaaguuccg NW_007370829.1:1180706..1180767:+
EFU_66_25835 1.9e+4 38902 38803 0 99 yes blast gggagaggaugcagucugaguggu gccauugaugaucgcucuucuc gccauugaugaucgcucuucucuuccacugggagaguaagagggagaggaugcagucugaguggu NW_007370716.1:372036..372101:+
EFU_96_29806 1.8e+4 36652 36646 1 5 yes blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaaugggauccggugguucuagacuugccaacu NW_007370746.1:670878..670942:+
EFU_31_17314 1.8e+4 36552 36548 0 4 yes blast uuagggcccuggcuccaucuccu aguggggcuucgacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuucgacccuaacc NW_007370681.1:12766402..12766467:+
EFU_104_30635 1.8e+4 36227 36097 0 130 yes blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauuaaaaucacauugccagggauuaccacg NW_007370754.1:1770417..1770478:+
EFU_28_16578 1.7e+4 35145 33714 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa NW_007370678.1:15533544..15533601:-
EFU_12_8969 1.7e+4 34899 30058 0 4841 yes blast cacgcucaugcacacacccaca ugagugugugugugugagugu ugagugugugugugugagugugugucgcucggguccacgcucaugcacacacccaca NW_007370662.1:14768812..14768869:+
EFU_39_19834 1.5e+4 30062 30058 0 4 yes blast cacgcucaugcacacacccaca ugagugugugugugucacu ugagugugugugugucacuuggguccacgcucaugcacacacccaca NW_007370689.1:2043042..2043089:-
EFU_39_19905 1.4e+4 29375 29020 0 355 yes blast gagagaucagaggcgcagagu ccugugccuuuuaccucuuuaa gagagaucagaggcgcagagugcgucagugucaaugaagccugugccuuuuaccucuuuaa NW_007370689.1:11408801..11408862:-
EFU_11_8383 1.4e+4 29094 28957 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac NW_007370661.1:26675385..26675447:+
EFU_21_13643 1.4e+4 27740 20947 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu NW_007370671.1:10863606..10863662:+
EFU_224_37697 1.2e+4 24483 24413 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca NW_007370874.1:908989..909050:+
EFU_15_11096 1.1e+4 22473 19049 1438 1986 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccucucgugcuaccgcacuguggguacuugcu NW_007370665.1:7045243..7045302:-
EFU_155_34595 1.0e+4 21327 18186 4 3137 yes blast gaguauuguuucugcugcccgg uagcagcgggaacaguacug uagcagcgggaacaguacugcagugggugauccguauucuggaguauuguuucugcugcccgg NW_007370805.1:652936..652999:+
EFU_179_35921 1.0e+4 20989 18901 0 2088 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc NW_007370829.1:1151719..1151780:-
EFU_4_3549 9.8e+3 19334 19325 0 9 yes blast ucacagugaaccggucucuuu gggggccgaugcacuguacgaga gggggccgaugcacuguacgagagugaguagcaggucucacagugaaccggucucuuu NW_007370654.1:29773481..29773539:+
EFU_9_7240 8.0e+3 15790 15784 0 6 yes blast ucgugcacugggccucuagu cgaggggucccagacug cgaggggucccagacugcacgagggcgcagacugggcugagggauaccccccaccgucagugcaugaauuucgugcacugggccucuagu NW_007370659.1:9884104..9884194:-
EFU_14_10265 7.6e+3 14928 14927 0 1 yes blast ucgugcacugggccucuagu agggacccuaccugugcacg agggacccuaccugugcacgaauuucgugcacugggccucuagu NW_007370664.1:6123712..6123756:+
EFU_120_32120 7.4e+3 14607 14600 0 7 yes blast acgcccuucccccccuucuuca aggagggaggagaggggccacg aggagggaggagaggggccacguucccucugccuggaacgcccuucccccccuucuuca NW_007370770.1:1445483..1445542:-
EFU_62_25213 7.2e+3 14257 14226 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauacaauuuucuagcaccaucugaaaucgguua NW_007370712.1:9215313..9215373:+
EFU_284_39004 7.0e+3 13734 12451 0 1283 yes blast cacuccucuccucccgucuucu aggacgggaggagaggagggcg aggacgggaggagaggagggcgugguuucugcagguccucacuccucuccucccgucuucu NW_007370934.1:369285..369346:-
EFU_128_32842 6.6e+3 12989 11423 3 1563 yes blast ucccuguccuccaggagcuc agcgccucggggccagagccc ucccuguccuccaggagcucaccugcguccggccgugagcgccucggggccagagccc NW_007370778.1:3242536..3242594:+
EFU_4_3955 6.3e+3 12365 12269 0 96 yes blast agcugguguugugaaucaggccg gcuacuucacaacaccagggu agcugguguugugaaucaggccguugccaaucagagaacggcuacuucacaacaccagggu NW_007370654.1:31880122..31880183:-
EFU_78_27585 6.2e+3 12225 12216 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagcgcuuccucuuacccggcuauuucacgacaccaggguu NW_007370728.1:809767..809836:-
EFU_5_4616 5.9e+3 11591 11585 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu NW_007370655.1:27067131..27067191:-
EFU_158_34779 5.9e+3 11591 11585 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucaacuguucaauggauuugguccccuucaaccagcugu NW_007370808.1:1688295..1688355:+
EFU_107_30998 5.5e+3 10916 7342 1 3573 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcgcauagaauugucucacacagaaaucgcacccguc NW_007370757.1:1659637..1659702:-
EFU_179_35891 4.9e+3 9739 9482 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccuuucacaaaucacauugccagggauuucca NW_007370829.1:1180505..1180563:+
EFU_151_34417 4.9e+3 9699 9677 0 22 yes blast agagguaaaaauuugauuugacu caaaucauuuuuuacucucc agagguaaaaauuugauuugacuaguucuuaaacaucuagcaaaucauuuuuuacucucc NW_007370801.1:2998869..2998929:-
EFU_140_33670 4.7e+3 9388 8152 0 1236 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua NW_007370790.1:95466..95524:+
EFU_31_17203 4.6e+3 9030 8941 0 89 yes blast uggcagucagacauccucugag gagagggauguccgacugcc gagagggauguccgacugccuguuauagacaaauccuaugcccaacacuauuauccucuaaacuggcagucagacauccucugag NW_007370681.1:2630385..2630470:+
EFU_32_17806 4.5e+3 8948 8943 0 5 yes blast uggcagucagacauccucugag uugggggaugucugccuau uugggggaugucugccuauagggaagugggccuaagcuggcagucagacauccucugag NW_007370682.1:5885318..5885377:-
EFU_187_36235 4.5e+3 8918 8368 0 550 yes blast augcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcuuucugaaugcaaugcaccugggcaaggauucuga NW_007370837.1:842991..843053:+
EFU_242_38122 4.3e+3 8562 3865 0 4697 no blast agccacugcccaccgcacacug cugugcgugugacagcggcuga agccacugcccaccgcacacugcgcugcuccggacccacugugcgugugacagcggcuga NW_007370892.1:677641..677701:+
EFU_201_36882 4.1e+3 8116 7172 0 944 yes blast uccgguucucagggcuccacc aggaagcccuggaggggcuggagg aggaagcccuggaggggcuggaggugauggauguguuccuccgguucucagggcuccacc NW_007370851.1:1306370..1306430:-
EFU_18_12541 3.8e+3 7564 6726 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau NW_007370668.1:12692930..12692990:-
EFU_8_6166 3.8e+3 7540 7377 93 70 no blast ucuggcuccgugucuucacuccc gagggagggacgggggcugugc ucuggcuccgugucuucacucccgugugugucugaggagggagggagggacgggggcugugc NW_007370658.1:5142252..5142314:+
EFU_188_36298 3.7e+3 7441 7431 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugugggguaaggauuuaaggccccaauagaagauaacuauacaacuuacuacuuuccc NW_007370838.1:1542085..1542166:+
EFU_116_31800 3.7e+3 7366 6308 5 1053 yes blast gggacucuugugugaccuccgg gagaucacacacgagucccccu gagaucacacacgagucccccucucuccacccuggggggacucuugugugaccuccgg NW_007370766.1:117292..117350:-
EFU_144_33923 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaauacauggauuggcugggagguggauguuuacuuc NW_007370794.1:843148..843208:-
EFU_3_2555 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucugaguaagauagcagucagugcacuacagaacuuugu NW_007370653.1:10994873..10994933:+
EFU_233_37903 3.2e+3 6327 4484 0 1843 yes blast ucccccaggugugauucugauuug uuaucagaaucuccagggguac uuaucagaaucuccagggguacuuauaauuugaaaaagucccccaggugugauucugauuug NW_007370883.1:1113029..1113091:+
EFU_33_17958 3.0e+3 5887 5074 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu NW_007370683.1:518697..518757:+
EFU_26_15590 2.8e+3 5595 5491 0 104 yes blast ugagaacugaauuccauaggcugu ugcccuagggacucaguucug ugagaacugaauuccauaggcugugagcucuagcaaaugcccuagggacucaguucug NW_007370676.1:5973092..5973150:+
EFU_96_29802 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa NW_007370746.1:666651..666713:+
EFU_187_36227 2.5e+3 5013 4060 0 953 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguugucaucuuaauuacccucccacacccaaggcuugca NW_007370837.1:836855..836914:+
EFU_97_29946 2.5e+3 4953 4952 0 1 yes blast cgcggaccaucgguuggcgacu ucgccaaccuuugggaccucacggau ucgccaaccuuugggaccucacggaucaccagugguccgcggaccaucgguuggcgacu NW_007370747.1:200729..200788:-
EFU_140_33671 2.4e+3 4722 4499 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug NW_007370790.1:95605..95668:+
EFU_44_21354 2.3e+3 4541 2992 0 1549 yes blast uaaugccccuaaaaauccuuau aagggacuuucaggggcagcugu aagggacuuucaggggcagcuguguuuucugacucaagucauaaugccccuaaaaauccuuau NW_007370694.1:6897275..6897338:-
EFU_97_29942 2.2e+3 4373 4372 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaauugagaaccugcuaugccaacauauugccauc NW_007370747.1:4846071..4846130:+
EFU_148_34205 2.0e+3 4112 4108 0 4 no blast ggguucgauucccggucaggga gccuggguugugggcuugaucc ggguucgauucccggucagggaacacgccuggguugugggcuugaucc NW_007370798.1:2112283..2112331:-
EFU_63_25398 2.0e+3 4087 4060 0 27 yes blast ugcccugaucgccccuuaggag ccucaggggcgaucagggcca ugcccugaucgccccuuaggagcagggggagguagagaagcccucaggggcgaucagggcca NW_007370713.1:7571572..7571634:+
EFU_28_16306 2.0e+3 4067 4065 0 2 yes blast ugcccugaucgccccuuaggag ccugaggggcgaucagggc ugcccugaucgccccuuaggagcaaggggagauggagaagcccugaggggcgaucagggc NW_007370678.1:7569480..7569540:+
EFU_31_17493 1.9e+3 3890 3850 0 40 no blast aagcgggcggcuucucu ucgaacccugcucgcugcg ucgaacccugcucgcugcggaagcgggcggcuucucu NW_007370681.1:9693915..9693952:-
EFU_44_21355 1.9e+3 3787 3266 0 521 yes blast ugggucuuugcgggcgagauga aacuggccuacaaagucccagu ugggucuuugcgggcgagaugagggugucgguucaacuggccuacaaagucccagu NW_007370694.1:6909870..6909926:-
EFU_107_30928 1.8e+3 3613 3592 0 21 yes blast acccgucccgugcguccccggac cgggaacgucgggacuggagc acccgucccgugcguccccggacguugcucucugccccgggaacgucgggacuggagc NW_007370757.1:490657..490715:+
EFU_91_29299 1.6e+3 3263 2930 26 307 no blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauugguguaaagcuggagacccacugccccaggugcugcug NW_007370741.1:4948762..4948818:+
EFU_155_34613 1.6e+3 3242 3211 0 31 yes blast aauugcacgguauccaucugu cggguggaucacgaugcaauuuu cggguggaucacgaugcaauuuugauuaguauaauaggugaaaaauugcacgguauccaucugu NW_007370805.1:951112..951176:+
EFU_122_32277 1.5e+3 3060 3051 0 9 yes blast aggccagcagucggacaucccc gaugucugacugcuggcguagg gaugucugacugcuggcguagggagcaggccuaggccagcagucggacaucccc NW_007370772.1:2624575..2624629:+
EFU_71_26649 1.4e+3 2798 2416 0 382 yes blast uaacacugucugguaacgauguu caucuuaccggacagugcugga caucuuaccggacagugcuggauuaucggcuugacucuaacacugucugguaacgauguu NW_007370721.1:208610..208670:+
EFU_40_20152 1.2e+3 2478 2197 0 281 yes blast cuccuggggcccgcacucucgc uggggagcggcccccgggcggg uggggagcggcccccgggcgggccucugcucuggccccuccuggggcccgcacucucgc NW_007370690.1:8698318..8698377:-
EFU_13_9723 1.2e+3 2483 2471 11 1 no blast ucgugcacugggccucuag ggggucccagauuggag ggggucccagauuggagagggugcaggcugggcugagggacaaccccccucugugcaagaauuucgugcacugggccucuag NW_007370663.1:21339885..21339967:+
EFU_140_33676 1.1e+3 2155 2146 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu NW_007370790.1:95914..95973:+
EFU_63_25500 1.0e+3 2106 2099 0 7 yes blast uacgucaucguugucaucauca guggugacgccgauggugcgagc guggugacgccgauggugcgagcuggaaauggggugcuacgucaucguugucaucauca NW_007370713.1:7985186..7985245:-
EFU_147_34113 1.0e+3 2072 2004 0 68 yes blast uggcagucagacauccucuga gagagggaugucugacugcc gagagggaugucugacugccgguuuaggccugaugcgcagggaucccugugggauugagccuaagcuggcagucagacauccucuga NW_007370797.1:2106003..2106090:+
