miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mbr/mbr_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mbr.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mbr/mbr_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mbr/mbr_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mbr.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mbr/mbr_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
105.77
95.67
85.57
75.57
65.47
55.37
45.27
35.57
26.27
12.17
01.17
-117
-21.17
-31.17
-41.17
-51.17
-61.17
-71.17
-81.27
-91.27
-101.27





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
MBR_168359_37854 6.0e+6 11909275 11902602 0 6673 yes blast uauugcacuugucccggccugu agguugggaucaguugcaaugcu agguugggaucaguugcaaugcuguguuucucuaugguauugcacuugucccggccugu NW_005370787.1:5320595..5320654:-
MBR_168229_36737 5.6e+6 11127535 10813327 0 314208 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaaaaaaccaccgaccguugacuguacc NW_005370657.1:3607127..3607187:-
MBR_169208_41695 5.5e+6 10814096 10813984 0 112 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaauuaaagucaaaaccaucgaccguugauuguacc NW_005371636.1:555356..555418:-
MBR_162642_24988 5.3e+6 10470632 10470551 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguguuauauauaaaguauugcacuugucccggccugu NW_005365070.1:2065019..2065080:-
MBR_151998_6427 1.1e+6 2191054 2190873 1 180 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc NW_005354426.1:37838..37911:-
MBR_169502_43023 1.1e+6 2189209 2188871 117 221 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuggggcucggcccugcugugggauaacuauacaaucuacugucuuucc NW_005371930.1:693418..693488:-
MBR_166028_29480 6.3e+5 1240090 1210633 28 29429 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuccccacuagauugugagcuccugga NW_005368456.1:266759..266821:-
MBR_165561_28912 6.2e+5 1231630 1205390 53 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaggccacagacgggcuuucagucggauguuugcagc NW_005367989.1:1542269..1542332:+
MBR_166633_30300 6.1e+5 1206531 769718 0 436813 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu NW_005369061.1:446804..446863:-
MBR_155969_15749 5.6e+5 1113482 1107244 0 6238 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugaggacguccaggaucacaggugagguucuugggagc NW_005358397.1:56537..56596:-
MBR_167398_31198 4.6e+5 915912 915814 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuauacccugggaguuaacuguacaaccuucuagcuuucc NW_005369826.1:460991..461058:+
MBR_163647_26233 4.4e+5 872001 862512 100 9389 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgcuuuguucacaguggcuaaguucug NW_005366075.1:556966..557028:+
MBR_151611_4861 3.9e+5 774365 773574 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu NW_005354039.1:1070440..1070500:+
MBR_155308_14739 3.2e+5 631598 629411 0 2187 yes blast caacggaaucccaaaagcagcug cugcgcuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc NW_005357736.1:450674..450738:-
MBR_157658_18115 3.0e+5 601971 600186 138 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaagaaauuuuguggucacaaauucguaucuaggggaau NW_005360086.1:41620..41682:-
MBR_167754_33569 2.6e+5 528968 528962 0 6 yes blast uucaaguaauccaggauaggcu ccuauucuugauuacuuguuuc uucaaguaauccaggauaggcuguuuccaccugugaggccuauucuugauuacuuguuuc NW_005370182.1:767892..767952:-
MBR_168467_38195 2.6e+5 528898 528768 4 126 yes blast uucaaguaauccaggauaggcu ccuauucucgguuacuugcacg uucaaguaauccaggauaggcugugcaggucccgaugggccuauucucgguuacuugcacg NW_005370895.1:377423..377484:-
MBR_151410_3846 2.1e+5 413793 413593 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacauagucacagauucgauucuaggggaaua NW_005353838.1:8483734..8483796:+
MBR_151032_2011 2.1e+5 413781 413280 5 496 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagguucuucauugcacccggcucggggcagcucaguacaggau NW_005353460.1:4566405..4566468:-
MBR_151032_1946 2.0e+5 402273 402009 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagccgggugcaaugaagaaccucggggcagcucaguacaggau NW_005353460.1:4566406..4566469:+
MBR_125141_855 1.8e+5 361790 361595 6 189 yes blast ccucgacacaaggguuugu ugcuucugggucgggguu ugcuucugggucgggguuucauacauagcagagcagcucccuugcugcaaucagcccucgacacaaggguuugu NW_005327569.1:90..164:+
MBR_151803_5420 1.6e+5 332242 328518 0 3724 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcuac uguaaacauccccgacuggaagcuguaagacagaacuaagcuuucagucagauguuugcuac NW_005354231.1:485680..485742:+
MBR_151746_5237 1.5e+5 306447 286172 0 20275 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaucucauggcaacagcagucgaugggcugu NW_005354174.1:2464927..2464986:-
MBR_155969_15753 1.1e+5 227726 216275 0 11451 no blast cacccguagaaccgaccuugcg caagcucgugucuguggguccg cacccguagaaccgaccuugcggggccuucgccgcacacaagcucgugucuguggguccg NW_005358397.1:57139..57199:-
MBR_152661_8415 1.0e+5 210541 210522 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc NW_005355089.1:39614..39686:-
MBR_151998_6425 1.0e+5 208878 208821 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguaguuauuuuacccuguucaggagauaacuauacaaucuauugccuuccc NW_005354426.1:37454..37532:-
MBR_154477_12958 8.6e+4 169483 169389 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaacauuaaacaccaauauuauugugcugcuuu NW_005356905.1:2422111..2422175:+
MBR_154009_11584 8.6e+4 169308 169299 1 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaauuaucuccaguauuaacugugcugcugaa NW_005356437.1:693674..693738:+
MBR_167527_31894 8.4e+4 165929 102603 0 63326 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucucauccccuacuagacugaagcuccuugagga NW_005369955.1:559799..559857:+
MBR_160999_22842 6.6e+4 129619 129553 0 66 yes blast agcuacaucuggcuacugggucuc ggcucaguagucaguguagauc ggcucaguagucaguguagauccugucuuuuauaaucaguagcuacaucuggcuacugggucuc NW_005363427.1:954728..954792:-
MBR_169449_42907 6.5e+4 128140 128115 0 25 yes blast gugcaucuccgugcggccccu gggcggcacggggaggccacgg gggcggcacggggaggccacggcgaguuugcaacaccgugcaucuccgugcggccccu NW_005371877.1:767646..767704:+
MBR_165198_28452 6.3e+4 124165 124098 18 49 yes blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucuuacugaagguuuccuggaaaccacgcacaugcuguugccacuaaccucaaccu NW_005367626.1:888607..888686:+
MBR_157925_18536 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga NW_005360353.1:255285..255345:-
MBR_154647_13399 5.8e+4 115327 115323 0 4 yes blast aaaagcuggguugagagggcga gccuucucuucccgguucuucccg gccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggcga NW_005357075.1:1386866..1386920:+
MBR_157050_17361 5.8e+4 114856 114779 0 77 yes blast uauugcacucgucccggccucc agggacgggacgcggugcagugu agggacgggacgcggugcaguguuguucuuucccccgccaauauugcacucgucccggccucc NW_005359478.1:2039404..2039467:+
MBR_153831_11120 5.0e+4 99792 99693 0 99 yes blast uagguaguuuccuguuguuggg ucgacagcacgacacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgacacugccuuc NW_005356259.1:9535309..9535366:+
MBR_158647_19553 4.5e+4 89899 89828 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuugaacucggcaacaagaaacugccuga NW_005361075.1:614122..614180:-
MBR_162642_25004 4.5e+4 89646 88752 0 894 yes blast caaaacgugaggcgcugcuau cagcagcaauucauguuuugaa cagcagcaauucauguuuugaagugcuuuacauaguucaaaacgugaggcgcugcuau NW_005365070.1:2377271..2377329:-
MBR_167398_31200 4.3e+4 84570 45288 0 39282 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuucaguaacaucacaagucaggcucuugggaccu NW_005369826.1:506197..506258:+
MBR_155822_15628 4.3e+4 84477 78791 87 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaggagcuuucagucggauguuuacagc NW_005358250.1:232932..232996:+
MBR_153575_10389 3.9e+4 76636 76583 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc NW_005356003.1:506856..506935:-
MBR_161344_23228 3.7e+4 73632 73534 0 98 no blast ucgacacaaggguuugu aucuauugaaagucagcc aucuauugaaagucagccuucgacacaaggguuugu NW_005363772.1:1211002..1211038:+
MBR_157658_18121 3.5e+4 70341 70247 0 94 no blast uagguaguuucauguuguuggg caacgacauuaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacauuaaaccacccga NW_005360086.1:113047..113106:-
MBR_168230_36762 2.9e+4 58116 58100 0 16 yes blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugaggacggaggccagacccaccgagggaugaaugucac NW_005370658.1:1021034..1021098:+
MBR_154477_12956 2.7e+4 53190 52227 1 962 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauacuauagucaagaugcgaaucauuauuugcugcucu NW_005356905.1:2421969..2422028:+
MBR_151225_2983 2.5e+4 50682 45498 0 5184 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggag NW_005353653.1:1354389..1354449:-
MBR_157925_18537 2.4e+4 48904 48224 0 680 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuucccga caaagugcuguucgugcagguagugugauuaccugaccuacugcugagcuagcacuucccga NW_005360353.1:255487..255549:-
MBR_151998_6424 2.4e+4 48755 31435 15 17305 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuagggcagggauuuugcccacaaggagguaacuauacgaccugcugccuuucu NW_005354426.1:34903..34979:-
MBR_160999_22840 2.4e+4 47153 45507 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguuaagcaacagcuacauugucugcuggguuu NW_005363427.1:954068..954130:-
MBR_162801_25187 2.3e+4 45414 40942 4470 2 no blast uugggugcgagaggucccgggu cgaggcuucuucccggagcggag uugggugcgagaggucccggguucaaaucccggacgagcccacuuuuuuccccucccgacccgaggcuucuucccggagcggag NW_005365229.1:5257137..5257221:-
MBR_158647_19548 2.1e+4 42451 39139 18 3294 yes blast uccgagccugggucucccucu ggggguccccggugcucggau ggggguccccggugcucggaucuugagggugcuuauuguucgguccgagccugggucucccucu NW_005361075.1:571399..571463:-
MBR_159841_21123 2.0e+4 39261 39099 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc NW_005362269.1:1015908..1015968:+
MBR_158249_19065 1.8e+4 36655 36649 1 5 no blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaaugggauccggugguucuagacuugccaacu NW_005360677.1:1100571..1100635:-
MBR_163647_26231 1.8e+4 36248 36122 0 126 no blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauuaaaaucacauugccagggauuaccacg NW_005366075.1:556744..556805:+
MBR_168662_39176 1.7e+4 35068 33637 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa NW_005371090.1:197951..198008:-
MBR_165159_28403 1.4e+4 29375 29020 0 355 yes blast gagagaucagaggcgcagagu ccugugccuuuuaccucuuuaa gagagaucagaggcgcagagugcgucaaugucaaugaagccugugccuuuuaccucuuuaa NW_005367587.1:5668158..5668219:-
MBR_168183_36516 1.4e+4 29088 28951 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac NW_005370611.1:2698219..2698281:-
MBR_154262_12402 1.4e+4 29084 22291 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu NW_005356690.1:246812..246868:-
MBR_169040_41314 1.2e+4 24403 24333 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca NW_005371468.1:343847..343908:-
MBR_157925_18540 1.1e+4 22473 19049 1438 1986 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccucucgugcuaccgcacuguggguacuugcu NW_005360353.1:255705..255764:-
MBR_162642_25002 1.0e+4 21331 18189 5 3137 yes blast gaguauuguuucugcugcccgg uagcagcgggaacaguacug uagcagcgggaacaguacugcaguggguuauccguauucuggaguauuguuucugcugcccgg NW_005365070.1:2376958..2377021:-
MBR_168230_36760 1.0e+4 20989 18901 0 2088 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc NW_005370658.1:1020861..1020922:+
MBR_166859_30598 1.0e+4 20275 20266 0 9 yes blast ucacagugaaccggucucuuu gggggccgaugcacuguacgaga gggggccgaugcacuguacgagagugaguagcaggucucacagugaaccggucucuuu NW_005369287.1:1391104..1391162:-
MBR_154883_14103 9.7e+3 19048 19043 0 5 yes blast uuagggcccuggcuccaucuccu aguggggcuuugacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuuugacccuaacc NW_005357311.1:6183556..6183621:-
MBR_169502_43011 7.4e+3 14570 14563 0 7 yes blast acgcccuucccccccuucuuca aggagggaggagaggggccacg aggagggaggagaggggccacguucccucugccuggaacgcccuucccccccuucuuca NW_005371930.1:1394746..1394805:+
MBR_169449_42903 7.2e+3 14278 12427 4 1847 yes blast cacuccucuccucccgucuucu aggacgggaggagaggagggugc aggacgggaggagaggagggugcgguguuugcggguccucacuccucuccucccgucuucu NW_005371877.1:663111..663172:+
MBR_151268_3152 7.2e+3 14257 14226 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauagaauuuucuagcaccaucugaaaucgguua NW_005353696.1:261941..262001:-
MBR_168467_38186 6.2e+3 12345 12249 0 96 yes blast agcugguguugugaaucaggccg gcuacuucacaacaccagggu agcugguguugugaaucaggccguugccaaucagagaacggcuacuucacaacaccagggu NW_005370895.1:1285439..1285500:+
MBR_163376_26073 6.2e+3 12205 12196 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagcgcauccucuuacccggcuauuucacgacaccaggguu NW_005365804.1:1769614..1769683:-
MBR_151539_4394 6.0e+3 11784 11717 2 65 yes blast ugcacugaccuccagggagcag ugcccccugguggucagugcu ugcacugaccuccagggagcagauggucaacacaggagcugcccccugguggucagugcu NW_005353967.1:11458908..11458968:+
MBR_153156_9407 5.9e+3 11591 11585 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu NW_005355584.1:9761506..9761566:+
MBR_169341_42382 5.9e+3 11591 11585 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucaacuguucaauggauuugguccccuucaaccagcugu NW_005371769.1:1253384..1253444:-
MBR_167869_34283 5.5e+3 10964 10960 0 4 yes blast uggcagucagacauccucugag gagagggauguccaacugcuggu gagagggauguccaacugcugguuaucgggccuaaacuggcagucagacauccucugag NW_005370297.1:993614..993673:+
MBR_152957_8945 5.3e+3 10481 10479 0 2 yes blast ucgccaaccuuucggaccucacg cggaccacuggcuggugacc ucgccaaccuuucggaccucacggaccaccagugguccggaccacuggcuggugacc NW_005355385.1:1292965..1293022:-
MBR_168230_36798 4.9e+3 9764 9507 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccugucacaaaucacauugccagggauuucca NW_005370658.1:992926..992984:-
MBR_168359_37863 4.9e+3 9715 8483 0 1232 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua NW_005370787.1:5321296..5321354:-
MBR_151997_6338 4.9e+3 9688 9669 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucuuaaacaucuagcaaaucauuuuuuacucucca NW_005354425.1:167301..167362:+
MBR_167536_31978 4.8e+3 9572 7342 1 2229 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcacauagaauugucucacacagaaaucgcacccguc NW_005369964.1:2689756..2689821:-
MBR_154533_13289 4.7e+3 9299 9298 0 1 yes blast augcaccugggcaaggauucuga uaauccuugcuacuugggugagagugcuu uaauccuugcuacuugggugagagugcuuucugaaugcaaugcaccugggcaaggauucuga NW_005356961.1:518689..518751:+
MBR_165159_28299 4.3e+3 8494 8486 3 5 yes blast uggcagucagacauccucugag gagagggauguccgucugcca gagagggauguccgucugccaguuuaggcccaggaucgggccuaaacuggcagucagacauccucugag NW_005367587.1:1431037..1431106:+
MBR_153371_10008 4.3e+3 8489 8486 0 3 yes blast uggcagucagacauccucugag agagggauguccgaccaccag agagggauguccgaccaccaguuuaggccuguuccuuaaacuggcagucagacauccucugag NW_005355799.1:468784..468847:-
MBR_169310_42240 4.3e+3 8482 8481 0 1 no blast uggcagucagacauccucugag aagagggugcaggccgggcug uggcagucagacauccucugagggcucccggacuggaagagggugcaggccgggcug NW_005371738.1:18349..18406:+
MBR_154533_13279 4.2e+3 8303 7350 0 953 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguugucaucuuaauuacccucccacacccaaggcuugca NW_005356961.1:508886..508945:+
MBR_167957_34902 4.1e+3 8119 7175 0 944 yes blast uccgguucucagggcuccacc aggaagcccuggaggggcuggagg aggaagcccuggaggggcuggaggugauggauguguuccuccgguucucagggcuccacc NW_005370385.1:1398295..1398355:-
MBR_163647_26235 3.9e+3 7814 7797 0 17 no blast uggcucaguucagcaggaacagg ggugccuacugagcugauaucagu ggugccuacugagcugauaucaguucucauuuacacacuggcucaguucagcaggaacagg NW_005366075.1:557480..557541:+
MBR_151410_4021 3.8e+3 7567 7378 133 56 no blast ucuggcuccgugucuucacuccc gagggagggacgggggcugugc ucuggcuccgugucuucacucccguguguguccgaggagggagggagggacgggggcugugc NW_005353838.1:15031821..15031883:-
MBR_165266_28518 3.8e+3 7553 6715 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau NW_005367694.1:2887079..2887139:+
MBR_152661_8413 3.7e+3 7425 7415 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugugggguagggauuuaaggccccaauagaagauaacuauacaacuuacuacuuuccc NW_005355089.1:38780..38861:-
MBR_168130_36099 3.6e+3 7251 6308 5 938 yes blast gggacucuugugugaccuccgg gagaucacacacgagucccccu gagaucacacacgagucccccucucuccacccuggggggacucuugugugaccuccgg NW_005370558.1:1446513..1446571:+
MBR_151803_5422 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaauacauggauuggcugggagguggauguuuacuuc NW_005354231.1:491189..491249:+