EFU_187_36231 1.0e+3 2047 1499 0 548 yes blast augcaccugggcaaggauuccga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcugucagaaugcaaugcaccugggcaaggauuccga NW_007370837.1:841198..841260:+
EFU_201_36884 1.0e+3 2044 1747 0 297 no blast ggcuccccagcgcugccucucu aggggccacacucgggugacc aggggccacacucgggugaccuuggauauuuaguacgaaggcuccccagcgcugccucucu NW_007370851.1:1416111..1416172:-
EFU_166_35199 8.7e+2 1712 1705 0 7 no blast ugagggaugucugacugcuggcu agccugcacccucucca agccugcacccucuccaaucugagaccacgugagggaugucugacugcuggcu NW_007370816.1:1117758..1117811:+
EFU_15_10991 8.5e+2 1681 1664 0 17 yes blast aagcuggcagucggacauccuc gauguccgacugccggcuuaggcu gauguccgacugccggcuuaggcucacuccccaugggaagugggccuaagcuggcagucggacauccuc NW_007370665.1:22626797..22626866:+
EFU_281_38942 7.6e+2 1500 1499 0 1 yes blast cucggcgcugucagcgggugu caccugcugccggugcccgg caccugcugccggugcccggcgcuggccccgaucgcucggcgcugucagcgggugu NW_007370931.1:230122..230178:-
EFU_16_11549 7.5e+2 1482 1467 0 15 yes blast cacuggggugccuggucagccu cuggccaagccccccagagggg cacuggggugccuggucagccugggugagaggcugauggcuguuugcaggcuggccaagccccccagagggg NW_007370666.1:3925341..3925413:-
EFU_28_16543 7.5e+2 1478 1451 26 1 yes blast cacuggggugccuggucagccu cuggccaagccccucagcaggga cacuggggugccuggucagccugggugaggggcugauggcuguuuucaggcuggccaagccccucagcaggga NW_007370678.1:12567655..12567728:-
EFU_512_40697 7.4e+2 1464 1451 0 13 yes blast cacuggggugccuggucagccu cuggccacgccccccagagggu cacuggggugccuggucagccugggugagcggcugauggcuguuugcaaacuggccacgccccccagagggu NW_007371162.1:53198..53270:-
EFU_15_11204 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu NW_007370665.1:18505705..18505764:-
EFU_2_2189 6.9e+2 1360 583 0 777 yes blast cuaagcuggcagguggacaucc uguucgccugccagcuuaggc uguucgccugccagcuuaggcccgcuccccgggccuagggccuaagcuggcagguggacaucc NW_007370652.1:24864780..24864843:-
EFU_35_18673 6.8e+2 1346 588 0 758 yes blast cuaagcuggcagguggacaucc augucugacuaccagcuuaggc augucugacuaccagcuuaggcccgaucccccagggagggggccuaagcuggcagguggacaucc NW_007370685.1:10600256..10600321:+
EFU_1063_40991 6.3e+2 1237 1191 0 46 yes blast uugagggaugucugacugcugg cagcagucagacaucccucuca uugagggaugucugacugcugguuuagccccaauccccagcagucagacaucccucuca NW_007371713.1:3429..3488:-
EFU_13_9629 6.2e+2 1223 1215 0 8 yes blast ucugauccacagccuccauggc aagggggcugcggaucaggcc aagggggcugcggaucaggcccagagagagagguagggucugauccacagccuccauggc NW_007370663.1:10344328..10344388:+
EFU_18_12544 6.2e+2 1217 1053 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu NW_007370668.1:12719501..12719557:-
EFU_149_34232 6.1e+2 1211 1190 0 21 yes blast uugagggaugucugacugcugg cagcagucagacaucccucucc uugagggaugucugacugcugguuuaaaccagcagucagacaucccucucc NW_007370799.1:1510461..1510512:+
EFU_8_6496 6.1e+2 1201 1200 0 1 yes blast agcuggcagguagacauccccc ggggagcucugcucagcc ggggagcucugcucagccauaagcuggggaucgggccuaagcuggcagguagacauccccc NW_007370658.1:6290820..6290881:-
EFU_169_35354 6.1e+2 1197 1191 0 6 yes blast uugagggaugucugacugcugg cagcaguuggacaucccucucaga uugagggaugucugacugcugguuuaggccugaucccaagggaucgggccuaaaucagcaguuggacaucccucucaga NW_007370819.1:1725661..1725740:+
EFU_28_16340 6.0e+2 1207 1116 0 91 no blast uugggcuuacuccucacgggugg uccugugacauuacgcccuaua uugggcuuacuccucacggguggcuggauacuaugaccuuccugugacauuacgcccuaua NW_007370678.1:10752556..10752617:+
EFU_47_22107 5.9e+2 1179 1174 0 5 no blast uguuggacugccaguuucagcu caggagcggcaggcaggag caggagcggcaggcaggaguggcaggugguguuggacugccaguuucagcu NW_007370697.1:11235754..11235805:+
EFU_44_21408 5.8e+2 1148 1088 1 59 yes blast uaacagucuacagccauggucg accguggcuuucgauuguuacu accguggcuuucgauuguuacugugggaaccggagguaacagucuacagccauggucg NW_007370694.1:11275505..11275563:-
EFU_90_29226 5.5e+2 1079 1019 0 60 yes blast cacuggggugccuggccagccu cuggccaggccccccagcgggg cacuggggugccuggccagccugggugaggagcugauggcuguuugcaugcuggccaggccccccagcgggg NW_007370740.1:1729117..1729189:-
EFU_82_28174 5.5e+2 1079 294 0 785 yes blast ccuaagccggcagucagacauc augucugacuaccagcuuaggc augucugacuaccagcuuaggcccaauccccaggccuaagccggcagucagacauc NW_007370732.1:1790568..1790624:+
EFU_29_16645 5.5e+2 1080 1078 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucugaaagguacaguacugugauaacugaa NW_007370679.1:4627672..4627729:+
EFU_255_38434 5.4e+2 1068 1067 0 1 yes blast cccccgguggucagugugcuu cacacugaccuccaggg cacacugaccuccaggggcagaugcucaaugcuucccccgguggucagugugcuu NW_007370905.1:657405..657460:-
EFU_42_20773 5.4e+2 1066 1025 0 41 yes blast cacuggggugccuggccagccu gcuggccaagccccccagcagg cacuggggugccuggccagccugguugaugggcugaugacuguuuucaggcuggccaagccccccagcagg NW_007370692.1:364268..364339:-
EFU_10_7926 5.4e+2 1066 1065 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa NW_007370660.1:15004290..15004347:-
EFU_62_25113 5.4e+2 1063 1019 3 41 yes blast cacuggggugccuggccagccu gcuggccacgccccccagcggg cacuggggugccuggccagccugggggaggggcugauggcuguuugcaggcuggccacgccccccagcggg NW_007370712.1:1670697..1670768:+
EFU_89_29086 5.4e+2 1058 1037 0 21 yes blast cacuggggugccuggccagccu cuggccaagccccccagcaga cacuggggugccuggccagccugagugaagggcugauggcuguuuguaggcuggccaagccccccagcaga NW_007370739.1:4862153..4862224:+
EFU_10_7856 5.3e+2 1046 1038 0 8 yes blast uaagccagcagucggacaucc augucugacugaugacuuagg augucugacugaugacuuagguggggagcgggcuuaagccagcagucggacaucc NW_007370660.1:6774744..6774799:-
EFU_276_38867 5.3e+2 1041 1025 7 9 yes blast cacuggggugccuggccagccu cuggccaagccccccagugggg cacuggggugccuggccagccugguugaggggcugagggcuguuugcaggcuggccaagccccccagugggg NW_007370926.1:266530..266602:-
EFU_203_36962 5.3e+2 1042 1020 17 5 yes blast cacuggggugccuggccagccu cuggccaagccccucagcggg cacuggggugccuggccagccuggaugaggggcugagggcuguuugcaggcuggccaagccccucagcggg NW_007370853.1:1510417..1510488:+
EFU_70_26535 5.2e+2 1025 1019 4 2 yes blast cacuggggugccuggccagccu gcuggccaggccccccag cacuggggugccuggccagccugggugagggcugauggcuguuugcaggcuggccaggccccccag NW_007370720.1:761952..762018:+
EFU_81_28009 5.1e+2 1011 1010 0 1 yes blast acuggccaggcaccccagcagg ccgcuggggggcauggc ccgcuggggggcauggccagccugcaaauagccaucagccccucaccuagacuggccaggcaccccagcagg NW_007370731.1:333706..333778:+
EFU_33_17967 5.1e+2 1005 841 0 164 yes blast ucugcccccugguugucaaugc cacacugaccaccagggggc cacacugaccaccagggggcagcuccugcauugagcgucugcccccugguugucaaugc NW_007370683.1:1087728..1087787:+
EFU_69_26441 5.0e+2 996 995 0 1 yes blast uugaucagcauugccucucucu agagaggcaggguaugauccgc agagaggcaggguaugauccgcagccucagugacagcuauugaucagcauugccucucucu NW_007370719.1:4241464..4241525:+
EFU_244_38181 5.0e+2 991 981 1 9 yes blast cacuggggugccuggccagccu cuggccaagccccccagugggg cacuggggugccuggccagccuaggugaggggcugagggccauuuacaggcuggccaagccccccagugggg NW_007370894.1:441767..441839:-
EFU_56_23972 4.9e+2 973 972 0 1 yes blast uguaacagcaacuccaugugga ccaguggagaugcuguuacuu uguaacagcaacuccauguggacugaguaccaauuuccaguggagaugcuguuacuu NW_007370706.1:4370832..4370889:+
EFU_19_12994 4.5e+2 893 888 0 5 yes blast uaagccagcagucggacaucc aucucugacugcugacuuagg aucucugacugcugacuuaggucugcuccccaugggccuaagccagcagucggacaucc NW_007370669.1:8076374..8076433:-
EFU_36_19112 4.4e+2 873 772 0 101 yes blast ugccucugguggucagugcacu ucacugaccaccagggggcag ucacugaccaccagggggcagaugcuuaacgcaggagcugccucugguggucagugcacu NW_007370686.1:11273473..11273533:-
EFU_10_8032 4.4e+2 867 684 0 183 yes blast ugccucugguggucagugcacu cacacugaccaccagggggc cacacugaccaccagggggcagacacucaauuuaggagcugccucugguggucagugcacu NW_007370660.1:26207427..26207488:-
EFU_1303_41101 4.2e+2 838 836 0 2 yes blast ugcccugaucgccccucagcag uugaggggcaaucagggccggc ugcccugaucgccccucagcagcagggggagguggagaaguuuugaggggcaaucagggccggc NW_007371953.1:9134..9198:-
EFU_216_37455 4.1e+2 819 767 0 52 yes blast uguaacagcaacuccaugugga ccaguggggcugcuguuaucugg uguaacagcaacuccauguggaagugcccgcucguuccaguggggcugcuguuaucugg NW_007370866.1:1052840..1052899:-
EFU_189_36334 4.1e+2 803 473 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg NW_007370839.1:504915..504979:+
EFU_17_12189 4.0e+2 787 785 0 2 yes blast augucugacuaccagcuuaggc uaagccggcagguggacauucc augucugacuaccagcuuaggcccaauccccuggggagcgggccuaagccggcagguggacauucc NW_007370667.1:22803078..22803144:-
EFU_115_31718 3.9e+2 777 776 0 1 yes blast cucggcgcugucagcgggugc acccacugcuggugccuggcg acccacugcuggugccuggcgccggccccaaucacucggcgcugucagcgggugc NW_007370765.1:1067388..1067443:-
EFU_12_9358 3.9e+2 768 758 5 5 yes blast augucugacuaccagcuuaggc uaagcccucagucagacauccc uaagcccucagucagacauccccugagggcuccugggcugccagagggaugucugacuaccagcuuaggc NW_007370662.1:18888203..18888273:-
EFU_110_31211 3.9e+2 766 684 0 82 yes blast ugccucugguggucagugcacu ugcacugaccaccagggggcag ugcacugaccaccagggggcagaugcuuaaugcaggagcugccucugguggucagugcacu NW_007370760.1:1726555..1726616:+
EFU_109_31199 3.8e+2 757 682 0 75 yes blast gagagggauguccgacugccagua gucggacaucccccaaggggucc gagagggauguccgacugccaguauaggcacaaucccaauaacuuggcagucggacaucccccaaggggucc NW_007370759.1:4154335..4154407:-
EFU_1_697 3.8e+2 755 684 2 69 yes blast ugccucugguggucagugcacu ugcacugaccaccagggggcag ugcacugaccaccagggggcagacauucaacgcaggagcuggagcugccucugguggucagugcacu NW_007370651.1:59162673..59162740:+
EFU_266_38676 3.8e+2 754 527 226 1 yes blast agaguugagucuggacgucccg ugauuguccaaacgcaauucucga ugauuguccaaacgcaauucucgagucuccggcucggccgagaguugagucuggacgucccg NW_007370916.1:617758..617820:-
EFU_80_27822 3.8e+2 752 277 0 475 yes blast cauuauuacuuuugguacgcg ucguaccgugaguaauaaugcg cauuauuacuuuugguacgcgcugugacacuucaaacucguaccgugaguaauaaugcg NW_007370730.1:1315391..1315450:+
EFU_35_18704 3.7e+2 734 729 0 5 yes blast acucgcacccgcugacggcaug ugccagcagugggugcaaguggg acucgcacccgcugacggcauggagcaauuggguucggugccagcagugggugcaaguggg NW_007370685.1:13643392..13643453:+
EFU_68_26284 3.7e+2 731 665 0 66 yes blast gagagggauguccgacugccagua ccagcagucggacaucccc gagagggauguccgacugccaguaggggccuaaaccagcagucggacaucccc NW_007370718.1:5611447..5611500:+
EFU_17_11939 3.5e+2 694 684 2 8 yes blast ugccucugguggucagugcacu gcacugaccaccaggaggcag gcacugaccaccaggaggcagaugcucaaugcaggagcugccucugguggucagugcacu NW_007370667.1:21118769..21118829:+
EFU_3_3045 3.5e+2 690 676 0 14 yes blast gagagggauguccgacugccagua cuggcagucggacauccaccgag gagagggauguccgacugccaguauaggcccaaucccguggauuuggccuauacuggcagucggacauccaccgag NW_007370653.1:19802373..19802449:-
EFU_36_19106 3.5e+2 689 583 0 106 yes blast cuaagcuggcagguggacaucc gaugucugacugccagcuuagg cuaagcuggcagguggacaucccccgaggauuccugggcugccagaggaugucugacugccagcuuagg NW_007370686.1:10672046..10672115:-
EFU_242_38141 3.2e+2 639 637 0 2 no blast ugccaggggcacuucuagacacuc acgcuagggggcgccug ugccaggggcacuucuagacacucgagaggacgcuagggggcgccug NW_007370892.1:532643..532690:-
EFU_136_33400 3.2e+2 628 625 0 3 yes blast caggggaugucugacugccagua cugcagucagccaucccucuca caggggaugucugacugccaguauaggccugauccugcagucagccaucccucuca NW_007370786.1:3038165..3038221:+
EFU_6_5134 3.2e+2 625 514 0 111 yes blast uagaucugggguagggccugggga uugggccccacccccggagacu uugggccccacccccggagacugugaaucaguaaguagaucugggguagggccugggga NW_007370656.1:7220642..7220701:-