MBR_155023_14372 3.4e+3 6761 4484 0 2277 yes blast ucccccaggugugauucugauuug uuaucagaaucuccagggguac uuaucagaaucuccagggguacuuauaauuugaaaaagucccccaggugugauucugauuug NW_005357451.1:1025872..1025934:-
MBR_121279_804 3.3e+3 6566 3955 0 2611 yes blast uaaugccccuaaaaauccuuau agggacuuucaggggcagcugug agggacuuucaggggcagcuguguuuucugacucaagucauaaugccccuaaaaauccuuau NW_005323707.1:650..712:-
MBR_167474_31471 3.3e+3 6566 3955 0 2611 yes blast uaaugccccuaaaaauccuuau agggacuuucaggggcagcugug agggacuuucaggggcagcuguguuuucugacucaagucauaaugccccuaaaaauccuuau NW_005369902.1:792937..792999:+
MBR_153831_11133 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucugaguaugauagcagucagugcacuacagaacuuugu NW_005356259.1:10405056..10405116:+
MBR_167398_31196 2.9e+3 5874 5061 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu NW_005369826.1:460269..460329:+
MBR_167615_32589 2.8e+3 5594 5491 0 103 yes blast ugagaacugaauuccauaggcugu ugcccuagggacucaguucug ugagaacugaauuccauaggcugugagcucuagcaaaugcccuagggacucaguucug NW_005370043.1:3374135..3374193:-
MBR_158249_19069 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa NW_005360677.1:1106688..1106750:-
MBR_168110_35872 2.6e+3 5163 5003 0 160 yes blast gucaacacuugcugguuuccucu gggagccaggaaguauugauguu gggagccaggaaguauugauguuucugccaguuuagcgucaacacuugcugguuuccucu NW_005370538.1:1585492..1585552:-
MBR_154442_12744 2.5e+3 5084 5076 0 8 yes blast ucccuccuuucccuuccucu gaggaagggagacggcggg ucccuccuuucccuuccucucccgacccgcucacccgggaggaagggagacggcggg NW_005356870.1:4888712..4888769:+
MBR_168397_37950 2.5e+3 5044 4976 0 68 yes blast caagugcacgcgcuuugggac uucacaaagcccauacacuucac caagugcacgcgcuuugggacagugaagcaaagaauguucacaaagcccauacacuucac NW_005370825.1:856948..857008:-
MBR_160633_22288 2.4e+3 4721 4720 0 1 yes blast ugagugugugugugugagugu cugagcagggccaggcuc cugagcagggccaggcuccaggcugagggugugugugugugcgcgcgcguguguaugugaguguguaugagugugugugugugagugu NW_005363061.1:1593520..1593608:-
MBR_168359_37862 2.3e+3 4710 4487 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug NW_005370787.1:5321152..5321215:-
MBR_169558_43169 2.2e+3 4371 4370 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc NW_005371986.1:117345..117404:-
MBR_150921_1626 1.9e+3 3882 3879 0 3 yes blast ugcccugaucgccccuuaggag ccugaggggugaucggggcca ugcccugaucgccccuuaggagcaaggggaguuggagaagcccugaggggugaucggggcca NW_005353349.1:1146018..1146080:+
MBR_166279_29730 1.9e+3 3881 3874 0 7 yes blast ugcccugaucgccccuuaggag ucugaggggcgauccgggccugu ugcccugaucgccccuuaggagcaggggaagguggagaaguucugaggggcgauccgggccugu NW_005368707.1:6137325..6137389:+
MBR_164445_27445 1.9e+3 3857 3854 1 2 yes blast ugcccugaucgccccuuaggag cccucaggggugaucagggcug ugcccugaucgccccuuaggagcggggggagguggagaagcccucaggggugaucagggcug NW_005366873.1:3513446..3513508:-
MBR_154516_13167 1.9e+3 3851 3570 0 281 yes blast cuccuggggcccgcacucuugc uggggagcggcccccgggcggg uggggagcggcccccgggcgggccucugcucuggccccuccuggggcccgcacucuugc NW_005356944.1:5831970..5832029:+
MBR_167474_31470 1.9e+3 3787 3266 0 521 yes blast ugggucuuugcgggcgagauga aacuggccuacaaagucccagu ugggucuuugcgggcgagaugagggugucgguucaacuggccuacaaagucccagu NW_005369902.1:778644..778700:+
MBR_169113_41510 1.7e+3 3363 3358 0 5 yes blast uggcagucagacauccucugaaa gugagagggauguccaacugccagu gugagagggauguccaacugccaguuuaggccugguccacugcaggauugggccuguacuggcagucagacauccucugaaa NW_005371541.1:1803409..1803491:-
MBR_167717_33238 1.6e+3 3289 2956 26 307 no blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauugguguaaagcuggagacccacugccccaggugcugcug NW_005370145.1:217743..217799:-
MBR_151844_5527 1.6e+3 3250 3249 0 1 yes blast uuuccggaggaugaggcccaga aggccucauccuccgaaaauu aggccucauccuccgaaaauucuguuucuuuguuacuaauguuauggccccaccccauaacaaagagacagaauuuccggaggaugaggcccaga NW_005354272.1:92957..93052:+
MBR_162642_24986 1.6e+3 3242 3211 0 31 yes blast aauugcacgguauccaucugu cggguggaucacgaugcaauuuu cggguggaucacgaugcaauuuugauuaguacaauaggugaaaaauugcacgguauccaucugu NW_005365070.1:2064862..2064926:-
MBR_159762_21096 1.6e+3 3175 3076 0 99 yes blast ccucaggggcgaucagggccga ugccccaaucgccccucaggag ugccccaaucgccccucaggagcagagggaaguggagaagcccucaggggcgaucagggccga NW_005362190.1:492660..492723:-
MBR_128661_951 1.6e+3 3175 3076 0 99 yes blast ccucaggggcgaucagggccga ugccccaaucgccccucaggag ugccccaaucgccccucaggagcagagggaaguggagaagcccucaggggcgaucagggccga NW_005331089.1:82..145:+
MBR_153193_9549 1.5e+3 3118 3102 0 16 no blast uagaaacguccagaggcaccgga cgggucccugugacguucccaga cgggucccugugacguucccagaagauucaugcugacaccuagaaacguccagaggcaccgga NW_005355621.1:43729..43792:+
MBR_154516_13187 1.5e+3 3029 3023 5 1 yes blast ugaccuaugaauugacagccagu ggcugccaauugcauaggu ugaccuaugaauugacagccagugcucuugucuccccucuggcugccaauugcauaggu NW_005356944.1:954126..954185:-
MBR_160457_22202 1.4e+3 2794 2416 1 377 yes blast uaacacugucugguaacgauguu caucuuaccggacagugcugga caucuuaccggacagugcuggacuucucggcucgacucuaacacugucugguaacgauguu NW_005362885.1:996853..996914:-
MBR_169418_42764 1.3e+3 2744 2730 0 14 no blast ugccgggguuguggcuc uucgauuccuggucagggcac uucgauuccuggucagggcacaugccgggguuguggcuc NW_005371846.1:128904..128943:-
MBR_153614_10644 1.3e+3 2714 2594 0 120 yes blast ccucaggggcgaucagggccga gccccgaucgccccucaggag gccccgaucgccccucaggagcagggggaaguggagaagcccucaggggcgaucagggccga NW_005356042.1:8285825..8285887:-
MBR_167487_31611 1.3e+3 2634 2617 0 17 yes blast agccgugaucgccccucaggag ccugaggggcgaucggggccgg agccgugaucgccccucaggagcaggaagaaguggagaagcccugaggggcgaucggggccgg NW_005369915.1:1870705..1870768:-
MBR_167487_31612 1.3e+3 2619 2617 0 2 no blast agccgugaucgccccucaggag cuggcagugggugcaagc cuggcagugggugcaagcggggcuggcagcgggcgcgagagguggcugccagccgugaucgccccucaggag NW_005369915.1:1870746..1870818:-
MBR_151583_4737 1.2e+3 2507 2473 0 34 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuaua uugggcuuacuccucacagguggcagaauacuauggccuuccugugacauuacgcccuaua NW_005354011.1:98272..98333:-
MBR_151276_3230 1.2e+3 2506 2473 0 33 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuaua uugggcuuacuccucacagguggcagaauacuauggccuuccugugacauuacgcccuaua NW_005353704.1:60689..60750:+
MBR_155664_15477 1.2e+3 2506 2473 0 33 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuaua uugggcuuacuccucacagguggcagaauacuauggccuuccugugacauuacgcccuaua NW_005358092.1:2951320..2951381:-
MBR_151997_6332 1.2e+3 2491 2473 0 18 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuaua uugggcuuacuccucacagguggcaggauaccaugaccuuccugugacauuacgcccuaua NW_005354425.1:45445..45506:+
MBR_152245_7255 1.2e+3 2353 2315 0 38 yes blast ugagggaugucugacugcuggc cagcagucggacauucccuga ugagggaugucugacugcuggcuugagaaggccuaagccagcagucggacauucccuga NW_005354673.1:2774068..2774127:-
MBR_163013_25683 1.1e+3 2290 2257 0 33 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggca acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggca NW_005365441.1:1484987..1485044:-
MBR_151863_5608 1.1e+3 2290 2257 0 33 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggca acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggca NW_005354291.1:16453..16510:+
MBR_163171_25829 1.1e+3 2290 2257 0 33 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggca acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggca NW_005365599.1:1192830..1192887:-
MBR_168359_37857 1.1e+3 2155 2146 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu NW_005370787.1:5320847..5320906:-
MBR_154207_12144 1.0e+3 2120 2115 0 5 yes blast agcuggcagguagacauccccc gggaugucugacugucagcuuaggcc gggaugucugacugucagcuuaggccugaucaccuggggaacgggccuaagcuggcagguagacauccccc NW_005356635.1:7231813..7231884:-
MBR_152091_6640 1.0e+3 2120 2113 0 7 yes blast uacgucaucguugucaucauca guggugacgccgauggugcgagc guggugacgccgauggugcgagcuggaaauggggugcuacgucaucguugucaucauca NW_005354519.1:460406..460465:-
MBR_160198_21707 1.0e+3 2116 2111 0 5 yes blast agcuggcagguagacauccccc agggaugucugacugcca agggaugucugacugccaucuuaggcugaucucccaggaagcaggccuaagcuggcagguagacauccccc NW_005362626.1:483886..483957:+
MBR_167957_34904 1.0e+3 2017 1720 0 297 no blast ggcuccccagcgcugccucucu aggggccacacucgggugacc aggggccacacucgggugaccuuggguauuuaguacgaaggcuccccagcgcugccucucu NW_005370385.1:1507598..1507659:-
MBR_167843_34018 9.6e+2 1895 1818 0 77 yes blast cuuggcaccuaguaagcacuca agugccugcuaugugccagg cuuggcaccuaguaagcacucaguaaauacuuguugagugccugcuaugugccagg NW_005370271.1:2935501..2935557:+
MBR_168654_39038 9.3e+2 1823 1798 4 21 yes blast auugcacugaucaccaaggggc cccccugguggucagug auugcacugaucaccaaggggcagcuucugcauugagcgucugcccccugguggucagug NW_005371082.1:761672..761732:+
MBR_168045_35537 9.2e+2 1819 1797 4 18 yes blast auugcacugaucaccaaggggc cccccugguggucagug auugcacugaucaccaaggggcagcuccugcauugagcaucugcccccugguggucagug NW_005370473.1:84748..84808:-
MBR_167124_30981 9.0e+2 1765 1719 0 46 yes blast ucaggggaugucugacugccaga cagcagucagacaucccucuca ucaggggaugucugacugccagauuaagcccaaucucagcagucagacaucccucuca NW_005369552.1:4353493..4353551:-
MBR_169449_42910 8.7e+2 1719 1713 0 6 no blast ugucaccucacgccugaccugucuu aacaucucuggcuggcgcc ugucaccucacgccugaccugucuuuucucuuguagaacaucucuggcuggcgcc NW_005371877.1:768643..768698:+
MBR_162427_24553 8.6e+2 1687 1675 0 12 yes blast uugagggaugucugacugcugg uggcagucagacaucccucuc uugagggaugucugacugcugguuuaggcccgauccugauugggccgccuaaacuggcagucagacaucccucuc NW_005364855.1:764112..764187:-
MBR_168255_36956 8.6e+2 1685 1684 0 1 yes blast ugcacugaccuccagggag ucccugguggucagugcac ugcacugaccuccagggagaagcuccugcauugagcaucugcucccugguggucagugcac NW_005370683.1:27268..27329:+
MBR_154883_14071 8.6e+2 1685 1684 0 1 yes blast ugcacugaccuccagggag ucccugguggucagugcac ugcacugaccuccagggagaagcuccugcauugagcaucugcucccugguggucagugcac NW_005357311.1:423741..423802:-
MBR_151516_4231 8.5e+2 1675 1338 0 337 yes blast cacuggggugccuggccagccu gcuggccaagccccccagcagga cacuggggugccuggccagccugggugaggggcugaaugucugucugcaugcuggccaagccccccagcagga NW_005353944.1:157422..157495:+
MBR_165446_28710 8.5e+2 1675 1338 0 337 yes blast cacuggggugccuggccagccu gcuggccaagccccccagcagga cacuggggugccuggccagccugggugagggucugauggcuguuugcaggcuggccaagccccccagcagga NW_005367874.1:917267..917339:-
MBR_162427_24554 8.5e+2 1680 1675 0 5 no blast uugagggaugucugacugcugg agccugcacccucucca agccugcacccucuccaaucugggaccccuugagggaugucugacugcugg NW_005364855.1:764165..764216:-
MBR_151957_6150 8.3e+2 1625 1615 0 10 yes blast aggccagcagucggacaucccc gauguccgacugccaguuuaggc gauguccgacugccaguuuaggcccaguccccgcaggccaggccagcagucggacaucccc NW_005354385.1:1612475..1612536:-
MBR_161344_23298 8.2e+2 1618 1452 0 166 yes blast agcuggcagguagacaucccc gaugucugacugccagcuuagg gaugucugacugccagcuuaggccccaucccccgggaagcggaccuaagcuggcagguagacaucccc NW_005363772.1:4766572..4766640:-
MBR_156515_16666 8.2e+2 1633 1631 0 2 no blast aagguuauagaaauuucagacaguc acauuuugaaaugguuugaggccuug acauuuugaaaugguuugaggccuugcccugcugcauccagagcaagguuauagaaauuucagacaguc NW_005358943.1:2263001..2263070:-
MBR_152377_7569 8.1e+2 1585 1523 0 62 yes blast uugagggaugucugacugcugg uggcagucggacaucccucucu uugagggaugucugacugcuggauuaggccccugugggauggggccuaaacuggcagucggacaucccucucu NW_005354805.1:209..282:-
MBR_161510_23541 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu NW_005363938.1:1145555..1145614:+
MBR_162454_24585 7.4e+2 1458 1338 2 118 yes blast cacuggggugccuggccagccu cuggccaagccccccagcggga cacuggggugccuggccagccugggugaggagcugauggcuguuugcaggcuggccaagccccccagcggga NW_005364882.1:2746728..2746800:+
MBR_163850_26713 7.4e+2 1454 1320 16 118 yes blast cacuggggugccuggccagccu cuggccaagccccccagcggga cacuggggugccuggccagccuuggugaggggcugauggcuguuuucaggcuggccaagccccccagcggga NW_005366278.1:68208..68280:+
MBR_156473_16546 7.1e+2 1398 1393 2 3 yes blast ccuaaggggcaaucggggcca ggccccgauugccccucaggag ggccccgauugccccucaggagcagggggugguggagaagcccuaaggggcaaucggggcca NW_005358901.1:71306..71368:-
MBR_167124_30924 7.0e+2 1383 1295 0 88 yes blast ucgccaaccuuucggaccucac ggaccaucgguuggcgacu ucgccaaccuuucggaccucacagaccaccagugguuuguggaccaucgguuggcgacu NW_005369552.1:103725..103784:-
MBR_155263_14674 6.9e+2 1362 1320 16 26 yes blast cacuggggugccuggccagccu cuggccaagccccccagugggaacu cacuggggugccuggccagccugggugaggggcugauggcuguuugcaggcuggccaagccccccagugggaacu NW_005357691.1:803447..803522:-
MBR_155783_15561 6.9e+2 1361 1338 0 23 yes blast cacuggggugccuggccagccu gcuggccaaaccccccagcggga cacuggggugccuggccagccugggugagaggcugauggcuguuugcaggcuggccaaaccccccagcggga NW_005358211.1:12645..12717:+
MBR_167725_33305 6.9e+2 1358 1333 0 25 yes blast ugccggccgugaguuugacaug augucaaacucgcagcugg augucaaacucgcagcuggcgggccacaugccucauugccggccgugaguuugacaug NW_005370153.1:511910..511968:+
MBR_153745_10879 6.9e+2 1366 1364 1 1 no blast ucgugcacugggccucuaaa caagggcucccagacugcaagagggcac caagggcucccagacugcaagagggcacaggcugggcugggugacacccccuccccccaacugcauaaauuucgugcacugggccucuaaa NW_005356173.1:2243000..2243091:+
MBR_154246_12245 6.8e+2 1335 1314 17 4 yes blast cccccgguggucagugugcuu agcgcacugagcaccagggggc agcgcacugagcaccagggggcagcuccugcauugagcgucugccccccgguggucagugugcuu NW_005356674.1:4438801..4438866:+
MBR_153193_9578 6.5e+2 1290 1273 2 15 yes blast uggccccaauugccccucaggac ccugaggggcaaucagggcugga uggccccaauugccccucaggacuucuccaccucccccugcuccugaggggcaaucagggcugga NW_005355621.1:3021468..3021533:+
MBR_164405_27236 6.1e+2 1206 1204 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucuggaagguacaguacugugauaacugaa NW_005366833.1:44869..44926:-
MBR_157452_17966 6.0e+2 1192 1191 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa NW_005359880.1:739211..739268:-
MBR_165685_28980 6.0e+2 1185 1179 0 6 no blast uguuggacugccaguuucagcu caggagcagcaggcaggag caggagcagcaggcaggaguggcaggcaguguuggacugccaguuucagcu NW_005368113.1:433286..433337:-
MBR_156221_16154 5.6e+2 1108 1100 0 8 yes blast guuggacugccaguuucagccu cugaaaccagcagucugacauc guuggacugccaguuucagccugaugcccgccggggaucaggcugaaaccagcagucugacauc NW_005358649.1:4100716..4100780:+
MBR_160999_22823 5.6e+2 1102 1012 0 90 yes blast uugaucagcauugccucucucu agagaggcagggucugauc agagaggcagggucugaucugcagccucaguggcagcuguugaucagcauugccucucucu NW_005363427.1:1121001..1121062:+
MBR_165266_28513 5.5e+2 1090 926 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu NW_005367694.1:2860792..2860848:+
MBR_168359_37856 5.5e+2 1083 1074 0 9 yes blast ugugcaaauccaugcaaaacuga aguuuugcagguuugcauccagc aguuuugcagguuugcauccagcugugugauauucugcugugcaaauccaugcaaaacuga NW_005370787.1:5320710..5320771:-
MBR_167795_33874 5.4e+2 1073 1072 0 1 yes blast uaagccagcagucggacaucc gauguccaacugcuggcuuaggccugc gauguccaacugcuggcuuaggccugcuccccgggagagcaggccuaagccagcagucggacaucc NW_005370223.1:4889541..4889607:-
MBR_167900_34452 4.9e+2 973 972 0 1 yes blast uguaacagcaacuccaugugga ccaguggagaugcuguuacuu uguaacagcaacuccauguggacuguguaccaauuuccaguggagaugcuguuacuu NW_005370328.1:340454..340511:+
MBR_163743_26560 4.5e+2 907 904 0 3 no blast caccagauugugagcuccuga aguggcucaguucuguu aguggcucaguucuguuuccagguccaucugcuccaccagauugugagcuccuga NW_005366171.1:3217486..3217541:-
MBR_160670_22368 4.5e+2 880 854 0 26 yes blast ucugcccccugguugucaaugc cacacugaccaccaggggg cacacugaccaccagggggaagcuccugcauugagcaucugcccccugguugucaaugc NW_005363098.1:2236137..2236196:-
MBR_154804_13912 4.4e+2 877 764 0 113 yes blast cgccguacaacucaacgccagga cuggcguugaguuguaugaguu cgccguacaacucaacgccaggauggucuuccuggcguugaguuguaugaguu NW_005357232.1:4774..4827:-
MBR_157050_17461 4.4e+2 883 852 0 31 no blast gacaccugaugcugggcugauguug cuagcggugggguaucugaagcuggcucg gacaccugaugcugggcugauguugugacguucguugcgccaacuagcggugggguaucugaagcuggcucg NW_005359478.1:2352090..2352162:-
MBR_167983_35041 4.3e+2 858 854 0 4 yes blast ucugcccccugguugucaaugc cacugaccaucagggggcagu cacugaccaucagggggcaguuccugcauugagcaucugcccccugguugucaaugc NW_005370411.1:1795090..1795147:+
MBR_154516_13189 4.1e+2 819 767 0 52 yes blast uguaacagcaacuccaugugga ccaguggggcugcuguuaucugg uguaacagcaacuccauguggaagugcccacucguuccaguggggcugcuguuaucugg NW_005356944.1:954326..954385:-
MBR_154171_11897 4.1e+2 805 475 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg NW_005356599.1:86716..86780:-
MBR_160819_22688 4.0e+2 794 542 0 252 yes blast ucuggccaagccccccagcagaa ugcuggggugccuggccagccu ugcuggggugccuggccagccugggggagggguugauggcuguuuacagucuggccaagccccccagcagaa NW_005363247.1:10188565..10188637:-