EFU_111_31294 3.1e+2 615 610 0 5 yes blast ucgggggaugucugacugccaga cugcagucggacaucccucuca ucgggggaugucugacugccagauugggccuaucccuguaggauugggccuaaaccugcagucggacaucccucuca NW_007370761.1:2206911..2206988:+
EFU_19_13156 3.1e+2 615 571 0 44 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagagg augcugacauauuuacuagagggugaaauuaauagccuucuaguaagaguggcaguugaag NW_007370669.1:20236210..20236271:-
EFU_148_34217 2.9e+2 575 518 0 57 yes blast cacugaccaccaggaugcagcu ugcccccugguggucagu cacugaccaccaggaugcagcuccugcauugucugcccccugguggucagu NW_007370798.1:2676700..2676751:-
EFU_1_1129 2.9e+2 575 518 0 57 yes blast cacugaccaccaggaugcagcu ugcccccugguggucagu cacugaccaccaggaugcagcuccugcauugucugcccccugguggucagu NW_007370651.1:31348851..31348902:-
EFU_16_11302 2.9e+2 575 573 0 2 no blast gcgguggcggcggcggcggcggcgg gacggcggugcuggcgcu gcgguggcggcggcggcggcggcggcggggagaccccgcggacggcggugcuggcgcu NW_007370666.1:2487404..2487462:+
EFU_4_4013 2.8e+2 564 563 0 1 yes blast cgccccccccacgcccggac ccggggugggggagggga cgccccccccacgcccggaccugcagccccaucccucucagagguggaugcaggggccggggugggggagggga NW_007370654.1:38680212..38680286:-
EFU_187_36238 2.8e+2 549 538 0 11 yes blast uacccauugcauaucggaguug accuccugugugcauggauuaca uacccauugcauaucggaguugugaauucucaaagcaccuccugugugcauggauuaca NW_007370837.1:845076..845135:+
EFU_275_38828 2.8e+2 546 544 1 1 yes blast uucccuuugucauccuuugccuc gcagggacagcaaaggggugc uucccuuugucauccuuugccucgggcucugagcggggcagggacagcaaaggggugc NW_007370925.1:349935..349993:+
EFU_110_31257 2.7e+2 526 519 1 6 yes blast aagcuggcagucggacauccu auguccaacugcuggcuuaagcc auguccaacugcuggcuuaagccugccagggagcgggccuaagcuggcagucggacauccu NW_007370760.1:1652153..1652214:-
EFU_111_31284 2.3e+2 459 457 0 2 yes blast ucggacugcugguuuaggccc ccuaaaccggcaguuggacca ucggacugcugguuuaggcccaaucccacaggccuaaaccggcaguuggacca NW_007370761.1:1304749..1304802:+
EFU_62_25212 2.3e+2 458 398 4 56 yes blast gcugguuucauauggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu NW_007370712.1:9214970..9215034:+
EFU_50_22905 2.3e+2 456 358 0 98 yes blast cgggggaugucugacugccagga cagcagucggacaucccucuca cgggggaugucugacugccaggauugagccuaaaccagcagucggacaucccucuca NW_007370700.1:11423084..11423141:-
EFU_83_28335 2.2e+2 445 444 0 1 yes blast ugggggauguccaccuguuggc cagcagucagauaucccucu ugggggauguccaccuguuggcuuagguccaauccccccagccuaagccaggggauugggccuaagucagcagucagauaucccucu NW_007370733.1:1796810..1796897:-
EFU_12_8848 2.2e+2 440 420 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca NW_007370662.1:1963832..1963894:+
EFU_154_34562 2.1e+2 426 397 0 29 yes blast acagaucagacccugccucucu agaggcaagugcugaucaacagc agaggcaagugcugaucaacagcugcuacggaggcuacagaucagacccugccucucu NW_007370804.1:1543342..1543400:-
EFU_83_28315 2.1e+2 421 274 1 146 yes blast gagagggaugucugacugccagu uggcaguuggacauccccugaga gagagggaugucugacugccaguuuaggccuguucuugcagggaccaggccuaaacuggcaguuggacauccccugaga NW_007370733.1:5067292..5067371:+
EFU_34_18424 2.1e+2 423 318 0 105 yes blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua NW_007370684.1:16086540..16086598:+
EFU_2_1694 2.1e+2 415 398 3 14 yes blast uggccccaauugccccucaggag ccugaggggcaaucggggcca uggccccaauugccccucaggagcaggaggagguggagaagcccugaggggcaaucggggcca NW_007370652.1:21228592..21228655:+
EFU_9_7311 2.1e+2 413 410 1 2 yes blast uggccccaauugccccucaggag ccugaggggcaauugggg uggccccaauugccccucaggagcugggggagguggagaagcccugaggggcaauugggg NW_007370659.1:19198005..19198065:-
EFU_13_9689 2.1e+2 408 279 0 129 yes blast cugagcuggcagguggacaucc gaugucugacugccagcuuagg gaugucugacugccagcuuaggccugacccccccggggaacaggccugagcuggcagguggacaucc NW_007370663.1:17812906..17812973:+
EFU_20_13336 2.0e+2 417 415 0 2 no blast augcacacugaccaccagggac cucauggcuggcgagugcaguggcag augcacacugaccaccagggacaaacacucaacacaggagcugggcucauggcuggcgagugcaguggcag NW_007370670.1:17235739..17235810:+
EFU_187_36230 2.0e+2 407 382 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca NW_007370837.1:837242..837302:+
EFU_57_24229 2.0e+2 401 372 0 29 yes blast ucuacagugcacgugucuccagu ggagacgcggcccuguuggagu ucuacagugcacgugucuccaguguggcucggaggcuggagacgcggcccuguuggagu NW_007370707.1:1134571..1134630:-
EFU_49_22634 2.0e+2 395 274 0 121 yes blast gagagggaugucugacugccagu cagcaguuggacauccccugu gagagggaugucugacugccaguuuaggccagauccacagggaucccugcaggaucaggccuaaaccagcaguuggacauccccugu NW_007370699.1:4378219..4378306:-
EFU_44_21294 1.9e+2 386 382 0 4 yes blast uuggcgcugucagcagguguga ugcaccugcugccagcgccgg ugcaccugcugccagcgccggcugcaccugcaccugcugcuggugccagcaccgauugcuuggcgcugucagcagguguga NW_007370694.1:327562..327643:-
EFU_159_34839 1.9e+2 386 380 0 6 yes blast cuaagcuggcagguggacauc uguccaauugccagcuuaggcu uguccaauugccagcuuaggcucgaacaccgcagggagugggccuaagcuggcagguggacauc NW_007370809.1:2568706..2568770:+
EFU_529_40719 1.9e+2 382 381 0 1 yes blast gagagggauguccgacugcca caaucggacaucucccgaggggucc gagagggauguccgacugccagauuggggagugggccuaagccggcaaucggacaucucccgaggggucc NW_007371179.1:1079..1149:-
EFU_39_19841 1.9e+2 385 370 12 3 no blast gcggagggcggcggcgggac gcccgcgcgggcucuccc gcggagggcggcggcgggacaaucgguucgcggccggccucgcccgcgcgggcucuccc NW_007370689.1:2960598..2960657:-
EFU_56_23974 1.9e+2 371 312 0 59 yes blast augaccuaugaauugacagaca ucugucauuucuguaggccaau augaccuaugaauugacagacaguguggcuaagagugucugucauuucuguaggccaau NW_007370706.1:4371084..4371143:+
EFU_44_21366 1.8e+2 356 282 1 73 yes blast ucgggggaugucugacugccagu uggcagucagacaucccucucgu ucgggggaugucugacugccaguuuaggcacgaucccuuagggauccaugugggauugggccuaaacuggcagucagacaucccucucgu NW_007370694.1:7245055..7245145:-
EFU_257_38476 1.8e+2 350 261 0 89 yes blast cgcacuaaccaccagagggcag ugcccccugguggucagugugc cgcacuaaccaccagagggcagcuccugcguugagcagcugcccccugguggucagugugc NW_007370907.1:230718..230779:+
EFU_71_26763 1.7e+2 343 339 3 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugagucauaaugagggaagcaaucagcaaguauacugcccu NW_007370721.1:4614092..4614157:-
EFU_27_16178 1.7e+2 341 282 0 59 yes blast ucgggggaugucugacugccagu cagcagucugacaucccucucac ucgggggaugucugacugccaguuuaggacugauccuauagggaaugagccuaaaccagcagucugacaucccucucac NW_007370677.1:13579192..13579271:-
EFU_1_979 1.6e+2 328 291 0 37 yes blast ccuaagccggcagucagacauc auccaacugccggcuuagguc auccaacugccggcuuagguccacugcaggccuaagccggcagucagacauc NW_007370651.1:16155709..16155761:-
EFU_12_9521 1.6e+2 327 291 0 36 yes blast ccuaagccggcagucagacauc uguccaccugcuggcuuaggucu uguccaccugcuggcuuaggucugaagggauugggccuaagccggcagucagacauc NW_007370662.1:31526233..31526290:-
EFU_20_13432 1.6e+2 325 213 1 111 yes blast ucugaggggcgaucggggcca gccccgaucgccccucaggag gccccgaucgccccucaggagcagggggagguggagaagcucugaggggcgaucggggcca NW_007370670.1:5651977..5652038:-
EFU_58_24529 1.5e+2 307 296 0 11 yes blast cuugcacccacugcuggcaccg ugcugucagugggugcgagugg cuugcacccacugcuggcaccggccccaauagcucugugcugucagugggugcgagugg NW_007370708.1:9715772..9715831:-
EFU_127_32753 1.5e+2 303 290 0 13 yes blast ucgggggaugucugacugccagu uggcagucagacaucccucuc ucgggggaugucugacugccaguauaugcucgaucccagggaucaggccuaaucuggcagucagacaucccucuc NW_007370777.1:1221159..1221234:-
EFU_313_39457 1.5e+2 299 295 0 4 yes blast caguuaccgcuuccgcuaccgc aguggcgggagcggccccucggc aguggcgggagcggccccucggccauccuccgucugcccaguuaccgcuuccgcuaccgc NW_007370963.1:174033..174093:+
EFU_22_14253 1.5e+2 291 274 0 17 yes blast ucggacugccgguuucagccu cugaaaccagcagucugacau ucggacugccgguuucagccuagucccugcaggccaggcugaggggccccaggaugcggguaucgggcugaaaccagcagucugacau NW_007370672.1:3883595..3883683:-
EFU_158_34813 1.4e+2 287 277 0 10 yes blast aucucagguucgucagccugug aggacugaccaaccugagaaug aggacugaccaaccugagaauggugucuccaggucaaucucagguucgucagccugug NW_007370808.1:2595566..2595624:-
EFU_81_28099 1.4e+2 284 263 20 1 yes blast ugcuggggugccuggccaguc cuggccaugccccccagcgggg ugcuggggugccuggccagucuaggugaggggcugauggcuauuugcaggcuggccaugccccccagcgggg NW_007370731.1:333704..333776:-
EFU_13_9974 1.4e+2 282 184 3 95 yes blast ccugaagggugauuggggccg gccccgaucgccccucaggag gccccgaucgccccucaggagcaggaggagguggagaagcccugaagggugauuggggccg NW_007370663.1:11798126..11798187:-
EFU_4_3454 1.3e+2 265 181 0 84 yes blast gaugucugacugccagcuuagg uaagcuggcagucggacauc gaugucugacugccagcuuaggagagucuaagcuggcagucggacauc NW_007370654.1:18829787..18829835:+
EFU_133_33248 1.3e+2 262 200 0 62 yes blast cagugccucggcagugcagcu gugcauugcuguugcauug gugcauugcuguugcauugcacgugugaggugggugcagugccucggcagugcagcu NW_007370783.1:977101..977158:-
EFU_30_17084 1.3e+2 259 106 0 153 yes blast ugccccuuggugaucagugugc cacacugaccaccagggggc cacacugaccaccagggggcagauccuguauugagugucugccccuuggugaucagugugc NW_007370680.1:6329916..6329977:-
EFU_7_5798 1.3e+2 253 118 0 135 yes blast uggccccaauugccccugaggacu ccuaaggggcaaucggggccg uggccccaauugccccugaggacuucuccaccuagccccgcuccuaaggggcaaucggggccg NW_007370657.1:3212167..3212230:-
EFU_9_7295 1.3e+2 251 183 17 51 yes blast cacuggggugccuggccagcc cuggccaagccccccagcggg cacuggggugccuggccagccagggugaggggcugauggcuguuuucaggcuggccaagccccccagcggg NW_007370659.1:17062290..17062361:-
EFU_34_18473 1.2e+2 252 213 0 39 yes blast cauggaggucucugucuggcu ucugaucguuccccuccauaca cauggaggucucugucuggcuuagcacagcugucuaagucugaucguuccccuccauaca NW_007370684.1:3477354..3477414:-
EFU_9_6881 1.2e+2 255 250 0 5 no blast agggaugucugacugcuggcu cccagacugugagagccccggacugc cccagacugugagagccccggacugcgagagggaugucugacugcuggcu NW_007370659.1:14539508..14539558:+
EFU_193_36527 1.2e+2 246 240 0 6 yes blast cagcagucagacaucccucucaa ugggggauguccaacugccagu ugggggauguccaacugccaguuuaggcucggaccuaaaccagcagucagacaucccucucaa NW_007370843.1:1631325..1631388:+
EFU_30_16935 1.2e+2 252 251 0 1 no blast uccgacugcugguuuaggcca guuaggagccagucaucc guuaggagccagucaucccgauugcgugagagauguccgacugcugguuuaggcca NW_007370680.1:5730173..5730229:+
EFU_6_5306 1.2e+2 249 243 1 5 no blast uuugugcaucgggccucuaguuaa ugccagagggaagccggugc ugccagagggaagccggugccagcagccagaggaaggaaggccuacucuugcaugaauuuugugcaucgggccucuaguuaa NW_007370656.1:25504051..25504133:-
EFU_73_26984 1.2e+2 236 193 0 43 yes blast ucgggggauguccaacugccaga caggcagucggacaucccucu ucgggggauguccaacugccagauuaggccugaucccggagaucaggccuaaacaggcagucggacaucccucu NW_007370723.1:4964332..4964406:+
EFU_118_31965 1.2e+2 235 189 0 46 yes blast uugggggauguccaacugcugu cagcagucagacaucccucuca uugggggauguccaacugcuguuuuaggccugauccuggaucaggccuaaaccagcagucagacaucccucuca NW_007370768.1:1853922..1853996:-
EFU_99_30167 1.2e+2 235 178 0 57 yes blast uugggggauguccaacugcugu cggcagucggacaucccucu uugggggauguccaacugcuguuuuagguccaaucccacagagaucggccuaaaucggcagucggacaucccucu NW_007370749.1:2249114..2249189:-
EFU_105_30720 1.2e+2 236 48 0 188 yes blast uuagaccauugucaauugagaug ucucuucugcaugcauggucuaga uuagaccauugucaauugagauggaguaaccauuucaucucuucugcaugcauggucuaga NW_007370755.1:338107..338168:+
EFU_188_36284 1.1e+2 230 211 0 19 yes blast ucuggugccagcagcgg gggcgcuggcaguggguguga gggcgcuggcagugggugugagcaguggcucuggugccagcagcgg NW_007370838.1:1003793..1003839:+
EFU_16_11442 1.1e+2 229 185 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua NW_007370666.1:16233334..16233398:+
EFU_40_20119 1.1e+2 228 222 0 6 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguacauaacucaauagccggaagcccuuaccccaaaaagca NW_007370690.1:3739419..3739482:-