MBR_152410_7726 3.8e+2 747 743 0 4 yes blast agagaggcagggucugaucca ugaucagccauugccucucucu agagaggcagggucugauccacagacucugucacagcuguugaucagccauugccucucucu NW_005354838.1:4701..4763:+
MBR_156882_17109 3.7e+2 735 705 0 30 yes blast cucacacucacugcuggcacug ugccaucagcgggugcgagugg cucacacucacugcuggcacuggccccaaucacuccaugccaucagcgggugcgagugg NW_005359310.1:24786..24845:-
MBR_164406_27360 3.7e+2 725 688 2 35 yes blast ugccucugguggucagugcacu aaugcacugaccaccagggggg aaugcacugaccaccaggggggcagacgcucaaugcaggagcugccucugguggucagugcacu NW_005366834.1:2978370..2978434:-
MBR_154468_12914 3.6e+2 703 702 0 1 yes blast augucugacuaccagcuuaggc cuaagcugacaggcggacauc augucugacuaccagcuuaggcccaauccccgcagggagugggccuaagcugacaggcggacauc NW_005356896.1:104379..104444:+
MBR_162683_25032 3.5e+2 698 697 0 1 yes blast cuuggcgccgucagugggugug cacccgcugccggugcccag cacccgcugccggugcccagugcuggcccugauugcuuggcgccgucagugggugug NW_005365111.1:518167..518224:-
MBR_169026_41270 3.5e+2 691 668 0 23 yes blast agagaggcagggucugaucca ugaucagcuguugccucucucu agagaggcagggucugauccacagucuccauggcagcuguugaucagcuguugccucucucu NW_005371454.1:224062..224124:+
MBR_169026_41279 3.5e+2 691 668 0 23 yes blast agagaggcagggucugaucca ugaucagcuguugccucucucu agagaggcagggucugauccacagucucuauggcagcuguugaucagcuguugccucucucu NW_005371454.1:228129..228191:-
MBR_167588_32313 3.5e+2 691 668 0 23 yes blast agagaggcagggucugaucca ugaucagcuguugccucucucu agagaggcagggucugauccacagucucuguggcagcuguugaucagcuguugccucucucu NW_005370016.1:2427423..2427485:-
MBR_168305_37372 3.5e+2 699 403 0 296 no blast ccccgguccgucggagcacuuc aagggcuguuuugguaccggaga ccccgguccgucggagcacuucaguuaaugggaauagaagggcuguuuugguaccggaga NW_005370733.1:1159014..1159074:-
MBR_151357_3565 3.5e+2 684 371 0 313 yes blast uggcaguuggacauccccugagu gagagggauguccgacugcca gagagggauguccgacugccaggauccggccuuaacuggcaguuggacauccccugagu NW_005353785.1:44309..44368:+
MBR_156636_16805 3.4e+2 683 369 0 314 yes blast uggcaguuggacauccccugagu gagagggaugucugacugccagu gagagggaugucugacugccaguuuaggccugaucuggcaguuggacauccccugagu NW_005359064.1:1533389..1533447:+
MBR_152316_7424 3.4e+2 676 588 0 88 yes blast gagagggauguccgacugccaga cagcagucggacaucccucgagg gagagggauguccgacugccagaucaggccuaaaccagcagucggacaucccucgagg NW_005354744.1:776791..776849:+
MBR_155664_15433 3.3e+2 653 651 1 1 yes blast ccugagagacgauuggggcugg uggcccugauugccccucaggag uggcccugauugccccucaggagcagggggagguggagaagcccugagagacgauuggggcugg NW_005358092.1:4375895..4375959:+
MBR_167588_32227 3.3e+2 652 650 0 2 yes blast cuaagcuggcagguggacaucc gaugucugacugcuguc gaugucugacugcugucuuaggcccgggccuaagcuggcagguggacaucc NW_005370016.1:1632172..1632223:+
MBR_168349_37665 3.2e+2 631 457 0 174 yes blast gggccagcagucggacaucccc gaugucugacugccagcuuagg gaugucugacugccagcuuaggccggcucccccugggccagcagucggacaucccc NW_005370777.1:4226772..4226828:+
MBR_156221_16155 3.2e+2 626 625 0 1 yes blast cuaggcuggcagguggacaucc uguccaacugcagcuuagg uguccaacugcagcuuaggcccaaucuccuggggagcgggccuaggcuggcagguggacaucc NW_005358649.1:4133465..4133528:+
MBR_159145_20218 3.1e+2 627 517 0 110 no blast uccacacccggcuggcugcgg gacagacagcaggugugugggcu gacagacagcaggugugugggcugcaaguauauuugguccacacccggcuggcugcgg NW_005361573.1:3567244..3567302:-
MBR_152271_7282 3.1e+2 616 571 0 45 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagaag augcugacauauuuacuagaagggugaaauuaauagccuucuaguaagaguggcaguugaag NW_005354699.1:47025..47087:-
MBR_160011_21525 3.1e+2 612 531 0 81 yes blast auguucgccugccagcuuagg uaagcuggcaggcagacauccc auguucgccugccagcuuagggccgcagggaacugggccuaagcuggcaggcagacauccc NW_005362439.1:3892877..3892938:-
MBR_167890_34358 3.1e+2 604 551 0 53 yes blast ugggggauguccaccuguuggc cagcagucagacaucccucuca ugggggauguccaccuguuggcuuaggcccgauuccccaggccuaagccagcagucagacaucccucuca NW_005370318.1:824221..824291:+
MBR_152820_8795 3.0e+2 593 592 0 1 yes blast cuaagcuggcagguggacaucc augucuggcugccagcuuaggc augucuggcugccagcuuaggcuugauccccuggggagugggccuaagcuggcagguggacaucc NW_005355248.1:856441..856506:-
MBR_167869_34314 3.0e+2 590 337 0 253 yes blast gcuggccaagccccccagcagga ugcuggggugccuggccagccu ugcuggggugccuggccagccugggugaguggcugauggcaguuuucaggcuggccaagccccccagcagga NW_005370297.1:1593210..1593282:-
MBR_169484_42967 2.9e+2 572 482 0 90 yes blast uaagccagcagucggacaucc augucugacugcuggcuuagg augucugacugcuggcuuaggcccacuccccacagugagcaggccuaagccagcagucggacaucc NW_005371912.1:47557..47623:+
MBR_151597_4801 2.9e+2 571 569 0 2 yes blast ucgccaaccuuucggaccuca ggaccacugguuggcgacugcu ggaccacugguuggcgacugcugcuccaaagguuuccuuaaaccaguggucgccaaccuuucggaccuca NW_005354025.1:782729..782799:-
MBR_160011_21519 2.8e+2 571 570 0 1 no blast ccucacccggcccggac aggggccagggcaggac ccucacccggcccggacacagggagggaagcucccaggggccagggcaggac NW_005362439.1:3579646..3579698:-
MBR_167603_32434 2.8e+2 560 555 0 5 yes blast gagagggaugucugacugccaga cagcagucagacaucccccgag gagagggaugucugacugccagaugucugacuguagggaucaggccuaaaccagcagucagacaucccccgag NW_005370031.1:2201991..2202064:+
MBR_167969_34935 2.8e+2 553 534 0 19 yes blast uguggccucuggguguguacccu aguguacuuccuggggcuucu aguguacuuccuggggcuucugggcauauaauuccuguggccucuggguguguacccu NW_005370397.1:521426..521484:+
MBR_154533_13292 2.8e+2 549 538 0 11 yes blast uacccauugcauaucggaguug accuccugugugcauggauuaca uacccauugcauaucggaguugugaauucucaaagcaccuccugugugcauggauuaca NW_005356961.1:520775..520834:+
MBR_160248_21822 2.7e+2 545 544 0 1 yes blast uucccuuugucauccuuugccuc gcagggacggcaaaggggugc uucccuuugucauccuuugccucgggcucggagcggggcagggacggcaaaggggugc NW_005362676.1:444196..444254:+
MBR_168182_36383 2.7e+2 540 524 0 16 yes blast aagcuggcagucggacauccu auguccgacugauggcuuaggc auguccgacugauggcuuaggccuguucuccacagggaucgggccuaagcuggcagucggacauccu NW_005370610.1:1596461..1596528:+
MBR_168782_39850 2.6e+2 517 506 6 5 yes blast agaaacagaauuuccggaggau cuccagaaauucugucucu cuccagaaauucugucucuuuguuaugggguggggccacaacaugaguaacaaagaaacagaauuuccggaggau NW_005371210.1:485307..485382:-
MBR_151516_4233 2.5e+2 502 337 0 165 yes blast gcuggccaagccccccagcagga cgcuggggugccuggccagccu cgcuggggugccuggccagccugggugaggggcugaaugucugucugcaugcuggccaagccccccagcagga NW_005353944.1:157672..157745:+
MBR_168159_36201 2.5e+2 511 321 0 190 no blast augcacacugaccaccagggac ugugugugugugugugugugu uguguguguguguguguguguauaugacuaagcaaucguuacgaugaaaugaccggucacuaugaugcacacugaccaccagggac NW_005370587.1:39892..39978:+
MBR_164926_27889 2.5e+2 492 449 0 43 yes blast uugcagcugccugggagugacuuc cagucacucugggcaccgcag cagucacucugggcaccgcagcacugugcuggggauguugcagcugccugggagugacuuc NW_005367354.1:2506811..2506872:+
MBR_164406_27326 2.4e+2 486 483 0 3 yes blast uugagggaugucugacugcu gcagucggacaucccucuc uugagggaugucugacugcuaucgggcagucggacaucccucuc NW_005366834.1:7104844..7104888:+
MBR_169113_41505 2.4e+2 483 463 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca NW_005371541.1:1370877..1370939:-
MBR_168259_37017 2.4e+2 470 426 0 44 yes blast acagaucagacccugccucucu agaggcaaguucugaucaacagc agaggcaaguucugaucaacagcugccacagagacuacagaucagacccugccucucu NW_005370687.1:47842..47900:+
MBR_168207_36600 2.4e+2 477 303 170 4 no blast gagagggauguccgacugcca agcagucagacaucccccaaggg gagagggauguccgacugccauggggaucgggccuaaaccagcagucagacaucccccaaggg NW_005370635.1:782132..782195:+
MBR_153700_10817 2.4e+2 468 424 0 44 yes blast acagaucagacccugccucucu agaggcaaguucugaucaacagc agaggcaaguucugaucaacagcugccacagaggccacagaucagacccugccucucu NW_005356128.1:1387200..1387258:+
MBR_162283_24361 2.3e+2 466 448 0 18 yes blast gagagggauguccgacugcca gcaguuggacauccccugu gagagggauguccgacugccaguuuagguccgaucccugggaucgggccuaaacugcaguuggacauccccugu NW_005364711.1:79642..79716:+
MBR_153832_11247 2.3e+2 466 460 0 6 yes blast uacggccaagcacccgcagggc cggcggguuuguuggcuuugcgu cggcggguuuguuggcuuugcguuuucaaccuuugcguacggccaagcacccgcagggc NW_005356260.1:666888..666947:+
MBR_158081_18764 2.3e+2 464 454 4 6 yes blast uggcaguaggacauccccugagg gagagggauguccgacug gagagggauguccgacugucgguuuaggcccaaucugcagggaucacugugggauagggccuaaacuggcaguaggacauccccugagg NW_005360509.1:2501382..2501471:-
MBR_168982_40989 2.3e+2 460 214 0 246 yes blast ucccccuggugaucagugcgcu cacacugaccaccagggggc cacacugaccaccagggggcagaugcucaaugcaggagcuucccccuggugaucagugcgcu NW_005371410.1:9504502..9504564:+
MBR_169249_41871 2.3e+2 453 447 3 3 yes blast agaaacagaauuuccggaggau uccucuggaaauucuguuucuuu uccucuggaaauucuguuucuuuguuacuaauguugugaccccaccccauaacaaagaaacagaauuuccggaggau NW_005371677.1:242760..242837:-
MBR_155023_14348 2.2e+2 446 278 1 167 yes blast cgcacuaaccaccagagggcag cccccugguggucagugugcu cgcacuaaccaccagagggcaggcgcucagcgcagaagcugcccccugguggucagugugcu NW_005357451.1:466753..466815:+
MBR_151268_3153 2.2e+2 442 381 4 57 yes blast gcugguuucauauggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu NW_005353696.1:262269..262333:-
MBR_166279_29768 2.2e+2 436 341 0 95 yes blast ccugaagggugauuggggccg gccccgaucgccccucaggag gccccgaucgccccucaggagcagggggagguagagaagcccugaagggugauuggggccg NW_005368707.1:747598..747659:-
MBR_169013_41204 2.2e+2 475 472 0 3 no blast agaaacagaauuuccggaggau auucccaggugauucuaaugugca agaaacagaauuuccggaggaugagucccagaaaucaagauuuuaaaaagauucccaggugauucuaaugugca NW_005371441.1:1283587..1283661:+
MBR_160670_22372 2.2e+2 429 309 0 120 yes blast ugguuccaggugcgucaccaga aggugacgcacccaggaaucggg aggugacgcacccaggaaucgggcucccuccuuucugguuccaggugcgucaccaga NW_005363098.1:2468485..2468542:-
MBR_156429_16479 2.1e+2 423 262 0 161 yes blast gccgacaggcgggcaggaccagg uggccugcccgccagucggg uggccugcccgccagucgggcucugcugucuguuguuugggccgacaggcgggcaggaccagg NW_005358857.1:88174..88237:+
MBR_169160_41629 2.1e+2 423 318 0 105 yes blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua NW_005371588.1:39679..39737:-
MBR_167514_31804 2.1e+2 412 404 0 8 yes blast cuaagcuggcagguggacauc uguccaccugccggcuu uguccaccugccggcuugcagggagugggccuaagcuggcagguggacauc NW_005369942.1:1526846..1526897:-
MBR_169281_42168 2.0e+2 407 312 0 95 yes blast gagagggaugucugacugccagu cugcagucugacaucccccgag gagagggaugucugacugccaguuuaggccugaucccacagggaucgggcuaaaccugcagucugacaucccccgag NW_005371709.1:1423942..1424019:-
MBR_154533_13282 2.0e+2 407 382 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca NW_005356961.1:509273..509333:+
MBR_151078_2222 2.0e+2 402 394 0 8 yes blast uggccccaauugccccucaggag ccugaggggugauuggggccag uggccccaauugccccucaggagcagggggagguagcccugaggggugauuggggccag NW_005353506.1:235591..235650:+
MBR_156797_17012 2.0e+2 401 372 0 29 yes blast ucuacagugcacgugucuccagu ggagacgcggcccuguuggagu ucuacagugcacgugucuccaguguggcucggaggcuggagacgcggcccuguuggagu NW_005359225.1:4407184..4407243:+
MBR_162852_25215 2.0e+2 401 313 0 88 yes blast gagagggaugucugacugccagu cggcagucggacauccccugaga gagagggaugucugacugccaguuuaggcccaaucccggcagucggacauccccugaga NW_005365280.1:896733..896792:+
MBR_153972_11547 2.0e+2 388 379 0 9 yes blast cgcuggggggcuuggccagucu cuggccaggcaccccagcgggg cgcuggggggcuuggccagucugcaaacagccagcagccccucaccuaggcuggccaggcaccccagcgggg NW_005356400.1:27220..27292:-
MBR_154442_12828 1.9e+2 388 387 0 1 yes blast cugcccggccccucccacugug gcagugggcacaggggc gcagugggcacaggggcaacuuuuggcccacccucugugccccugcccggccccucccacugug NW_005356870.1:2850651..2850715:-
MBR_169249_41866 1.9e+2 386 379 1 6 yes blast cgcuggggggcuuggccagucu cuggucaggcaccccagcagga cgcuggggggcuuggccagucugccaacugccaucagccacucgcccagacuggucaggcaccccagcagga NW_005371677.1:1243121..1243193:+
MBR_153831_11094 1.9e+2 384 321 2 61 yes blast agaaacagaauuuccggaggau uccuccggaaauucuguuucuu uccuccggaaauucuguuucuucguuaugggguggggccacaacacccauaacgaagaaacagaauuuccggaggau NW_005356259.1:6184849..6184926:+
MBR_157050_17357 1.9e+2 382 252 8 122 yes blast ugcuggggugccuggccagccu cuggccaagccccccagcgga ugcuggggugccuggccagccugggugaggggcugauggcugucugcaggcuggccaagccccccagcgga NW_005359478.1:1591395..1591466:+
MBR_168349_37692 1.9e+2 374 252 0 122 yes blast ugcuggggugccuggccagccu cuggccaagccccccagcgga ugcuggggugccuggccagccuggguggggggcugauggcuguuuucaggcuggccaagccccccagcgga NW_005370777.1:3164181..3164252:-
MBR_169341_42339 1.9e+2 375 365 0 10 yes blast aucucagguucgucagcccgug aggacugaccaaccugagaaug aggacugaccaaccugagaauggugucuccaggucaaucucagguucgucagcccgug NW_005371769.1:336905..336963:+
MBR_151593_4767 1.9e+2 373 210 0 163 yes blast cacuggggggcuugaccagccu cuggccaggccccccagcggga cacuggggggcuugaccagccugcaaacagccaucaguccgucacccaggcuggccaggccccccagcggga NW_005354021.1:1050887..1050959:+
MBR_167900_34454 1.9e+2 371 312 0 59 yes blast augaccuaugaauugacagaca ucugucauuucuguaggccaau augaccuaugaauugacagacaguguggcuaagugugucugucauuucuguaggccaau NW_005370328.1:340713..340772:+
MBR_169013_41234 1.8e+2 367 145 0 222 yes blast gaugucugacugccagcuuagg cugagcuggcagguggacauc gaugucugacugccagcuuaggcccgauccccuggggagugggccugagcuggcagguggacauc NW_005371441.1:60900..60965:-
MBR_165913_29223 1.8e+2 367 145 0 222 yes blast gaugucugacugccagcuuagg cugagcuggcagguggacauc gaugucugacugccagcuuaggcccgauccccuggggagugggccugagcuggcagguggacauc NW_005368341.1:1443364..1443429:+
MBR_153156_9518 1.8e+2 362 311 0 51 yes blast gaggcccgauguaugaaauuc auuucaugcaccaggccacuag auuucaugcaccaggccacuagucuuuuauauaauaacuagaggcccgauguaugaaauuc NW_005355584.1:9793838..9793899:-
MBR_169578_43223 1.8e+2 356 252 0 104 yes blast ugcuggggugccuggccagccu cuggccaagccccccagcggu ugcuggggugccuggccagccuggguaggggcugauggcuguuuucaggcuggccaagccccccagcggu NW_005372006.1:879437..879507:+
MBR_152037_6502 1.8e+2 355 350 0 5 yes blast agggaugucugacugcuggcu gcuggcacguggacauccc agggaugucugacugcuggcuuagaacugcuccccaugggaagcaggccuaugcuggcacguggacauccc NW_005354465.1:223697..223768:+
MBR_160670_22366 1.7e+2 347 280 26 41 yes blast cacuggggugcuuggucagccu cuggccaagucccccagcgggg cacuggggugcuuggucagccugggugaggggcugagggccguuuucaggcuggccaagucccccagcgggg NW_005363098.1:2159113..2159185:-
MBR_162525_24705 1.7e+2 348 337 0 11 yes blast gcuggccaagccccccagcagga ugcuguggugccuggccaauc ugcuguggugccuggccaaucugggugaguggcugauugcaguuugcaggcuggccaagccccccagcagga NW_005364953.1:490956..491028:+
MBR_167640_32646 1.7e+2 348 337 0 11 yes blast gcuggccaagccccccagcagga ugcuguggugccuggccaauc ugcuguggugccuggccaaucugggugaguggcugauugcaguuugcaggcuggccaagccccccagcagga NW_005370068.1:235109..235181:-
MBR_154477_13042 1.7e+2 348 337 0 11 yes blast gcuggccaagccccccagcagga ugcuguggugccuggccaauc ugcuguggugccuggccaaucugggugaguggcugauugcaguuugcaggcuggccaagccccccagcagga NW_005356905.1:5151715..5151787:-
MBR_163336_26001 1.7e+2 343 339 3 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugagucauaaugaaggaagcaaucagcaaguauacugcccu NW_005365764.1:107988..108053:-
MBR_161040_22930 1.7e+2 341 245 0 96 yes blast gagagggauguccgacugcca gcagucggacaucccccgaggu gagagggauguccgacugccaauuuaggcccaaucccacaggccuaacccggcagucggacaucccccgaggu NW_005363468.1:2546366..2546439:-
MBR_168896_40490 1.7e+2 340 321 0 19 yes blast cauaggucagggcaugugcagga cugcacaugcccugaccagga cugcacaugcccugaccaggaaucgaaccaugaccucauaggucagggcaugugcagga NW_005371324.1:577569..577628:-
MBR_156797_16968 1.7e+2 339 313 15 11 yes blast cacuggggugccuggccagccg gcuggccaagccccccagu cacuggggugccuggccagccgggugaggggcugauggcuguuuucaggcuggccaagccccccagu NW_005359225.1:167133..167200:+
MBR_156473_16573 1.7e+2 334 318 0 16 yes blast aaugcaguggaccugggccagau uuggccugggcacacgcauca aaugcaguggaccugggccagaugagcagcuucuacauuggccugggcacacgcauca NW_005358901.1:1998192..1998250:-
MBR_155131_14531 1.7e+2 331 320 0 11 yes blast uacccacugcuggcaccuggug cucggugccgucagcgggu uacccacugcuggcaccuggugccagucuugaucgcucggugccgucagcgggu NW_005357559.1:1691168..1691222:-
MBR_167677_32822 1.7e+2 331 321 0 10 yes blast cuaauaugcuaauggucggga cagaccauuagcauauuagcu cuaauaugcuaauggucgggacaccauaauggguaacgaccagaccauuagcauauuagcu NW_005370105.1:2723264..2723325:+
MBR_129012_960 1.6e+2 325 321 1 3 yes blast augcacacugaccaccagggac ccccaugguggucagugcgcuc augcacacugaccaccagggacagaugcucagcacaggagcugccccaugguggucagugcgcuc NW_005331440.1:44..109:+
MBR_154171_11901 1.6e+2 334 318 0 16 no blast aaugcaguggaccugggccagau uuggccugggcacacgcauca aaugcaguggaccugggccagaugagcagcuucuacauuggccugggcacacgcauca NW_005356599.1:303206..303264:-
MBR_156473_16575 1.6e+2 334 318 0 16 no blast aaugcaguggaccugggccagau uuggccugggcacacgcauca aaugcaguggaccugggccagaugagcagcuucuacauuggccugggcacacgcauca NW_005358901.1:2000599..2000657:-