EFU_96_29879 1.1e+2 226 224 0 2 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaag cuuuuugcggucugggcuugcuguuccucucaaccguagucaggaagcccuuaccccaaaaag NW_007370746.1:1819395..1819458:-
EFU_11_8252 1.1e+2 224 221 0 3 yes blast agggaugucugacugcuggcu ccagcagucaaacaucccucu agggaugucugacugcuggcugcaggacugggccuaaaccagcagucaaacaucccucu NW_007370661.1:12814016..12814075:+
EFU_17_11917 1.1e+2 214 213 0 1 yes blast ucugaggggcgaucggggcca agccccaaucaccccuca agccccaaucaccccucagggcuucuccaccucccucugacucugaggggcgaucggggcca NW_007370667.1:18059041..18059103:+
EFU_6_5311 1.1e+2 214 208 0 6 yes blast aagagggauguccgacugccaga uggcagucagacauccccugag aagagggauguccgacugccagauguccgacugccuaugggucaggccuaaaguggcagucagacauccccugag NW_007370656.1:26156706..26156781:-
EFU_11_8475 1.1e+2 213 205 0 8 yes blast cacccgcugcuggcgcccagca cucagcaccaucagcgggug cacccgcugcuggcgcccagcacuggucccaauugcucagcaccaucagcgggug NW_007370661.1:3860982..3861037:-
EFU_210_37228 1.0e+2 216 184 0 32 no blast uggaagacuagugauuuuguuguu caacaagucccagucugccgca uggaagacuagugauuuuguuguugucucgcugcaucagcaacaagucccagucugccgca NW_007370860.1:556698..556759:+
EFU_28_16540 1.0e+2 207 203 0 4 yes blast ucccccuggugaucagugcgcu cgcgcacugaccacuagggggc cgcgcacugaccacuagggggcagacacuuaacgcaagagcuucccccuggugaucagugcgcu NW_007370678.1:12066168..12066232:-
EFU_6_5179 1.0e+2 207 186 0 21 yes blast uaaccgguugaacaacugaacc uuacaguuguucaaccaguuacu uuacaguuguucaaccaguuacuaaucuaacuaauguaaccgguugaacaacugaacc NW_007370656.1:13004604..13004662:-
EFU_129_32914 1.0e+2 205 123 0 82 yes blast caggggauguccgacugccggua cggcagucggacaucccucu caggggauguccgacugccgguauaggccugaucucagggaucgggccuacaccggcagucggacaucccucu NW_007370779.1:2064287..2064360:+
EFU_134_33290 1.0e+2 200 122 0 78 yes blast ugagggaugucugacugccagu cagcagucggacaucccucuca ugagggaugucugacugccaguuuaggcccgaucccagugauugggccuaaaucagcagucggacaucccucuca NW_007370784.1:2737723..2737798:+
EFU_33_17966 1.0e+2 200 154 0 46 yes blast aggggauguucaacugcugguu cagcagucagacaucccucuca aggggauguucaacugcugguuuaggcccaaccugcuggcccgaaaccagcagucagacaucccucuca NW_007370683.1:1070465..1070534:+
EFU_227_37770 1.0e+2 199 111 0 88 yes blast cuuguacccgcugauggcaca ugccagcagcgggugugaga cuuguacccgcugauggcacagagugacuggggccagugccagcagcgggugugaga NW_007370877.1:132791..132848:+
EFU_115_31758 1.0e+2 195 194 0 1 yes blast cugcagucugacaucccccgag gagggauguccgacugc gagggauguccgacugcagguuuaagcccaaucccugggccuaaaccugcagucugacaucccccgag NW_007370765.1:3803048..3803116:-
EFU_15_11235 1.0e+2 195 78 0 117 yes blast aaguccgacugcugguuuaggc uaaaccggcagucagacauccc aaguccgacugcugguuuaggccuggcccaggccuaaaccggcagucagacauccc NW_007370665.1:21921833..21921889:-
EFU_72_26896 1.0e+2 194 192 0 2 yes blast ugccagcagcgggugugagc ucacacccacugauggcgcugagc ucacacccacugauggcgcugagcaauugggacuggugccgggugccagcagcgggugugagc NW_007370722.1:4780121..4780184:-
EFU_3_2583 9.9e+1 191 134 1 56 yes blast ucagcaguuggacauccccuga gagagggaugucugacugcc gagagggaugucugacugccuguuuaggccugaucccuaugggggauggggccuaaaucagcaguuggacauccccuga NW_007370653.1:13001243..13001322:+
EFU_129_32957 9.9e+1 192 146 0 46 yes blast cgggggaugucugacugccagg cagcagucagacaucccucuca cgggggaugucugacugccaggggaucggggaucaggccuaaaccagcagucagacaucccucuca NW_007370779.1:3117497..3117563:-
EFU_39_19885 9.8e+1 190 184 0 6 yes blast cugggcacuggcagcgggugc accagcagugggugcaagcgg cugggcacuggcagcgggugcaaguggggccagcaccagcagugggugcaagcgg NW_007370689.1:7081172..7081227:-
EFU_310_39432 9.8e+1 189 121 0 68 yes blast ugcucccugguggucagugggc ugcacugaccaccagggggcag ugcacugaccaccagggggcagcucugcguugagcgucugcucccugguggucagugggc NW_007370960.1:544931..544991:-
EFU_24_15041 9.6e+1 193 184 0 9 no blast cugggcacuggcagcgggugc cgcuggcagugagugugagcagu cugggcacuggcagcgggugcaaguggcggcuccagcccuggcagcaggagcaagcagggccaucgcuggcagugagugugagcagu NW_007370674.1:6876276..6876363:-
EFU_6_4799 9.6e+1 185 127 0 58 yes blast gaugucugacugccagcuuagg cuggcagucggacaucccccau gaugucugacugccagcuuaggcccacucuggcagucggacaucccccau NW_007370656.1:10707907..10707957:+
EFU_9_7322 9.4e+1 182 181 0 1 yes blast gaucgggccuaaaccagcagu uguugguuuaggccugacccc uguugguuuaggccugaccccugugggaucgggccuaaaccagcagu NW_007370659.1:21274010..21274057:-
EFU_15_11150 9.3e+1 181 173 0 8 yes blast ggaccaucgguuggcgacc ucgccaaccuuucagaccuca ucgccaaccuuucagaccucacagaccaccaguggucugcggaccaucgguuggcgacc NW_007370665.1:11212123..11212182:-
EFU_47_22158 9.3e+1 178 123 0 55 yes blast uggccccaauugccccucagggcu uccugaggggugaucggggccag uggccccaauugccccucagggcuucuccaucucccccugcuccugaggggugaucggggccag NW_007370697.1:4664454..4664518:-
EFU_106_30850 9.2e+1 177 176 0 1 yes blast cacccgcugcuggcgcccagca ccaggcgccagcagcgg cacccgcugcuggcgcccagcaccaagggaucguggcuggugccaggcgccagcagcgg NW_007370756.1:3481349..3481408:+
EFU_23_14766 9.1e+1 176 173 0 3 yes blast aaccggcagucugacauccucu agggauguccgacugacgguu agggauguccgacugacgguuuagucccaaucccugggauugggacuaaaccggcagucugacauccucu NW_007370673.1:12997212..12997282:-
EFU_35_18791 9.0e+1 174 160 0 14 yes blast cacacugaccaccagggggc cccccugguggucagug cacacugaccaccagggggcauuuccugcauugagcaucuacccccugguggucagug NW_007370685.1:5863102..5863160:-
EFU_86_28704 9.0e+1 173 163 1 9 yes blast cacacugaccaccagggggc cccucugguggucagugcgc cacacugaccaccagggggcauuuucugcauugagcgucugcccucugguggucagugcgc NW_007370736.1:3703432..3703493:+
EFU_94_29665 8.9e+1 172 167 4 1 yes blast uggccccaauugccccucagga ugaggggugaucggggc uggccccaauugccccucaggaaaaggaggaaguggagaaacccugaggggugaucggggc NW_007370744.1:4781764..4781825:-
EFU_231_37864 8.9e+1 172 162 0 10 yes blast cuugcaccugcugauggcgcca ugcuggcagcgggugcgaac cuugcaccugcugauggcgccaagcgaucgggaccggcgcugggugcuggcagcgggugcgaac NW_007370881.1:767126..767190:+
EFU_53_23328 8.9e+1 170 149 1 20 yes blast gccccgaucgccccucaggagu ccugaggggcgaucggggcca gccccgaucgccccucaggaguagggggagguggagaagcccugaggggcgaucggggcca NW_007370703.1:6820906..6820967:+
EFU_27_16091 8.8e+1 170 169 0 1 yes blast cuggccaagccccccagcgggu gccguuuucaggcuggc cuggccaagccccccagcggguacccucauggcccuggguaaagggcugagggccguuuucaggcuggc NW_007370677.1:3630046..3630115:-
EFU_107_30924 8.8e+1 178 176 1 1 no blast gagagggauguccgccugcca gcagguagacauccccc gagagggauguccgccugccagcuuaggccugauccccagggggaauccagcagguagacauccccc NW_007370757.1:311489..311556:+
EFU_49_22513 8.8e+1 170 144 0 26 yes blast ugcccccuguuggucagugagc ugaccaccagagggcagacgcu ugaccaccagagggcagacgcucaaagcaggagcugcccccuguuggucagugagc NW_007370699.1:5305703..5305759:+
EFU_25_15221 8.8e+1 169 110 0 59 yes blast ucacugaccaccagggggcag uccccugguggucagugugcu ucacugaccaccagggggcagacgcucaaagcaggagcuguccccugguggucagugugcu NW_007370675.1:6883337..6883398:+
EFU_161_34925 8.7e+1 168 147 0 21 yes blast guucugggugugucaccugaga ucaggugacgcaccccggaaucg ucaggugacgcaccccggaaucggguuccuuccucucugguucugggugugucaccugaga NW_007370811.1:755805..755866:-
EFU_42_20825 8.7e+1 168 146 1 21 yes blast cgggggaugucugacugccagg cuggcagucagacaucccucucg cgggggaugucugacugccaggggaugucccugugggauugggccuaaacuggcagucagacaucccucucg NW_007370692.1:4801120..4801192:-
EFU_147_34111 8.7e+1 168 161 0 7 yes blast ugcccugaucgccccucag ucaggggcaaucggggcugu ugcccugaucgccccucaggagcagggggaggucgaaaagcccucaggggcaaucggggcugu NW_007370797.1:2103386..2103449:+
EFU_155_34608 8.6e+1 167 162 0 5 yes blast caaagugcucauagugcagguag acuguagugugagcacuucuag caaagugcucauagugcagguaguuuugccauuauucuacuguagugugagcacuucuag NW_007370805.1:950691..950751:+
EFU_44_21268 8.0e+1 155 153 0 2 yes blast uagugcacugaccaccagggga ccccugguggucaaugcguguca uagugcacugaccaccaggggauagcuccugcauugagcaccugcccccugguggucaaugcguguca NW_007370694.1:9016430..9016498:+
EFU_176_35746 8.0e+1 155 131 0 24 yes blast aaugucugccugccggcuuagg uaagccagcaguuggacauccc aaugucugccugccggcuuaggcccgauucccccggggaucaggccuaagccagcaguuggacauccc NW_007370826.1:1401614..1401682:+
EFU_1_534 8.0e+1 154 129 0 25 yes blast auguccaacugccagcuuagg uaagccggcaguuggacauc auguccaacugccagcuuaggagcgggccuaagccggcaguuggacauc NW_007370651.1:45099105..45099154:+
EFU_81_28075 7.9e+1 152 101 0 51 yes blast ggaccaucgguuggcgacc ucgccaaccuuucagaccucacgga ucgccaaccuuucagaccucacggaccaccagugguccacggaccaucgguuggcgacc NW_007370731.1:5621690..5621749:+
EFU_1_1067 7.9e+1 152 135 0 17 yes blast ucgggggauaucugacugcuggu acuggcagucagacaucccuc ucgggggauaucugacugcugguuuaaacuggcagucagacaucccuc NW_007370651.1:22765371..22765419:-
EFU_36_18993 7.9e+1 151 129 0 22 yes blast cgcacugaccaccagggggc cccccugguggucagugugcgua cgcacugaccaccagggggcagcuucuguguugagcaucuacccccugguggucagugugcgua NW_007370686.1:11271500..11271564:+
EFU_37_19267 7.8e+1 151 143 0 8 yes blast ccaugccucuccgcugccucaga gcaggcagaggaagaggcaccg gcaggcagaggaagaggcaccgcuggccgugacgcagggccaugccucuccgcugccucaga NW_007370687.1:13647391..13647453:+
EFU_262_38598 7.8e+1 150 146 0 4 yes blast cgggggaugucugacugccagg cuggccgucagacaucccucuca cgggggaugucugacugccagggaucaggccuaaacuggccgucagacaucccucuca NW_007370912.1:387266..387324:+
EFU_41_20425 7.5e+1 145 140 0 5 yes blast ccgggugccagcaguggguguga cacccgcugauggugcugagcga cacccgcugauggugcugagcgaucggggcuggcgccgggugccagcaguggguguga NW_007370691.1:12680057..12680115:+
EFU_325_39636 7.5e+1 154 150 2 2 no blast augacuuaggccugcucccugu agaaggcacaggccaggcu augacuuaggccugcucccugucagugggacaucccccaagggcuccuggacugcgagaaggcacaggccaggcu NW_007370975.1:319979..320054:+
EFU_203_36969 7.5e+1 144 143 0 1 yes blast ccgggugccagcaguggguguga cacccacugacagcaccaagu cacccacugacagcaccaagugaucaggaccagcuccgggugccagcaguggguguga NW_007370853.1:1799429..1799487:+
EFU_49_22508 7.5e+1 144 143 0 1 yes blast uugggggaugucugccugccgguu acuggcaguuggacauc uugggggaugucugccugccgguuuaggccugauuguggguuuugggcuuaaacuggcaguuggacauc NW_007370699.1:4795470..4795539:+
EFU_67_26136 7.5e+1 144 59 0 85 yes blast ccggcagucagacauccccagag ucgggggauguccaacugcc ucgggggauguccaacugccaguuuaggcccaauccccucaggccagucagacauccggcagucagacauccccagag NW_007370717.1:1172234..1172312:-
EFU_5_4476 7.5e+1 144 130 9 5 yes blast ugccccuuggugaucagugugc gcacugaccaccaggaggcag gcacugaccaccaggaggcaggugcucaaugcaggagcugccccuuggugaucagugugc NW_007370655.1:11783883..11783943:-
EFU_2_1597 7.4e+1 142 112 0 30 yes blast gccccgaucgccccucaggag ccucaggggcgaucagggca gccccgaucgccccucaggagcagagggaggugaagaagcccucaggggcgaucagggca NW_007370652.1:13810719..13810779:+
EFU_82_28237 7.4e+1 143 138 0 5 yes blast auaucugacugcuggcuuaggc uaagccggcagguggacaucu auaucugacugcuggcuuaggcccuaucccuuggggaucuagccuaagccggcagguggacaucu NW_007370732.1:2696675..2696740:-
EFU_65_25785 7.4e+1 143 141 0 2 yes blast ugaugucuggccucauucucagg uggguggagcccaggcauugguga ugaugucuggccucauucucagggauuccaauuuagucuggguggagcccaggcauugguga NW_007370715.1:3647500..3647562:-
EFU_169_35338 7.4e+1 142 120 0 22 yes blast uggccccaaucgccccucaggacu ccugaggggcgaucagggcugg uggccccaaucgccccucaggacuuuuccaccucucccugcuccugaggggcgaucagggcugg NW_007370819.1:595117..595181:+
EFU_42_20664 7.3e+1 139 132 0 7 yes blast ugcccugaucgccccucag ucaggggugaucagggccagc ugcccugaucgccccucaggaacaggggggagaugaagaagcccucaggggugaucagggccagc NW_007370692.1:1936055..1936120:+