MBR_161603_23749 1.6e+2 323 304 0 19 yes blast gagagggaugucugacugccagu ggcagucggacaucccccgugg gagagggaugucugacugccaguuuagcccugaucccuggggauugugccuuaagcggcagucggacaucccccgugg NW_005364031.1:3264700..3264778:-
MBR_167398_31212 1.6e+2 318 317 0 1 yes blast gagagggaugucugacugccagu ggcagucagacauuccccaaggggucc gagagggaugucugacugccaguauaggcccgaucccacagugauugggccuauacuggcagucagacauuccccaaggggucc NW_005369826.1:2299431..2299515:+
MBR_169610_43327 1.6e+2 315 296 0 19 yes blast acuggccaggcaccccagcagg cacuggggggcuuggccagccu cacuggggggcuuggccagccuacaaacagccaccagcuucucacucagacuggccaggcaccccagcagg NW_005372038.1:131041..131112:+
MBR_169212_41713 1.6e+2 317 238 0 79 yes blast caggcuaggggagaugaccggau uucacuuaccucccagccuaca caggcuaggggagaugaccggauagaaaacguuguucuauucacuuaccucccagccuaca NW_005371640.1:246230..246291:+
MBR_159224_20345 1.5e+2 298 292 0 6 yes blast ucgggggaugucugacugccagu uggcagucagacauccu ucgggggaugucugacugccaguauaggccugauccugccuaaacuggcagucagacauccu NW_005361652.1:1692745..1692807:-
MBR_166210_29629 1.5e+2 295 104 12 179 yes blast cuggccaagccccccagcggu ugcuggggugccuggccaguc ugcuggggugccuggccagucugggugaguggcugauggcuguuugcaggcuggccaagccccccagcggu NW_005368638.1:2755248..2755319:+
MBR_157696_18224 1.5e+2 292 287 0 5 yes blast gagagggaugucugacugccagu cagcagucagacaucccccgag gagagggaugucugacugccagugggauagggccuaaaccagcagucagacaucccccgag NW_005360124.1:7268118..7268179:+
MBR_167514_31737 1.4e+2 288 258 18 12 yes blast ugucaggccugggcaggggac ccccccgcccaggccugaugc ugucaggccugggcaggggacccucauuuccccccaucacugguucugccccccgcccaggccugaugc NW_005369942.1:3408360..3408429:+
MBR_166279_29667 1.4e+2 293 274 0 19 no blast ugcugcucgcacccgcugacgg aucaguggguccgaguggcugc ugcugcucgcacccgcugacggugcacggacccaucaguggguccgaguggcugc NW_005368707.1:317437..317492:+
MBR_160781_22491 1.4e+2 277 245 5 27 yes blast ugcuggggugccuggccagccu gcuggccaagccccccagcagg ugcuggggugccuggccagccuuguugaggggcugauggcuguuuucaggcuggccaagccccccagcagg NW_005363209.1:1670974..1671045:-
MBR_155615_15360 1.4e+2 276 158 5 113 yes blast aggggauguccgacugccgguu cggcagucggacaucccucu aggggauguccgacugccgguuuaagcccgaucccugggaucggucuuaaaccggcagucggacaucccucu NW_005358043.1:5788217..5788289:-
MBR_169502_43022 1.4e+2 276 158 5 113 yes blast aggggauguccgacugccgguu cggcagucggacaucccucu aggggauguccgacugccgguuuaagcccgaucccugggaucggucuuaaaccggcagucggacaucccucu NW_005371930.1:409000..409072:-
MBR_161301_23210 1.4e+2 283 282 0 1 no blast gacgggacugucugcggcgagg uggccgcagcucuuccug uggccgcagcucuuccugcucagacggugacgcgggacgggacugucugcggcgagg NW_005363729.1:79461..79518:-
MBR_167754_33547 1.4e+2 272 271 0 1 yes blast cuuggcgccgucagcgggug cccacugcuggcgccggu cccacugcuggcgccggucucaaucgcuuggcgccgucagcgggug NW_005370182.1:2066715..2066761:+
MBR_161408_23465 1.4e+2 272 262 0 10 yes blast ucggacugccgguuucagccu ccgaaaccggcagucugacauc ucggacugccgguuucagccugauccccacaggccgaaaccggcagucugacauc NW_005363836.1:3968406..3968461:-
MBR_150896_1429 1.3e+2 269 252 13 4 yes blast cacuggggugccuggccagcc gcuggccacggccccgggcaac cacuggggugccuggccagcccgggugaggggcugagggcuguuugccggcuggccacggccccgggcaac NW_005353324.1:886532..886603:-
MBR_168654_39136 1.3e+2 266 235 0 31 yes blast acuggccaggcaccccagcagu cgcuggggggcuuggccag cgcuggggggcuuggccagccuacaaacugccaucagacuggccaggcaccccagcagu NW_005371082.1:3583902..3583961:-
MBR_32314_214 1.3e+2 266 261 0 5 yes blast gccaaccuuucggaccucacggau ucuguggaccaccgguuggca gccaaccuuucggaccucacggaucaucaguggucuguggaccaccgguuggca NW_005234742.1:1..55:+
MBR_159224_20359 1.3e+2 257 242 9 6 yes blast cgggggaugucccacugccggc cuggcagugggacaucccccca cgggggaugucccacugccggcuuaggcuugcggggaguagggagcgggccuaagcuggcagugggacaucccccca NW_005361652.1:3146985..3147062:-
MBR_157050_17527 1.3e+2 258 213 0 45 yes blast cauggaggucucugucuggcu uuugaucguuccccuccauaca cauggaggucucugucuggcuuagcacagcuggcuaaguuugaucguuccccuccauaca NW_005359478.1:6879065..6879125:-
MBR_153371_9967 1.3e+2 252 210 13 29 yes blast cacuggggggcuugaccagccu gcuggccaggccccccagcagg cacuggggggcuugaccagccugcaaacagcccucagccccucacccaggcuggccaggccccccagcagg NW_005355799.1:1642369..1642440:+
MBR_169336_42294 1.3e+2 258 256 0 2 yes blast ucgugcacugggccucu ccccccugugcacgaau ccccccugugcacgaauuucgugcacugggccucu NW_005371764.1:162932..162967:+
MBR_166632_30233 1.2e+2 246 199 0 47 yes blast uugggggauguccaacugcugu cagcagucagacaucccucuca uugggggauguccaacugcuguuuuaggcccgauccugcaaccagcagucagacaucccucuca NW_005369060.1:1745080..1745144:-
MBR_169287_42218 1.2e+2 239 238 0 1 yes blast ugauugggcugccuccagagga acucugaggcugaccaauuggg acucugaggcugaccaauugggcaaaaucuuugaccugauugggcugccuccagagga NW_005371715.1:1044316..1044374:-
MBR_169287_42222 1.2e+2 239 238 0 1 yes blast ugauugggcugccuccagagga acucugaggcugaccaauuggg acucugaggcugaccaauugggcaaaaucuuugaccugauugggcugccuccagagga NW_005371715.1:1045425..1045483:-
MBR_161344_23269 1.2e+2 239 238 0 1 yes blast ugauugggcugccuccagagga acucugaggcugaccaauuggg acucugaggcugaccaauugggcaaaaucuuugaccugauugggcugccuccagagga NW_005363772.1:4371415..4371473:+
MBR_169265_41982 1.2e+2 237 165 0 72 yes blast accggcaguuggacaucccucu gggaugucugacugcugguu gggaugucugacugcugguuaagggaucgggccuuaaccggcaguuggacaucccucu NW_005371693.1:2084510..2084568:+
MBR_165720_29066 1.2e+2 235 169 0 66 yes blast uaggccggcagucggacaucc gauguccgacugccagcuuagg gauguccgacugccagcuuaggcagggagcaggccuaggccggcagucggacaucc NW_005368148.1:3752331..3752387:-
MBR_151844_5556 1.2e+2 234 118 6 110 yes blast cuggccaagccccccagcggga cacuggggugccuggccagc cacuggggugccuggccagcuugggugaggggcugauggcuguugguaugcuggccaagccccccagcggga NW_005354272.1:231537..231609:-
MBR_158463_19334 1.2e+2 233 231 0 2 yes blast gcuggccacgccccccagcag cauggggguauggccagccug gcuggccacgccccccagcagggacucuuacuccauggggguauggccagccug NW_005360891.1:1132506..1132560:+
MBR_155833_15677 1.1e+2 231 223 0 8 yes blast ucggggaugucugacugccagc cagcagguggacauccccugu ucggggaugucugacugccagcuguggggagugggccuaagccagcagguggacauccccugu NW_005358261.1:127641..127704:-
MBR_157696_18170 1.1e+2 229 185 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua NW_005360124.1:2249429..2249493:+
MBR_159445_20476 1.1e+2 225 214 5 6 yes blast uagugcacugaccaccagggga uccugguggucagugcauguca uagugcacugaccaccaggggacaguuccugcauugagugucugccuccugguggucagugcauguca NW_005361873.1:1796263..1796331:+
MBR_154091_11798 1.1e+2 223 213 0 10 yes blast cacacugaccaccagggggc ccccuuguggucagugcgcguca cacacugaccaccagggggcagcuucaguguugagcaucugcccccuuguggucagugcgcguca NW_005356519.1:2366865..2366930:-
MBR_153659_10759 1.1e+2 223 162 0 61 yes blast ugggggaugucugacugcugga cggcagucggacaucccucu ugggggaugucugacugcuggauuacgcccgaucccacauggaucuggccuaaaacggcagucggacaucccucu NW_005356087.1:727094..727169:-
MBR_155664_15420 1.1e+2 224 214 0 10 yes blast cuaauaugcuaauggucggga cagaccauuagcauauuagcu cuaauaugcuaauggucgggauaccuuaacguguaacgaccagaccauuagcauauuagcu NW_005358092.1:3344166..3344227:+
MBR_154323_12562 1.1e+2 222 199 1 22 yes blast gccccgaucgccccucaggagu ccucaggggcgaucaggg gccccgaucgccccucaggaguagggggagauggagaagcccucaggggcgaucaggg NW_005356751.1:760258..760316:+
MBR_168183_36523 1.1e+2 229 228 0 1 no blast gucugccccuaucucaugccug aggacugaguuuggggcuguugu gucugccccuaucucaugccugguguuggaguccccuugagauacaggacugaguuuggggcuguugu NW_005370611.1:3451093..3451161:-
MBR_157696_18295 1.1e+2 220 210 0 10 yes blast augucaaacucgcagcuggugg ugccagccgugaguuugaca augucaaacucgcagcugguggucaugcagccugccagccgugaguuugaca NW_005360124.1:5292276..5292328:-
MBR_168654_39098 1.1e+2 219 187 0 32 yes blast ugcuggggugccuggccaguc gcuggccaagccccccagcgg ugcuggggugccuggccagucugauggcaguuuguaggcuggccaagccccccagcgg NW_005371082.1:3583904..3583962:+
MBR_167506_31668 1.1e+2 220 162 0 58 yes blast ugggggaugucugacugcugga cggcagucggacaucccucu ugggggaugucugacugcuggaugucccggggaugaggccuaaaucggcagucggacaucccucu NW_005369934.1:268567..268632:+
MBR_168144_36169 1.1e+2 217 159 0 58 yes blast cgcuggggugccuggccagccu cuggccaagccccccagugggu cgcuggggugccuggccagccugggugagaagcugauggcuguuugcaggcuggccaagccccccagugggu NW_005370572.1:694069..694141:+