EFU_2_1460 7.2e+1 138 131 0 7 yes blast aaugucugccugccggcuuagg uaagccagcaggcggacaucc aaugucugccugccggcuuaggcccaaucuccccagggaucaggccuaagccagcaggcggacaucc NW_007370652.1:3459781..3459848:+
EFU_42_20648 7.1e+1 138 135 0 3 yes blast ucgggggauaucugacugcuggu cugguagucgaacaucccucucaca ucgggggauaucugacugcugguuaaggcccacagggaucaggccuaaacugguagucgaacaucccucucaca NW_007370692.1:684477..684551:+
EFU_22_14179 7.1e+1 137 41 0 96 yes blast gggaugucugacugcugguu uggcagucggacaucccucucgu gggaugucugacugcugguuaacuggcagucggacaucccucucgu NW_007370672.1:19247855..19247901:+
EFU_44_21344 7.0e+1 134 91 0 43 yes blast gccccgaucgccccucaggag uccugaggggugaucggggccag gccccgaucgccccucaggagcagggggagguggagaaguccugaggggugaucggggccag NW_007370694.1:6557554..6557616:-
EFU_181_35998 6.9e+1 142 140 0 2 no blast uccggaauggggcuucagcgcug cggggagccccaguccugguuc uccggaauggggcuucagcgcuggagaucucguacaacggggagccccaguccugguuc NW_007370831.1:1604383..1604442:+
EFU_19_13123 6.9e+1 133 132 0 1 yes blast gauguccgacugcuggcuuagga cuaagccaucagucgga gauguccgacugcuggcuuaggaccccccuaggggagugggccuaagccaucagucgga NW_007370669.1:17160802..17160861:-
EFU_8_6589 6.9e+1 133 127 0 6 yes blast acuggcccugcucgcacccgcu aggugcgagugguggcugcu acuggcccugcucgcacccgcugccagcacccagagccggucccgaucacucggcacugucagcaggugcgagugguggcugcu NW_007370658.1:19150128..19150212:-
EFU_6_5089 6.9e+1 132 129 1 2 yes blast ugcccugaucgccccucag ucaggggcaaucagggccggc ugcccugaucgccccucagaagcagggggagguggagaagcccucaggggcaaucagggccggc NW_007370656.1:3369990..3370054:-
EFU_109_31131 6.8e+1 132 126 0 6 yes blast uaagccagcagucggacaucu gauaucugacugccagcuuaga gauaucugacugccagcuuagacaccccccagggagaucgggccuaagccagcagucggacaucu NW_007370759.1:2720772..2720837:+
EFU_3_2470 6.8e+1 139 138 0 1 no blast ggcggggccagggcuggcacu gccgcggcugccucgcc ggcggggccagggcuggcacuuaggucaccugccgcggcugccucgcc NW_007370653.1:2334361..2334409:+
EFU_456_40602 6.8e+1 131 100 0 31 yes blast caucugcccccugguggucggu agugaccaccagggugcagcuc agugaccaccagggugcagcuccuguguuaagcaucugcccccugguggucggu NW_007371106.1:137041..137095:-
EFU_98_30041 6.8e+1 130 73 0 57 yes blast cacugaucaccagagggcagcu ugcccccugguggucagu cacugaucaccagagggcagcuccugcauuuagugucugcccccugguggucagu NW_007370748.1:553479..553534:-
EFU_7_5509 6.6e+1 127 107 0 20 yes blast ccggcagucagacaucccucucu cgggggauguccgacugcc cgggggauguccgacugccaguccaaccggcagucagacaucccucucu NW_007370657.1:10198068..10198117:+
EFU_202_36927 6.5e+1 138 137 0 1 no blast ugcaagcaacacucuguggcaga gacacaauuugagcuugcuaua ugcaagcaacacucuguggcagaugagcgacacugucugacacaauuugagcuugcuaua NW_007370852.1:1279604..1279664:-
EFU_260_38553 6.5e+1 133 121 0 12 no blast ggguucgauucccggucaggg ugcccggguugcggacuccauc ggguucgauucccggucagggcccgugcccggguugcggacuccauc NW_007370910.1:666913..666960:+
EFU_81_28107 6.5e+1 124 115 0 9 yes blast augucugacugcuggcuuagg uaagccaucagucagacauccc augucugacugcuggcuuaggcccucuccccagcaguccuaagccaucagucagacauccc NW_007370731.1:1077851..1077912:-
EFU_329_39681 6.5e+1 124 123 0 1 yes blast caggggauguccgacugccggua cagcagucagauaucccucu caggggauguccgacugccgguauaggccugaucgcugcagggucgggccuaaaccagcagucagauaucccucu NW_007370979.1:20677..20752:-
EFU_10_7632 6.4e+1 124 122 0 2 yes blast ugagggaugucugacugccagu gggcaguuggacaucccucuugc ugagggaugucugacugccaguuuaggcccgauccuauagggcaguuggacaucccucuugc NW_007370660.1:18165793..18165855:+
EFU_22_13954 6.4e+1 124 114 0 10 yes blast gcugcccccugauggucagug ugacuaccaggaggcagacacu ugacuaccaggaggcagacacuaaacgcaggagcugcccccugauggucagug NW_007370672.1:2886354..2886407:+
EFU_19_12902 6.4e+1 122 34 0 88 yes blast gaugucugccugccggcuuaga uaagcuggcaggcagacauccc gaugucugccugccggcuuagauccugaucccccggggaucgggccuaagcuggcaggcagacauccc NW_007370669.1:21410858..21410926:+
EFU_96_29846 6.4e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaccguuuuucauuauugcuccugacc NW_007370746.1:43620..43678:-
EFU_282_38978 6.2e+1 120 100 0 20 yes blast aucugccucucuguccccaga auggggauaguguugaggugguu auggggauaguguugaggugguucaggagcccucugaucugccucucuguccccaga NW_007370932.1:239336..239393:-
EFU_3_2907 6.2e+1 119 117 1 1 yes blast acugaccuccagggagcag ugcccucugcuggucagugugc acugaccuccagggagcagaugcucaauacaggagcugcccucugcccucugcuggucagugugc NW_007370653.1:3913804..3913869:-
EFU_39_19878 6.2e+1 118 107 0 11 yes blast caggcagucggacaucccucuag gagggauguccgacugcc gagggauguccgacugcccguuuaggccugggaucgggccuaaacaggcagucggacaucccucuag NW_007370689.1:6196074..6196141:-
EFU_85_28541 6.1e+1 117 99 0 18 yes blast aaugcacugaccaccagggggc cccccugauggucagugcauguu aaugcacugaccaccagggggcagcuccugcauugagcguaugcccccugauggucagugcauguu NW_007370735.1:1735951..1736017:+
EFU_16_11488 6.1e+1 118 115 0 3 yes blast cacccgcugcuggcgcccagc cuuggugccaucagcaggu cacccgcugcuggcgcccagcgccagcccugaucucuuggugccaucagcaggu NW_007370666.1:23951654..23951708:+
EFU_253_38388 6.0e+1 116 100 0 16 yes blast uugggggauguccgacugcuggua cggcagucagacaucccucucgca uugggggauguccgacugcugguaucgggccuaaaucggcagucagacaucccucucgca NW_007370903.1:602385..602445:+
EFU_8_6643 6.0e+1 114 112 1 1 yes blast ugccccaaucgccccucaggag ccucaggggugaucagggcuggc ugccccaaucgccccucaggaguagggggagguggagaagcccucaggggugaucagggcuggc NW_007370658.1:24057955..24058019:-
EFU_32_17856 6.0e+1 114 90 0 24 yes blast ugccgugaucgccccucagga ccugaggggcgaucugggcuggc ugccgugaucgccccucaggaacagggagagguggagaagcccugaggggcgaucugggcuggc NW_007370682.1:8171274..8171338:-
EFU_68_26272 5.9e+1 112 105 0 7 yes blast ugccccaaucgccccucaggag ucaggggugaucagggccagc ugccccaaucgccccucaggagaaaggggaaauggagaagcucucaggggugaucagggccagc NW_007370718.1:5101319..5101383:+
EFU_6_5267 5.7e+1 110 109 0 1 yes blast gaugucugacugcccgcuuagg gggcggacaggcggaca gaugucugacugcccgcuuaggccugaucccccugggcggacaggcggaca NW_007370656.1:21405855..21405906:-
EFU_10_7996 5.7e+1 109 106 0 3 yes blast cccccugguggucaguguguucu augcacacuuaccaccaggggac augcacacuuaccaccaggggacagacacucaaugcaggaucuucccccugguggucaguguguucu NW_007370660.1:22220489..22220556:-
EFU_37_19144 5.6e+1 107 94 0 13 yes blast caggugaugcacccuggaaucggg gguuccggggugcgucacccga caggugaugcacccuggaaucgggcucccuucucucugguuccggggugcgucacccga NW_007370687.1:929053..929112:+
EFU_63_25360 5.4e+1 114 108 0 6 no blast aaugcaguggaccugggccagau uuggccugggcacacgcauca aaugcaguggaccugggccagaugagcagcuucuacauuggccugggcacacgcauca NW_007370713.1:3712406..3712464:+
EFU_1_1396 5.3e+1 100 75 0 25 yes blast gauguccgacugcuggcuuagg aagccagcagucggacauc gauguccgacugcuggcuuaggccugggagcaggccaaagccagcagucggacauc NW_007370651.1:61214900..61214956:-
EFU_52_23142 5.2e+1 99 96 2 1 yes blast agccccgaucaccccucaggac cugaggggugaucagggca agccccgaucaccccucaggacuucuccaccucccccugcuccugaggggugaucagggca NW_007370702.1:8259749..8259810:+
EFU_197_36698 5.2e+1 99 96 0 3 yes blast agccccgaucaccccucaggac ccugaggggcgaucgggga agccccgaucaccccucaggacuucuccaccucuccuugcuccugaggggcgaucgggga NW_007370847.1:1247358..1247418:+
EFU_86_28695 5.1e+1 97 83 0 14 yes blast cacuggcagugggugugagcggu ugcucgcacccgcugacagug ugcucgcacccgcugacagugacgagcaaucggguccgguaacaggcacuggcagugggugugagcggu NW_007370736.1:3116572..3116641:+
EFU_30_17041 5.1e+1 97 89 2 6 yes blast gagagggaugucugacuacuggu uggcagucagacauccccugag gagagggaugucugacuacugguuuaggcucgaucccgcaggguucgggccuaaaguggcagucagacauccccugag NW_007370680.1:481165..481243:-
EFU_21_13579 5.0e+1 95 41 0 54 yes blast cagcagucagauaucccucuug aggggauguccgacugcugguuu aggggauguccgacugcugguuuagugggaucgcgccuaaaccagcagucagauaucccucuug NW_007370671.1:4321973..4322037:+
EFU_49_22562 4.9e+1 94 86 1 7 yes blast cgccccgaucaccccucaggau ccugaggggugauuggggc cgccccgaucaccccucaggaucagggggagguggagaagcccugaggggugauuggggc NW_007370699.1:10046426..10046486:+
EFU_44_21220 4.9e+1 93 80 2 11 yes blast ggccccgaucaccccucaggac ccugaggggcgaucggggccgg ggccccgaucaccccucaggacuucuccaccucccccugcuccugaggggcgaucggggccgg NW_007370694.1:6557556..6557619:+
EFU_170_35398 4.9e+1 94 89 0 5 yes blast gagagggaugucugacuacuggu uuugcaguuggacauccccuga gagagggaugucugacuacugguuuaggccugauucuggggauugggccuaaauuugcaguuggacauccccuga NW_007370820.1:2445754..2445829:+
EFU_10_8053 4.9e+1 92 75 0 17 yes blast cacccgcugcuggugcccagu cucggcacugucagugggugc cacccgcugcuggugcccagugccggucccaaucacucggcacugucagugggugc NW_007370660.1:28038626..28038682:-
EFU_86_28717 4.6e+1 87 10 3 74 yes blast ugcccucugauggucagugcac ugcacugaccaccagggggcag ugcacugaccaccagggggcagcuccugcauugagcgucugcccucugauggucagugcac NW_007370736.1:5392030..5392091:+
EFU_158_34765 4.6e+1 87 83 0 4 yes blast cugggcgccggcagugggugu caccugcugauggcgccgag caccugcugauggcgccgagcaaucugggcuggcgcugggcgccggcagugggugu NW_007370808.1:110180..110236:+
EFU_62_25102 4.6e+1 87 75 0 12 yes blast cacccgcugcuggugcccagu cucggcaccaucagugggugcg cacccgcugcuggugcccagugccagucccaaucgcucggcaccaucagugggugcg NW_007370712.1:776773..776830:+
EFU_4_3337 4.6e+1 87 83 0 4 yes blast cugggcgccggcagugggugu caccugcugacggcaccgagc caccugcugacggcaccgagcaaucaggauuggugcugggcgccggcagugggugu NW_007370654.1:7931239..7931295:+
EFU_7_5641 4.5e+1 85 75 5 5 yes blast ugcugucagcaggugcgagcgg ugcuugcaccugcugauggcg ugcuugcaccugcugauggcgcagagcaauuggggccagugccagcaguggugugaguggggcaggugcugucagcaggugcgagcgg NW_007370657.1:22152411..22152499:+
EFU_92_29382 4.4e+1 102 101 0 1 no blast acuccggcugcagcagagaa ucaguugucuucagucuu acuccggcugcagcagagaagccuagccucuuccgucuucagucuucaguugucuucagucuu NW_007370742.1:550430..550493:+
EFU_71_26769 4.3e+1 82 79 0 3 yes blast gggucccuuggccuggccugcgu gcagaccaggccgagggu gggucccuuggccuggccugcguccucucacaaucgguuucuucccgauccugcagaccaggccgagggu NW_007370721.1:5105239..5105309:-
EFU_1_602 4.3e+1 82 81 0 1 yes blast cggcggcggcagcggcggcggc ccgccucuguggcccacgucccugcu cggcggcggcagcggcggcggcagcagcaacaugcccgccucuguggcccacgucccugcu NW_007370651.1:50754393..50754454:+
EFU_55_23753 4.2e+1 80 52 0 28 yes blast ucaaguguucuaguucagaca gucugaaccagagcacuuuu gucugaaccagagcacuuuugagagugguacugaaugcucucaaguguucuaguucagaca NW_007370705.1:2068230..2068291:+
EFU_22_14144 4.0e+1 77 49 0 28 yes blast cccccgaggggucccggauug gaucgggccuaacccggcagu gaucgggccuaacccggcaguaagacaucccccgaggggucccggauug NW_007370672.1:17001145..17001194:+
EFU_181_35990 4.0e+1 75 55 0 20 yes blast cugccuagaccccugcccacc uggggcggggguucugggcugg uggggcggggguucugggcugggcuuggguguacgcccugccuagaccccugcccacc NW_007370831.1:1440912..1440970:+
EFU_85_28573 4.0e+1 75 39 0 36 yes blast uccccugcccaggccuaacg uuaggccugggcaggggcggagc uccccugcccaggccuaacgcgucggccagagacuuuaggccugggcaggggcggagc NW_007370735.1:4828213..4828271:+
EFU_50_22755 3.9e+1 73 66 0 7 yes blast uaagccagcagucggacauc augucugacugaugacuuagg augucugacugaugacuuaggccugcucuccacagggagcgggccuaagccagcagucggacauc NW_007370700.1:8058486..8058551:+
EFU_237_38004 3.8e+1 72 64 1 7 yes blast ugcccagaucgccccucaggagc cccucaggggcgaucggga ugcccagaucgccccucaggagcagggggagauggagaagcccucaggggcgaucggga NW_007370887.1:1183532..1183591:+
EFU_153_34511 3.7e+1 70 67 0 3 yes blast gauguccgacugcuggcuuagg uaagccugcaguuggacauccu gauguccgacugcuggcuuaggccagaucccuggggcaauugggccuaagccugcaguuggacauccu NW_007370803.1:1897712..1897780:-
EFU_237_38005 3.7e+1 69 67 0 2 yes blast cccagauugccccucaggag ccugaggggcgaucagggc cccagauugccccucaggagcaggggaagguagagaagcccugaggggcgaucagggc NW_007370887.1:1183330..1183388:-
EFU_86_28755 3.7e+1 69 54 0 15 yes blast ugccuugaucgccccucaggag ccugaggggcgaucggggcca ugccuugaucgccccucaggagcaccaggaggaggagaagcccugaggggcgaucggggcca NW_007370736.1:4405827..4405889:-
EFU_153_34502 3.7e+1 70 69 0 1 yes blast cccccggcgccggcucugcggcu ccgcagggaggauccggggaaa cccccggcgccggcucugcggcugcugaaucggaagccgcagggaggauccggggaaa NW_007370803.1:2798012..2798070:+
EFU_1_873 3.6e+1 68 46 0 22 yes blast acugaucaccagagggcagaca cugcccucugguggucagug acugaucaccagagggcagacacucaacgcaggagcugcccucugguggucagug NW_007370651.1:8337740..8337795:-
EFU_22_13968 3.6e+1 76 71 0 5 no blast ggggauguccuacugccggcuu cacagucuggccucccucug ggggauguccuacugccggcuuagacccgcuccccacacuuaagccacagucuggccucccucug NW_007370672.1:3901612..3901677:+
EFU_12_9064 3.6e+1 66 64 0 2 yes blast ugcccagaucgccccucaggagc ccugaggggcgaucagggc ugcccagaucgccccucaggagcaggggguggagaagcccugaggggcgaucagggc NW_007370662.1:22485580..22485637:+
EFU_17_11885 3.6e+1 67 52 0 15 yes blast ucggugcugucagcaggugugag ugcacccacugcuggcacccag ugcacccacugcuggcacccagcucuggucccaaucacucggugcugucagcaggugugag NW_007370667.1:13881339..13881400:+
EFU_87_28867 3.5e+1 66 64 1 1 yes blast ugcccagaucgccccucaggagc ccucaggggugaucuggac ugcccagaucgccccucaggagcagggggagguggagaagcccucaggggugaucuggac NW_007370737.1:2425682..2425742:-
EFU_214_37381 3.5e+1 66 65 0 1 yes blast uguaugugaugggguuggcgc ccaacccugucacaugcaccug ccaacccugucacaugcaccuguauuuguacgggguguaugugaugggguuggcgc NW_007370864.1:136086..136142:+
EFU_67_26161 3.5e+1 66 45 0 21 yes blast ugccccgaucgccccucaggau ccucaggggcgaucaggg ugccccgaucgccccucaggauuaggaggaggugaagaagcccucaggggcgaucaggg NW_007370717.1:4004050..4004109:-
EFU_1_1402 3.5e+1 65 62 0 3 yes blast caggugggcggggccucucucu agggaggcccaggccacug agggaggcccaggccacugacgggugggcugcagcaggugggcggggccucucucu NW_007370651.1:61949853..61949909:-
EFU_91_29304 3.4e+1 65 23 3 39 yes blast uagcagcacagaaauauuggca ccaauauuggcugagcugcuccag uagcagcacagaaauauuggcacugggaagagucugccaauauuggcugagcugcuccag NW_007370741.1:5148514..5148574:+
EFU_2_1525 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucauuuccugcccuggcccgagggaccgacu NW_007370652.1:8426574..8426635:+
EFU_3_2944 3.4e+1 64 48 0 16 yes blast cacguugggaaacuguggcauc ugccacagcgccggacucugcc ugccacagcgccggacucugccuugcauguggugacagacacguugggaaacuguggcauc NW_007370653.1:8039789..8039850:-
EFU_28_16361 3.3e+1 75 71 0 4 no blast uacugguucagggaggaaggaga accacgucucugagcaguacaca accacgucucugagcaguacacauuauuauauuuguacugguucagggaggaaggaga NW_007370678.1:12539439..12539497:+
EFU_3_3171 3.3e+1 65 61 0 4 no blast cacagucggacaucccccaagg gucagaggcuugucuga cacagucggacaucccccaagggcucccgggcugucagaggcuugucuga NW_007370653.1:36400699..36400749:-
EFU_197_36704 3.3e+1 64 42 1 21 yes blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucaugugucgugugugggauccgucucaguuacuuuauagcc NW_007370847.1:1370625..1370690:+
EFU_22_14172 3.2e+1 61 59 0 2 yes blast cccaggcuggccaggcaccccau gggguguggccagccug cccaggcuggccaggcaccccaucgggaccccccacccugaaggggguguggccagccug NW_007370672.1:18944694..18944754:+
EFU_62_25130 3.2e+1 63 49 0 14 yes blast aauuacagauugucuaagagga ucucucaggcgaccuguaggu aauuacagauugucuaagaggaaaacauuuauauucucucaggcgaccuguaggu NW_007370712.1:2583471..2583526:+
EFU_261_38573 3.2e+1 59 58 0 1 yes blast uguaugugaugggguuggcg ccaacccugucacaugcaccug ccaacccugucacaugcaccuguauuuguacgggguguaugugaugggguuggcg NW_007370911.1:316730..316785:+
EFU_181_35987 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucagggggcucugaauguguacaguagucugcacauugguu NW_007370831.1:1080047..1080109:+
EFU_34_18446 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucaggacaaugccguuguacaguagucugcacauugguu NW_007370684.1:1291623..1291683:-
EFU_20_13305 3.1e+1 59 26 0 33 yes blast ccccgauugccccucaggac ccucaggggcgaucagggccu ccccgauugccccucaggaccaggaggaaguggagaagccccucaggggcgaucagggccu NW_007370670.1:13450591..13450652:+
EFU_248_38302 3.0e+1 57 56 0 1 yes blast ugaucaacacuugccucucucu agagaagcagggacugauccg agagaagcagggacugauccguugccucuguggcagcuuuugaucaacacuugccucucucu NW_007370898.1:636691..636753:-
EFU_14_10682 3.0e+1 64 59 0 5 no blast agagcacacugaccaccagag ucuggcugaguggugcuccccc ucuggcugaguggugcucccccugugagagcacacugaccaccagag NW_007370664.1:20905120..20905167:-
EFU_126_32685 3.0e+1 55 54 0 1 yes blast cgcugaggggcuuggccagccu ggcuggccagacaccccag cgcugaggggcuuggccagccuguaaacagccaucagccccucacauaggcuggccagacaccccag NW_007370776.1:1684492..1684559:-
EFU_136_33416 2.9e+1 54 47 3 4 yes blast ccugaggggcaauuggggucgg gccccgaucgccccucag gccccgaucgccccucagagcuucuccaccucccccugcuccugaggggcaauuggggucgg NW_007370786.1:1054574..1054636:-
EFU_77_27451 2.9e+1 55 53 0 2 yes blast cuuguaccugcugauggcac cuggcagugggugcaagc cuuguaccugcugauggcaccaagugaucaggaccaacaccuggcgcuggcagugggugcaagc NW_007370727.1:1009773..1009837:-
EFU_189_36362 2.9e+1 107 103 0 4 yes blast agggggcggggaggggg uccucucugaaaucaau uccucucugaaaucaauaaaaacauuuaaaaaaaagagagaggggggaggggagaagugaaaagggaggagggggcggggaggggg NW_007370839.1:860189..860275:-
EFU_16_11444 2.9e+1 54 45 0 9 yes blast ugcugggguuccuggccagccu cuggccaagccccccagugggg ugcugggguuccuggccagccugggugagggauugaugguuguuugcaggcuggccaagccccccagugggg NW_007370666.1:18021414..18021486:+
EFU_57_24208 2.9e+1 54 51 0 3 yes blast gcuggccaggccccccagcagg cauggggguauggccagccug gcuggccaggccccccagcagggacucuuacuccauggggguauggccagccug NW_007370707.1:8048606..8048660:+
EFU_84_28430 2.8e+1 53 50 0 3 yes blast ggccccaauugccccucaggac cucaggggugaucggggccagc ggccccaauugccccucaggaccaggggaagguggagaagcccucaggggugaucggggccagc NW_007370734.1:5362534..5362598:+
EFU_25_15314 2.8e+1 53 52 0 1 yes blast acucacacccacugauggcacu ugccagcagugggugcaag acucacacccacugauggcacugagcgaucaggaccggugccaggugccagcagugggugcaag NW_007370675.1:15302201..15302265:+
EFU_76_27281 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu NW_007370726.1:996156..996210:+
EFU_52_23211 2.8e+1 52 48 0 4 yes blast agagagguagggucugauccac ugaccagccauugccucucucu agagagguagggucugauccacagccucuguggcagcuguugaccagccauugccucucucu NW_007370702.1:3647918..3647980:-
EFU_485_40651 2.7e+1 51 50 0 1 yes blast auuugggggcucguccgggau ucugaacccugggcaua ucugaacccugggcauaacauuugggggcucguccgggau NW_007371135.1:49247..49287:+
EFU_101_30321 2.7e+1 51 49 0 2 yes blast ucuggcaucuuggggucuccag agagacccgaaggagcgagaggaaa agagacccgaaggagcgagaggaaaggugugcucccucuggcaucuuggggucuccag NW_007370751.1:2961757..2961815:+
EFU_19_13148 2.7e+1 50 47 0 3 yes blast cgcugaggggcuuggccagccu aauggcccucagccccucaccca aauggcccucagccccucacccaggcgggccacacccccauggggugagaguccccgcugaggggcuuggccagccu NW_007370669.1:19055439..19055516:-
EFU_124_32484 2.7e+1 50 48 0 2 yes blast aagcauccugccccaccccuggc uggggugguguggaaugccugc uggggugguguggaaugccugcguugucaccaugcgacgaugcaagcauccugccccaccccuggc NW_007370774.1:3358200..3358266:-
EFU_1_1005 2.7e+1 50 48 0 2 yes blast agagagguagggucugauccac ugaucagccguugccucucucuu agagagguagggucugauccacagccuucauggcagcugcugaucagccguugccucucucuu NW_007370651.1:18638054..18638117:-
EFU_3_2696 2.6e+1 49 44 0 5 yes blast agagaggcagggucugauacacagc gaugaucaguacuugccucucu agagaggcagggucugauacacagccucaguggcagcugaugaucaguacuugccucucu NW_007370653.1:26371936..26371996:+
EFU_25_15472 2.6e+1 49 41 0 8 yes blast accggcaguuggccaucccucu ggggaugucugacugccgguu ggggaugucugacugccgguuucccugggaucagaccgaaaccggcaguuggccaucccucu NW_007370675.1:13826544..13826606:-
EFU_68_26326 2.6e+1 48 46 0 2 yes blast caccagcagugggugugagugg ugcucacauccacugacagugc ugcucacauccacugacagugccaagugauuuggaccagcgcugggcaccagcagugggugugagugg NW_007370718.1:2142235..2142303:-
EFU_15_11009 2.6e+1 62 57 0 5 no blast ggaggggcagagagagagaaa uguuguuguuaaucuucacc uguuguuguuaaucuucacccgaggauauuuuuccacugauucuuagagaaaguggaagggagggggaggggcagagagagagaaa NW_007370665.1:26456146..26456232:+
EFU_20_13250 2.5e+1 47 26 10 11 yes blast ugcacccacugacagcaccgagu cugggcgcuggcagcgggugc ugcacccacugacagcaccgagugauuagagcuggugcugggcgcuggcagcgggugc NW_007370670.1:6230797..6230855:+
EFU_28_16237 2.5e+1 47 29 0 18 yes blast agaggcaagugcugaucaacagc auggauuagacccugcuucu agaggcaagugcugaucaacagcugccacagaggcuauggauuagacccugcuucu NW_007370678.1:1370047..1370103:+
EFU_34_18334 2.4e+1 52 44 0 8 no blast caccugcugcuggcacccagcg cucggugcugucagcaggugc caccugcugcuggcacccagcgucgcccugaucacucggugcugucagcaggugc NW_007370684.1:4615765..4615820:+
EFU_52_23157 2.3e+1 43 42 0 1 yes blast gcuggcccugggugucuggg ugagcagcugggcagcc ugagcagcugggcagccaccauccaaggcuugccugugucuugggcuggcccugggugucuggg NW_007370702.1:9554738..9554802:+
EFU_13_9978 2.3e+1 43 27 12 4 yes blast ccguugaucagcacuugccucucu cccgggcugcugaucag ccguugaucagcacuugccucucucuuuuuuucugggccuggucaguagccacgccuccauuucucuccaggccuccacccgggcugcugaucag NW_007370663.1:12200320..12200415:-
EFU_29_16630 2.3e+1 42 35 0 7 yes blast acacccacugacggcgccgagu ccaggcgcugucagcgggugc acacccacugacggcgccgagugauugggaccagcgccaggcgcugucagcgggugc NW_007370679.1:2274661..2274718:+
EFU_133_33209 2.2e+1 41 40 0 1 yes blast ccccgguggucagugugcuu agcacacugaccacgagggg agcacacugaccacgagggggcagcuccgguguugagcaucuguccccgguggucagugugcuu NW_007370783.1:2464772..2464836:+
EFU_79_27733 2.2e+1 42 41 0 1 yes blast gugacacaccccggaaccggg ugguuccagaugugucacccga gugacacaccccggaaccgggcucccuccuuucugguuccagaugugucacccga NW_007370729.1:757191..757246:-
EFU_1_855 2.2e+1 40 38 0 2 yes blast ugccccaaucgucccucaggag uucaggggugauuggggccagc ugccccaaucgucccucaggagcagggggaaguggagaagccuucaggggugauuggggccagc NW_007370651.1:7809821..7809885:-
EFU_41_20628 2.2e+1 49 46 0 3 yes blast aagaggaggaggaggaggaggaug ugcaccaggccucuaguu ugcaccaggccucuaguuucuuuauaaaaguaaaaaggagaaggagaaggagaagaaggaggaggagaaagaggaggaggaggaggaggaug NW_007370691.1:11858936..11859028:-
EFU_4_4039 2.1e+1 39 37 0 2 yes blast gaacgaaauccaagcgcagcug gcugcuuuugggauuccguugcc gaacgaaauccaagcgcagcuggaaugcucuggagacaacagcugcuuuugggauuccguugcc NW_007370654.1:39581865..39581929:-
EFU_2_1691 2.1e+1 39 38 0 1 yes blast gcccuggcuggcuuggcucaaugg cacugagcuaaacuggc cacugagcuaaacuggcuagggccacaacacacuuuuagauacugauaaaaaaauaguuuccagcccuggcuggcuuggcucaaugg NW_007370652.1:21126162..21126249:+
EFU_371_40132 2.1e+1 38 20 0 18 yes blast cacugagcaccaggaggcag ugcccucugguggucagugcac cacugagcaccaggaggcagaugcucaaugcaggaacugcccucugguggucagugcac NW_007371021.1:213005..213064:+
EFU_40_20014 2.0e+1 37 31 0 6 yes blast ugaccugugucgcuggcauca uggcagcgacacaggccaggguu ugaccugugucgcuggcaucagauaagagcugccaucugauggcagcgacacaggccaggguu NW_007370690.1:8915733..8915796:+
EFU_93_29454 2.0e+1 37 26 0 11 yes blast cacggaggccuggguugggaca ucucaccccagcccuccuuccga cacggaggccuggguugggacauuuggaauaaaaugcaauucuucuuacagucucaccccagcccuccuuccga NW_007370743.1:1377659..1377733:+
EFU_6_5170 2.0e+1 36 31 0 5 yes blast cugcccuguguucucuccagu cuggagaggacagcagcagagc cuggagaggacagcagcagagccgggacauggcugcccuguguucucuccagu NW_007370656.1:11943289..11943342:-
EFU_25_15319 1.9e+1 35 20 0 15 yes blast aggggauguccgacugccaguu aacggcagucggaccucccucu aggggauguccgacugccaguuuaggcccgaucgcagggaucaggccuaaaacggcagucggaccucccucu NW_007370675.1:15940415..15940487:+
EFU_33_18064 1.9e+1 35 26 1 8 yes blast caccagcagugggugugagugg gcucguacccgcugauggcaug gcucguacccgcugauggcauggagcaauuggggccugcaccagcagugggugugagugg NW_007370683.1:11868918..11868978:+
EFU_150_34278 1.9e+1 35 18 0 17 yes blast ugccccuaucgccccucaggag ccucaggggcgaucaggg ugccccuaucgccccucaggagcaugaggaggugagaaagcccucaggggcgaucaggg NW_007370800.1:223730..223789:+
EFU_7_5945 1.9e+1 35 30 0 5 yes blast gcuggccaagucccccagcggg cauggggguguggccagccug gcuggccaagucccccagcggggacccucaccccauggggguguggccagccug NW_007370657.1:20618573..20618627:-
EFU_33_17999 1.9e+1 35 30 0 5 yes blast ccggcagucgaacaucccucuca ucgggggaugucugaaugcc ucgggggaugucugaaugccuguuuaggcacgaucucggggaucaggcuuaaaccggcagucgaacaucccucuca NW_007370683.1:3741677..3741753:+
EFU_82_28164 1.9e+1 35 30 0 5 yes blast gcuggccaagucccccagcggg cauggggguguggccagccug gcuggccaagucccccagcggggacccucucuccauggggguguggccagccug NW_007370732.1:620147..620201:+
EFU_2_2350 1.9e+1 33 32 0 1 yes blast uccugaggggugaugggggcagc agccccaauugccccucagg agccccaauugccccucagggcuucucuaucucccccugcuccugaggggugaugggggcagc NW_007370652.1:38377665..38377728:-
EFU_1_66 1.8e+1 41 22 0 19 no blast ugggacugggugagaugggu caaccuccugcagucccuccuu ugggacugggugagauggguuggacaugcccuggagccaaccuccugcagucccuccuu NW_007370651.1:5018764..5018823:+
EFU_3_2661 1.8e+1 41 40 0 1 no blast ugcacccacugcuggcgcccagu ccggggccagagcugcc ccggggccagagcugccgcuugcacccacugcuggcgcccagu NW_007370653.1:21744578..21744621:+
EFU_47_22036 1.7e+1 38 28 9 1 no blast cgcgccagcgcggccggccgacu gcggccggggucuggaguc cgcgccagcgcggccggccgacuucggggggaagcggcggcuccccucccgcccucccucccggcggccggggucuggaguc NW_007370697.1:3847052..3847134:+
EFU_191_36443 1.7e+1 31 29 0 2 yes blast cgccagcagcaggugcaagugga ccacucacacccgcugauggc ccacucacacccgcugauggcgcagaaugauugggaccagcagcgccagcagcaggugcaagugga NW_007370841.1:930649..930715:+
EFU_33_18237 1.7e+1 30 24 0 6 yes blast ugaccucggugcugcggugacc ugaccugggugcuguggugacc ugaccucggugcugcggugaccuuggugcugcggugaccucagugcugcagugaccugggugcuguggugacc NW_007370683.1:14574578..14574651:-
EFU_137_33491 1.7e+1 30 13 0 17 yes blast uugggggauguuugacugccggu acuggcagucagacaucccuc uugggggauguuugacugccgguuucaggccaaacuggcagucagacaucccuc NW_007370787.1:421250..421304:-
EFU_3_3195 1.6e+1 38 35 0 3 no blast guccuucagccuggccugcgcu uguccaccugccagcuuaggccc guccuucagccuggccugcgcucucucacaauccaggaccccuuguggaauguccaccugccagcuuaggccc NW_007370653.1:39098656..39098729:-
EFU_146_34031 1.6e+1 37 27 0 10 no blast cuugcacccacugacggcaccg ggaccagcgcugggcacug cuugcacccacugacggcaccgaacaauugggaccagcgcugggcacug NW_007370796.1:1368732..1368781:+
EFU_19_13053 1.6e+1 30 27 2 1 yes blast acacugaacaccaggggacag ccccauggucaucagug acacugaacaccaggggacagaugcucaacacaggagcugccccauggucaucagug NW_007370669.1:11769949..11770006:-
EFU_15_11178 1.5e+1 35 34 0 1 no blast cucugaaccgccgcccgcacg gccgggaggcggggcagcagga gccgggaggcggggcagcaggagacucgcucggccccucugaaccgccgcccgcacg NW_007370665.1:15023634..15023691:-
EFU_1_647 1.5e+1 25 15 1 9 yes blast accagcagugggugcaaguggu acuugcacccacugauggcacc acuugcacccacugauggcaccgagugauugggacuggcgcugggcaccagcagugggugcaaguggu NW_007370651.1:54579135..54579203:+
EFU_53_23430 1.4e+1 24 22 0 2 yes blast agcgcacugaccaccaggggga cccgguggucagugcac agcgcacugaccaccagggggaagcugcugcauugagugucuucccccgguggucagugcac NW_007370703.1:5076347..5076409:-
EFU_143_33857 1.4e+1 24 20 0 4 yes blast cucagugccgucagugggugc cacccucugcuggugcc cacccucugcuggugccuggcaccaaucccaaucgcucagugccgucagugggugc NW_007370793.1:2260294..2260350:+
EFU_6211_41688 1.3e+1 23 21 0 2 yes blast auggaucagacccugccuuucu agaggcaaguucugaucaaugg agaggcaaguucugaucaauggcugccacagaggcuauggaucagacccugccuuucu NW_007376861.1:800..858:-
EFU_198_36761 1.3e+1 23 20 0 3 yes blast aacuguuugcagaggaaacugaga ucagucucaucugcaaagaag aacuguuugcagaggaaacugagacuuuguaacuacaucucagucucaucugcaaagaag NW_007370848.1:1911163..1911223:-
EFU_261_38572 1.3e+1 22 21 0 1 yes blast caccugcugccagugcccagug cuuggagccaucagcgggu caccugcugccagugcccagugccagucccgaucacuuggagccaucagcgggu NW_007370911.1:297132..297186:+
EFU_111_31309 1.2e+1 22 20 0 2 yes blast ugccagcagcgggugcaaguggug cccgcucacacccgcugauggu cccgcucacacccgcugauggugcagagcgauugaggccacugccagcagcgggugcaaguggug NW_007370761.1:3616071..3616136:+
EFU_163_35038 1.2e+1 29 15 0 14 no blast accagcagugggugcaaguggu ccgcucgcacccgcugauggca ccgcucgcacccgcugauggcaaggagcaauuggggccagcaccagcagugggugcaaguggu NW_007370813.1:1129665..1129728:-
EFU_17_12174 1.2e+1 29 11 0 18 no blast ccuugguuguaggcucgaucccc uucgauucuggucaagggcaagu uucgauucuggucaagggcaaguaccuugguuguaggcucgaucccc NW_007370667.1:20540947..20540994:-
EFU_83_28277 1.2e+1 30 29 0 1 no blast agugcacugaccaccagaggac cuucuggcugaguggcgcuc cuucuggcugaguggcgcucccgcuguggaagugcacugaccaccagaggac NW_007370733.1:1870402..1870454:+
EFU_242_38125 1.2e+1 27 20 0 7 no blast cagggccgggccgggccgggc uccgcuccggcuccggcuc uccgcuccggcuccggcucccggggcaguggcugcugcagggccgggccgggccgggc NW_007370892.1:958973..959031:+
EFU_309_39419 1.1e+1 20 15 0 5 yes blast ucaaaugcucagacuccuguggu ccacggauguuugagcaugugcua ucaaaugcucagacuccugugguggcugcucaugcaccacggauguuugagcaugugcua NW_007370959.1:200739..200799:-
EFU_156_34686 1.1e+1 27 26 0 1 no blast cucggggaguuugggcagucugcu ccaggcugcugcacuccucagcuc cucggggaguuugggcagucugcucgcugagcauguugggccaggcugcugcacuccucagcuc NW_007370806.1:2805056..2805120:+
EFU_17_12197 1.1e+1 19 16 0 3 yes blast aagggggcugcggaucaggccu ucugauccguagccuccg aagggggcugcggaucaggccugaagagaggccuggagagagaagcagggucugauccguagccuccg NW_007370667.1:23249368..23249436:-
EFU_164_35138 1.1e+1 20 17 0 3 yes blast auuucucccaccucagucggca uagacugagaagggagagggaaugg uagacugagaagggagagggaauggaugcaaguaggauccauuucucccaccucagucggca NW_007370814.1:1836788..1836850:-
EFU_14_10762 1.0e+1 17 11 1 5 yes blast cuaaggggcaaucggggccag agccccaauugccccuuaggaa agccccaauugccccuuaggaacagggggagguggagaagcucuaaggggcaaucggggccag NW_007370664.1:27554476..27554539:-
EFU_12_9275 1.0e+1 16 12 0 4 yes blast ucgcauccgcugauggcacug gcgccaucagugugugggaguggc ucgcauccgcugauggcacuggcuccaaucgcuccacacugucagugggugugagcgaggccagcgccaucagugugugggaguggc NW_007370662.1:11513150..11513237:-
EFU_48_22327 9.9 17 16 0 1 yes blast auaaagggacagaggaggaac gccuccucugucacuuuuauug gccuccucugucacuuuuauugaguuucuguguacucuaauucauuaauaaagggacagaggaggaac NW_007370698.1:10926678..10926746:+
EFU_45_21583 9.8 33 28 0 5 no blast uccuuucccuuccucucccua ggggcgugugggaggcagc ggggcgugugggaggcagcugauugaugauguuucucucauugaaguuucuaucucucuauuccuuucccuuccucucccua NW_007370695.1:10844504..10844586:+
EFU_27_15898 9.5 16 10 0 6 yes blast ggugaugcacccggaaccagaa ccugauuccaggguguguc ggugaugcacccggaaccagaaaggagggagccugauuccaggguguguc NW_007370677.1:4187656..4187706:+
EFU_64_25531 9.4 15 11 0 4 yes blast agccaagcuucccgccugcucu agcgagcaggaggcuuggguuu agcgagcaggaggcuuggguuucccuggcaauggaggaagccaagcuucccgccugcucu NW_007370714.1:3574467..3574527:+
EFU_11_8459 9.3 15 10 0 5 yes blast cggucgccaaccucucgga caccaguuggcgaccgcug cggucgccaaccucucggaccaccaguggcccacgguccaccaguuggcgaccgcug NW_007370661.1:2134475..2134532:-
EFU_69_26510 8.8 14 12 0 2 yes blast uaggagcagugauagguaauau guuaucuauaacugcuccuaga guuaucuauaacugcuccuagaguacauagauucuuccuaggagcagugauagguaauau NW_007370719.1:5094948..5095008:-
EFU_9_7309 8.6 13 12 0 1 yes blast acugggcgccggcagcgggugc ucuggugccggcagcag acugggcgccggcagcgggugcaagaagcggcucuggugccggcagcag NW_007370659.1:19197905..19197954:-
EFU_69_26472 8.5 13 5 0 8 yes blast cucacacccacugauggcacc gcuagcagugggugcaag cucacacccacugauggcaccuagugauuggggcuggcaccaggugcuagcagugggugcaag NW_007370719.1:629491..629554:-
EFU_181_36017 8.2 13 11 0 2 yes blast uaaccaaugugcagacuacugu agguagucugaacacuggg uaaccaaugugcagacuacuguacacauucagagcccccugaacagguagucugaacacuggg NW_007370831.1:1080047..1080110:-
EFU_58_24463 8.2 13 10 0 3 yes blast cugggcuggagugaaggug ugucaucgucggcacca cugggcuggagugaaggugaugguagcugggccagaugccaaugcugucaucgucggcacca NW_007370708.1:1672204..1672266:-
EFU_15_10877 7.7 17 11 0 6 yes blast uaauuuuauguauaagcuagu gagcuuauucauaaaaguacag gagcuuauucauaaaaguacaguauaauccaguaaaccuguaauuuuauguauaagcuagu NW_007370665.1:10281297..10281358:+
EFU_47_22099 7.6 20 15 4 1 no blast uccugcguugagcaucugccccu gggggaggggccacgggauguu gggggaggggccacgggauguuggcugugagagugcaaugaccaccagagggcagcuccugcguugagcaucugccccu NW_007370697.1:10787923..10788002:+
EFU_98_30064 7.5 29 26 0 3 no blast aacuguggacccuggucag aaagaggaaccagagcu aaagaggaaccagagcuuuuguccagcugucaacguugacaaacuguggacccuggucag NW_007370748.1:2076288..2076348:-
EFU_67_26077 7.5 19 18 0 1 no blast uagcggcagcucgauggugacc gucaccuccagcgccgccug gucaccuccagcgccgccugcucggccgagcgcaguagcggcagcucgauggugacc NW_007370717.1:4614108..4614165:+
EFU_61_25074 6.9 9 7 1 1 yes blast ccugaggggcgaucggggccu agccccaauugccccucagg agccccaauugccccucagggcuucuccacccccuccugcuccugaggggcgaucggggccu NW_007370711.1:7678950..7679012:-
EFU_33_18230 6.7 18 11 1 6 no blast gcccugauugccccucaggag ccucaggagcaaucagggccagc gcccugauugccccucaggagcagggggagguggagaagcccucaggagcaaucagggccagc NW_007370683.1:13982328..13982391:-
EFU_72_26841 6.4 9 8 0 1 yes blast cggcccaccggccucgaguuuga aacucucggccggcgggc aacucucggccggcgggccacauaccucauuuacuuaaauaaagcacgcggcccaccggccucgaguuuga NW_007370722.1:6232810..6232881:+
EFU_120_32116 6.3 rRNA/tRNA 17 16 0 1 no blast cucaguugguuagagcgccc gcacugccugccugggc gcacugccugccugggcugcccgaacacgagcuggaugcagaaaaggcagccuugcucuggccggggagcucaguugguuagagcgccc NW_007370770.1:1278139..1278228:-
EFU_302_39289 5.7 16 10 5 1 no blast cgcgcaggaggcggcugau ucgagucccacucgggg ucgagucccacucgggguacaugccuggguugcaggcucgauccccagugugugugcgcgcgcaggaggcggcugau NW_007370952.1:520536..520613:+
EFU_31_17395 5.6 10 7 0 3 yes blast caguugccaaccuuuuggaccuc ggaccacugguuggcgaccgc caguugccaaccuuuuggaccucacggaccacugguuggcgaccgc NW_007370681.1:3420999..3421045:-
EFU_1_4 5.4 7 6 0 1 yes blast aggggauguccgaaugcugguu ccggcaauuggacauccaucu aggggauguccgaaugcugguuuaggcucaaucacggggaucaggccuaaaccggcaauuggacauccaucu NW_007370651.1:465877..465949:+
EFU_151_34360 4.5 9 8 0 1 yes blast uauauauauauauguacguaug uacguagauauauauguauuu uauauauauauauguacguauguguauaugaauguauacguagauauauauguauuu NW_007370801.1:1685537..1685594:+
EFU_18_12520 4.0 10580 10580 0 0 yes blast ccacccugaacgcgcccga gggcgcguucaggguggua gggcgcguucagggugguauggucuacggccacccugaacgcgcccga NW_007370668.1:10580902..10580950:-
EFU_230_37854 3.9 17 16 0 1 no blast gggcggaggaggaggaggag ucccacaugagcccugacc gggcggaggaggaggaggagagagaccucgaugcaagagagacacgucaauugguugucucccacaugagcccugacc NW_007370880.1:650981..651059:+
EFU_431_40509 3.5 43 43 0 0 yes blast acggcgccggccccacucgcacc ugcgaguggggccgucgucagca acggcgccggccccacucgcaccugcagccagcacuagcagcaggugcgaguggggccgucgucagca NW_007371081.1:82897..82965:-
EFU_69_26473 3.5 1483 1467 16 0 yes blast cacuggggugccuggucagccu gcuggccaugccccccaguggg cacuggggugccuggucagccugggugaggggcugauggcuguuugcaggcuggccaugccccccaguggg NW_007370719.1:842389..842460:-
EFU_885_40936 3.5 1056 1046 10 0 yes blast cacuggggugccuggccagccu gcuggccacgcccccagcggg cacuggggugccuggccagccuuggugaggagcugauggcuguuugcaggcuggccacgcccccagcggg NW_007371535.1:7786..7856:+
EFU_49_22555 3.5 123 122 0 1 yes blast cuggccaagccccccagcggga uggggagccauggccag uggggagccauggccagccugggugaggagcugauggcuguucgcaggcuggccaagccccccagcggga NW_007370699.1:9238490..9238560:+
EFU_71_26734 3.5 58 58 0 0 yes blast cgggcugggacgggcuggg gggcugggaccggcuggga gggcugggaccggcugggacgggcugggaccggcugggaccggcugggacgggcugggacgggcuggg NW_007370721.1:1471087..1471155:-
EFU_73_27029 3.4 131 131 0 0 yes blast aaugucugccugccggcuuagg uaagccggaauguggacauucc aaugucugccugccggcuuaggcccgcacccccacagggagugggccuaagccggaauguggacauucc NW_007370723.1:2704971..2705040:-
EFU_16_11502 3.4 277 276 1 0 yes blast ccuaagccggcagucagacauc ugucuaccugcuggcuuaggcc ugucuaccugcuggcuuaggcccgaucccccagggggaucgggccuaagccggcagucagacauc NW_007370666.1:25101417..25101482:+
EFU_46_21976 3.4 11 9 0 2 no blast ccugccccccgccccccccagg ugggggaggggacaggcu ugggggaggggacaggcugucuucuacccgggccuccuagaaagaggccccccugccccccgccccccccagg NW_007370696.1:10006428..10006501:-
EFU_24_14898 3.4 224 220 3 1 yes blast cccacuggggugccuggccagucug cuggccaagcuccccagcgggg cccacuggggugccuggccagucugggugagggcugauggcuguuugcaggcuggccaagcuccccagcgggg NW_007370674.1:10357632..10357705:+
EFU_22_14279 3.4 1472 1470 2 0 yes blast cacuggggugccuggucagccu gcuggccacacaccccagcagg cacuggggugccuggucagccugggagaggggcugauggcugucugcaggcuggccacacaccccagcagg NW_007370672.1:7084778..7084849:-
EFU_301_39276 3.4 2977 2976 1 0 yes blast ugagggaugucugacugcuggcu ccggcagucagauaucccuuuca ugagggaugucugacugcuggcuuaggccugauccccaaggaucaggccuaagccggcagucagauaucccuuuca NW_007370951.1:505699..505775:+
EFU_9_7221 3.4 303 293 0 10 yes blast ccuaagccggcagucagacauc gaugucugacugccggcuuaggcccg gaugucugacugccggcuuaggcccgauccccugggaucgggccuaagccggcagucagacauc NW_007370659.1:7654584..7654648:-
EFU_9_7146 3.4 196 167 0 29 yes blast acucgcacccgcugcuggcg ugccaucagcgggugcgagugg acucgcacccgcugcuggcgccagccccaauugcuccaugccaucagcgggugcgagugg NW_007370659.1:33223555..33223615:+
EFU_14_10532 3.4 54 33 0 21 yes blast ccugaggggugauuggggccagu cccugaucgccccucaggagc cccugaucgccccucaggagcagagggagauggagaagcccugaggggugauuggggccagu NW_007370664.1:3502930..3502992:-
EFU_15_10937 3.3 114 74 0 40 yes blast gagagggauguccgacugcc ggcagucggacaucccucgagu gagagggauguccgacugcccguuuaggcccaaucccagggaucgggccuaaaugggcagucggacaucccucgagu NW_007370665.1:17818600..17818677:+
EFU_145_34001 3.3 58 57 0 1 yes blast ugcugggggacuuggccagccu uggccaggcaccccagcggg ugcugggggacuuggccagccugcaaacagcuaucagccccucacccagguuggccaggcaccccagcggg NW_007370795.1:1591968..1592039:-
EFU_206_37065 3.3 49 47 2 0 yes blast uccugaggggugauuggggcugu ugccccgaucaucccugagggcu ugccccgaucaucccugagggcuucuccaccucccccugcuccugaggggugauuggggcugu NW_007370856.1:214288..214351:+
EFU_9_6951 3.3 84 84 0 0 yes blast uccugaggggcaauuggggcca gccccaauugccccucagggcu gccccaauugccccucagggcuucuccaccucccccagcuccugaggggcaauuggggcca NW_007370659.1:19198004..19198065:+
EFU_121_32181 3.3 210 210 0 0 yes blast gccggccgugaguuugacaug cgucaaacucguggcuggcgg cgucaaacucguggcuggcgggccacaugccuuguuuauuuaaaggaggcauguggcccgccggccgugaguuugacaug NW_007370771.1:1933208..1933288:+
EFU_53_23438 3.3 55 55 0 0 yes blast cuccugaggggugaucggggccag ggucccgauugccccucagggcu ggucccgauugccccucagggcuucuccaacuuccccugcuccugaggggugaucggggccag NW_007370703.1:5669309..5669372:-
EFU_70_26542 3.3 26 26 0 0 yes blast caggggauguccaacugcuggcuu gccaacaguuggacaucccccaag caggggauguccaacugcuggcuuaggcccauucccaggggccuaagccaacaguuggacaucccccaag NW_007370720.1:1324768..1324838:+
EFU_1_1150 3.3 61 61 0 0 yes blast ugcugucagcaggugcgagcgg gcucgcaccagcugcuggcacu gcucgcaccagcugcuggcacuggucccaaucacuccaugcugucagcaggugcgagcgg NW_007370651.1:34188329..34188389:-
EFU_110_31274 3.3 67 67 0 0 yes blast ugaggggagaucggggcuggcag gcugccccaucgccccucagg gcugccccaucgccccucaggagcagggggagguggagaaucgcugaggggagaucggggcuggcag NW_007370760.1:3684165..3684232:-
EFU_86_28754 3.3 94 90 4 0 yes blast ugaggggagaucagggcuggcagc ugccggccccaaucaccccucagg ugccggccccaaucaccccucagggcuucuccaccucccccugcuccugaggggagaucagggcuggcagc NW_007370736.1:4264470..4264541:-
EFU_12_8945 3.3 62 62 0 0 yes blast uccugaggggugaucggggcu ccccgauugccccucagggcu ccccgauugccccucagggcuucuccaucucccccugcuccugaggggugaucggggcu NW_007370662.1:11957371..11957430:+
EFU_19_13172 3.3 70 55 0 15 yes blast agcugccggcccugaucacccc aucagggccggcagccaccucu agcugccggcccugaucaccccucagggcuucuccaccuccccuugcuccugagggugaucagggccggcagccaccucu NW_007370669.1:20909139..20909219:-
EFU_48_22442 3.3 214 213 1 0 yes blast ucugaggggcgaucggggcca gccccaaucacuccucaggagc gccccaaucacuccucaggagcagggggagguggagaagcucugaggggcgaucggggcca NW_007370698.1:9860617..9860678:-
EFU_10_7722 3.3 113 112 1 0 yes blast ugccccaaucgccccucaggag ccugaggggugauuguggccggc ugccccaaucgccccucaggaguagggggagguggagaagcccugaggggugauuguggccggc NW_007370660.1:25358416..25358480:+
EFU_1_401 3.3 114 85 1 28 yes blast ugaggggagaucagggcuggcagc agccccgaucgccccucaggaa agccccgaucgccccucaggaacagggggagauggagaagacaugaggggagaucagggcuggcagc NW_007370651.1:32757271..32757338:+
EFU_3_2865 3.2 112 112 0 0 yes blast ccucgaggcuuggcuucuccac ggagaagccaagcuucacugaggcu ggagaagccaagcuucacugaggcuggagcagaggagccuagccucgaggcuuggcuucuccac NW_007370653.1:45421172..45421236:+
EFU_4_3446 3.2 200 199 1 0 yes blast cggccccaauugccccucaggacu uucugagggggcaucgggaccggc cggccccaauugccccucaggacuucuccaccucccccugcuucugagggggcaucgggaccggc NW_007370654.1:18093586..18093651:+
EFU_65_25799 3.2 138 137 1 0 yes blast ugcucugaucgccccucaggag ccucaggggcgauuggggccggc ugcucugaucgccccucaggagcagggggagguggagaagcccucaggggcgauuggggccggc NW_007370715.1:6126668..6126732:-
EFU_23_14592 3.2 992 981 11 0 yes blast cacuggggugccuggccagccu gcuggccaaaugccccaguggg cacuggggugccuggccagccuaggugaggggaugauggcuguuugcaggcuggccaaaugccccaguggg NW_007370673.1:17682488..17682559:+
EFU_103_30531 3.2 38 35 0 3 yes blast cccugaggggugauuggggcu gaucaccccucaggagc gaucaccccucaggagcagggggagguggaaaagcccugaggggugauuggggcu NW_007370753.1:942146..942201:+
EFU_27_16154 3.2 38 38 0 0 yes blast ccugaggggugauuggggccagu ugguccugauugccccucagggc ugguccugauugccccucagggcuucaccauuucccccugcuccugaggggugauuggggccagu NW_007370677.1:10709270..10709335:-
EFU_32_17698 3.2 47 47 0 0 yes blast uguuggacugcuggguuucag aaaacccggcaguccgacauc uguuggacugcuggguuucagcccgaucccugcaggccaggcccuacagggaucaggccaaaacccggcaguccgacauc NW_007370682.1:11434308..11434388:+
EFU_50_22902 3.2 47 46 1 0 yes blast caccagcagugggugugagugg gcucacacccacugauggugcc gcucacacccacugauggugccaagugaucaggacuggcgcugggcaccagcagugggugugagugg NW_007370700.1:10869973..10870040:-
EFU_61_25041 3.2 399 398 1 0 yes blast uggccccaauugccccucaggag cuugaggggcgaucagggccagc uggccccaauugccccucaggagcagggggagguggagaagccuugaggggcgaucagggccagc NW_007370711.1:3737021..3737086:-
EFU_10_7554 3.2 639 639 0 0 yes blast uguccaccugccggcuuuggcc cuuagccugcagguggacauc uguccaccugccggcuuuggccugcucccccagcuuagccugcagguggacauc NW_007370660.1:12034693..12034747:+
EFU_115_31690 3.2 174 174 0 0 yes blast agcgagcccggcuucuggcug gccagaagcugggcucacagc agcgagcccggcuucuggcugaguggcacucccacaggaggagagccacucagccagaagcugggcucacagc NW_007370765.1:1847890..1847963:+
EFU_1_283 3.2 66 62 2 2 yes blast uccugaggggugaucggggcu gcccugaucaccccucaggac gcccugaucaccccucaggacuucuccaccucccccugcuccugaggggugaucggggcu NW_007370651.1:22867772..22867832:+
EFU_15_10816 3.2 63 62 0 1 yes blast gucggacugccgguuucagccc gaaaccggcaguccaacau gucggacugccgguuucagcccaaucccggugagaucccucaggcuggucuuuggggauugggugaaaccggcaguccaacau NW_007370665.1:4159811..4159894:+
EFU_1_61 3.2 20 15 5 0 yes blast agggacaaucagggccggcagc ugcuggccccgauaaccccuaa ugcuggccccgauaaccccuaagggcuucuccaccucccccugcuccugagggacaaucagggccggcagc NW_007370651.1:4782485..4782556:+
EFU_1_464 3.2 294 280 0 14 yes blast aggcuggcagucggacaucccc ucugacugccagcuuaggcccg aggcuggcagucggacauccccauaggggucgcaugucugacugccagcuuaggcccg NW_007370651.1:38293753..38293811:+
EFU_19_13096 3.2 427 427 0 0 yes blast uaagccagcagucggacaucc auguccgacugcuaguuuagg auguccgacugcuaguuuaggcccgauccuaaaggcccugugggaucgggccuaagccagcagucggacaucc NW_007370669.1:14856152..14856225:-
EFU_21_13818 3.2 28 28 0 0 yes blast ccugaagggugauuggggcc ccccgaucacccuucagggc ccccgaucacccuucagggcuuuuccaccucccccugcuccugaagggugauuggggcc NW_007370671.1:7926764..7926823:-
EFU_195_36611 3.2 128 123 5 0 yes blast cacuggggugucuggccagccu gcuggccauaccccccagcggg cacuggggugucuggccagccugggugagggguugauggcuguuugcaggcuggccauaccccccagcggg NW_007370845.1:593487..593558:-
EFU_39_19678 3.2 235 234 1 0 yes blast ugcccugaucgccccucaggau ccucaggggccaucagggcuggc ugcccugaucgccccucaggaucagggggagguggagaagcccucaggggccaucagggcuggc NW_007370689.1:392555..392619:+
EFU_2_2001 3.2 222 222 0 0 yes blast uugagggaugucugccugcugg agcagccagacaugccucuugc uugagggaugucugccugcuggcuuaggcccguuccccuugaggauugggccuaagccagcagccagacaugccucuugc NW_007370652.1:6098371..6098451:-
EFU_60_24875 3.2 342 341 0 1 yes blast uguucgccugccagcuuaggc agccggcagguggacaucc uguucgccugccagcuuaggcccgcuccccaagccggcagguggacaucc NW_007370710.1:6947668..6947718:-
EFU_24_15033 3.2 17 16 1 0 yes blast uccccgauugccccucaggag ccccaggggugauuggggcca uccccgauugccccucaggaggagggggagguggagaagcccccaggggugauuggggcca NW_007370674.1:6041114..6041175:-
EFU_30_17086 3.2 90 90 0 0 yes blast ugaggggagaucagggcuggcagc ugcugcccuuaucgccccucagg ugcugcccuuaucgccccucaggagcagggguagguggagaagcccugaggggagaucagggcuggcagc NW_007370680.1:6334534..6334604:-
EFU_37_19178 3.2 167 165 2 0 yes blast ugcacccgcugcuggcgccgg ggugcugucagcgcgugggag ugcacccgcugcuggcgccggccccaauugcuccacuccgucagcgggugcaaguggggccggugcugucagcgcgugggag NW_007370687.1:2603374..2603456:+
EFU_199_36799 3.2 35 35 0 0 yes blast cacuggggugccuggccau ggccaugccccccaguggg cacuggggugccuggccauccugggugagguguugauggcuguuugcaggcuggccaugccccccaguggg NW_007370849.1:1156901..1156972:-
EFU_44_21264 3.2 358 356 0 2 yes blast gaccgacagggccucggcugu ggccgaggcccgggccgguucccc gaccgacagggccucggcugugugaggacgagaggcggccgaggcccgggccgguucccc NW_007370694.1:8959103..8959163:+
EFU_245_38207 3.2 888 888 0 0 yes blast uaagccagcagucggacaucc auauccuacugccggcuuagg auauccuacugccggcuuaggcccgcucccuggggagcgggccuaagccagcagucggacaucc NW_007370895.1:1046808..1046872:+
EFU_263_38613 3.2 1308 1308 0 0 yes blast aacucgcggccggcgggcugc agcccgccggccgcgaguuug aacucgcggccggcgggcugcaugccucauaguaaauggccgcaugccuuguaguaaaugaggcacgcagcccgccggccgcgaguuug NW_007370913.1:17407..17496:-
EFU_36_19049 3.2 152 151 0 1 yes blast ugauggcuuaggcccgcucccu gggccuaagccggcaguuggac ugauggcuuaggcccgcucccuaagggcgcgggccuaagccggcaguuggac NW_007370686.1:3469938..3469990:-
EFU_227_37776 3.2 72 42 30 0 yes blast cacuggggugccuggccaa ggucaagccccccaguggg cacuggggugccuggccaaccugggugaggggcugauggcuguuugcaggcuggucaagccccccaguggg NW_007370877.1:627753..627824:+
EFU_14_10474 3.1 84 84 0 0 yes blast cccugaucgccccuuaggag ccugaggggcgaucaggcgcu cccugaucgccccuuaggagcaaggggagguggagaagcccugaggggcgaucaggcgcu NW_007370664.1:28548729..28548789:+
EFU_111_31319 3.1 52 52 0 0 yes