MBR_160568_22225 1.1e+2 218 212 0 6 yes blast ucaggccugggcaggggacu ccccccacccaggccugacgcc ucaggccugggcaggggacucccagaccccuccaauugcuuccuccgccccccacccaggccugacgcc NW_005362996.1:154257..154326:-
MBR_160819_22526 1.1e+2 218 175 0 43 yes blast gcggaucagacccugccucucu agaggcagguacugaucaacagc agaggcagguacugaucaacagcugccacugagucugcggaucagacccugccucucu NW_005363247.1:867562..867620:+
MBR_151819_5440 1.1e+2 217 113 0 104 yes blast cuuguacccgcugauggcaca ugccagcagcaggugcaagugg cuuguacccgcugauggcacagagcgauugggacccgugccagcagcaggugcaagugg NW_005354247.1:292960..293019:+
MBR_168982_41024 1.1e+2 217 208 0 9 yes blast ucccccuggugaucagugcgcu acacugaccaccaaggggcag acacugaccaccaaggggcagacguucaacacaggagcuucccccuggugaucagugcgcu NW_005371410.1:581362..581423:-
MBR_150147_1354 1.1e+2 240 239 0 1 no blast caucgaucagcugccuccug ggggagagggauagagag ggggagagggauagagaguuuggaacaucgaucagcugccuccug NW_005352575.1:836..881:-
MBR_158690_19658 1.1e+2 216 202 0 14 yes blast gguuccggggugcgucaccug gaugacacaccccggaaucgg gaugacacaccccggaaucgggcccccucuucucugguuccggggugcgucaccug NW_005361118.1:834972..835028:-
MBR_166063_29532 1.1e+2 216 211 0 5 yes blast cagcagucagacaucccucucaa uugggggaugucugacagcc uugggggaugucugacagcccauuuaggcccgaucccuggggcuggaccuaaaccagcagucagacaucccucucaa NW_005368491.1:1210583..1210660:-
MBR_166673_30397 1.1e+2 213 205 0 8 yes blast ucgggggauguccaacugccaga ccagcaguuggacaucccucuca ucgggggauguccaacugccagaucaggccuaaaccagcaguuggacaucccucuca NW_005369101.1:1062508..1062565:-
MBR_167474_31490 1.0e+2 207 204 1 2 yes blast ugcccugaucgccccucag ucaggggcgaucggggccggc ugcccugaucgccccucaggaacagggggagguggagaagcccucaggggcgaucggggccggc NW_005369902.1:2785342..2785406:+
MBR_165953_29401 1.0e+2 206 204 0 2 yes blast ugcccugaucgccccucag ucaggggcgauuggggcuggc ugcccugaucgccccucaggaacgggggagggggagaagcccucaggggcgauuggggcuggc NW_005368381.1:911480..911543:-
MBR_151539_4539 1.0e+2 207 186 0 21 yes blast uaaccgguugaacaacugaacc uuacaguuguucaaccaguuacu uuacaguuguucaaccaguuacuaaucuaacuaauuguaaccgguugaacaacugaacc NW_005353967.1:7334966..7335025:-
MBR_167779_33664 1.0e+2 206 197 0 9 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguuccucucaaccguagucaggaagcccuuaccccaaaaagca NW_005370207.1:1317310..1317375:+
MBR_160011_21458 1.0e+2 205 196 0 9 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguacauaacucaauagccggaagcccuuaccccaaaaagca NW_005362439.1:618181..618244:+
MBR_162168_24243 1.0e+2 203 176 0 27 yes blast cccagauugccccucaggagc ccucaggggcgaucagggcca cccagauugccccucaggagcagggguagguggagaagcccucaggggcgaucagggcca NW_005364596.1:3497543..3497603:-
MBR_154207_11941 1.0e+2 203 197 5 1 yes blast ugccagcagcgggugugagc ucacaccugcugauggc ucacaccugcugauggcuccgagcgaucgggacuggcgcugggugccagcagcgggugugagc NW_005356635.1:948204..948267:+
MBR_165561_28949 1.0e+2 203 130 0 73 yes blast gaugucugacugccagcuuagg cuaagcuggcagguggac cuaagcuggcagguggacuuccccuaagagcucccagacugccagaggaugucugacugccagcuuagg NW_005367989.1:3555103..3555172:-
MBR_158078_18719 1.0e+2 202 201 0 1 yes blast gaucgggccuaaaccagcagu cugccgguuuaggcccgauu cugccgguuuaggcccgauucccccagggggaucgggccuaaaccagcagu NW_005360506.1:22649..22700:+
MBR_157329_17725 1.0e+2 203 130 0 73 yes blast gaugucugacugccagcuuagg cuaagcuggcagguggac gaugucugacugccagcuuaggcccaauccuccagggaacaggccuaagcuggcagguggac NW_005359757.1:308267..308329:+
MBR_164405_27260 1.0e+2 203 184 0 19 yes blast guucuggggugcaucaccugaga caggugaugcacccuggaaucggg caggugaugcacccuggaaucgggccccuccucucugguucuggggugcaucaccugaga NW_005366833.1:3515638..3515698:-
MBR_136350_1136 1.0e+2 203 130 0 73 yes blast gaugucugacugccagcuuagg cuaagcuggcagguggac gaugucugacugccagcuuaggcccaauccuccagggaacaggccuaagcuggcagguggac NW_005338778.1:77..139:-
MBR_167652_32680 1.0e+2 202 201 0 1 yes blast augucaaacucgcagcuggugg ccggccgcgaguuugacaug augucaaacucgcagcuggugggccacaugccucggcccgccggccgcgaguuugacaug NW_005370080.1:1579022..1579082:+
MBR_51978_331 1.0e+2 202 201 0 1 yes blast gaucgggccuaaaccagcagu cugccgguuuaggcccgauu cugccgguuuaggcccgauucccccagggggaucgggccuaaaccagcagu NW_005254406.1:15..66:+
MBR_151957_6174 1.0e+2 200 159 0 41 yes blast cgcuggggugccuggccagccu cuggccaagucccccagcgggg cgcuggggugccuggccagccugggugaggggcugacggcuguuugcaggcuggccaagucccccagcgggg NW_005354385.1:4488049..4488121:-
MBR_162243_24299 1.0e+2 200 119 0 81 yes blast auguccaacugccagcuuagg uaagccggcagucggacaacc auguccaacugccagcuuaggccugcucccaguggugagcaggccuaagccggcagucggacaacc NW_005364671.1:646009..646075:+
MBR_157453_18037 1.0e+2 197 196 0 1 yes blast augucaaacucgcagcuggugg ccggccgcgaguuugacaug augucaaacucgcagcuggugggccgcaugccgccggccgcgaguuugacaug NW_005359881.1:2502143..2502196:-
MBR_163376_26064 1.0e+2 196 195 0 1 yes blast caucugcccccugauggucggu ugaccaccaagggccagcuccu ugaccaccaagggccagcuccugcauugagcaucugcccccugauggucggu NW_005365804.1:1193816..1193868:-
MBR_168359_37870 1.0e+2 195 194 0 1 yes blast gaucgggccuaaaccagcagu ugccgguuuaggcccgauc ugccgguuuaggcccgaucacagaucgggccuaaaccagcagu NW_005370787.1:5724919..5724962:-
MBR_151852_5570 1.0e+2 193 126 1 66 yes blast cuggccaggccccccagcgggg ugcuggggggcuuggccagccu ugcuggggggcuuggccagccugggugaguggaugauggcuguuuacaggcuggccaggccccccagcgggg NW_005354280.1:103875..103947:-
MBR_169610_43355 1.0e+2 194 181 0 13 yes blast ugcuggggugccuggccaguc gcuggccaagccccccagu ugcuggggugccuggccagucugagugagaagcugguggcuguuuguaggcuggccaagccccccagu NW_005372038.1:131042..131110:-
MBR_167124_30933 1.0e+2 192 152 0 40 yes blast cugugcaccaggccucuaguu uagaggccuggugcacaaaau cugugcaccaggccucuaguugaauuauaaugugacuagaggccuggugcacaaaau NW_005369552.1:1344241..1344298:-
MBR_164926_27952 9.9e+1 192 151 0 41 yes blast ccuggccugcucuccccacaga aaggggagagaaggccagauca aaggggagagaaggccagaucaacacccugaccugccuggccugcucuccccacaga NW_005367354.1:3496392..3496449:-
MBR_159002_19951 9.8e+1 190 188 0 2 yes blast uugggggaugucugccugccggg cuggcaggcggacaucccu uugggggaugucugccugccggguuaggcccuaucccuagcuuaggccuggcaggcggacaucccu NW_005361430.1:1109930..1109996:-
MBR_169560_43180 9.8e+1 188 150 16 22 yes blast cuggccaggccccccagcgggg uacugggguuccuggccagccu uacugggguuccuggccagccugggugaggggcugagggcaguuugcagacuggccaggccccccagcgggg NW_005371988.1:45..117:-
MBR_154323_12606 9.7e+1 187 156 0 31 yes blast gccccgaucgccccucaggag ccugaggggugauuggggcuga gccccgaucgccccucaggagcagggguagguagagaagcccugaggggugauuggggcuga NW_005356751.1:4297114..4297176:+
MBR_157798_18453 9.7e+1 188 186 0 2 yes blast ccggcugugaguuugacaugcu gcaugucaaacucgcggc gcaugucaaacucgcggccggcauguggcccaccggcugugaguuugacaugcu NW_005360226.1:422678..422732:+
MBR_157412_17915 9.7e+1 188 171 0 17 yes blast auggaucagacccugccucucu agaggcaaguucugaucaguggc agaggcaaguucugaucaguggcugccgcagagguuauggaucagacccugccucucu NW_005359840.1:5208958..5209016:-
MBR_162454_24617 9.7e+1 188 171 0 17 yes blast auggaucagacccugccucucu agaggcaaguucugaucagugga agaggcaaguucugaucaguggaugccacagaggcuauggaucagacccugccucucu NW_005364882.1:1934059..1934117:-
MBR_161181_23081 9.7e+1 187 186 0 1 yes blast ccggcugugaguuugacaugcu caugucaaacucccagcc caugucaaacucccagccggcaugccgcgaguuuaaauaaacgaggcaugcggcccaccggcugugaguuugacaugcu NW_005363609.1:1013109..1013188:+
MBR_160781_22456 9.6e+1 185 181 0 4 yes blast ugcuggggugccuggccaguc cuggccaagacccccagcgg ugcuggggugccuggccagucugagugaguggcugauggcaguuuuuaggcuggccaagacccccagcgg NW_005363209.1:2964529..2964599:+
MBR_154442_12791 9.5e+1 184 172 0 12 yes blast ccgggugccagcaguggguguga gcaccugcugauggcgcugagca gcaccugcugauggcgcugagcaaucaggaccggcgccgggugccagcaguggguguga NW_005356870.1:9364598..9364657:+
MBR_153831_11143 9.4e+1 182 181 0 1 yes blast cccagauugccccucaggagc ccugaggggugaucugg cccagauugccccucaggagcagagagagguagagaagcccugaggggugaucugg NW_005356259.1:6935..6991:-
MBR_159688_20977 9.4e+1 190 189 0 1 no blast cugggcacuggcagcgggugc caccagaagcaggugcgagcgc cugggcacuggcagcgggugcaagccucggcuccggcaccagaagcaggugcgagcgc NW_005362116.1:179976..180034:-
MBR_163712_26450 9.4e+1 182 154 0 28 yes blast ugagcccacccgucugcccuaca cuggguaguugggguucugacuggca cuggguaguugggguucugacuggcaucuuguuccuuugaugugagcccacccgucugcccuaca NW_005366140.1:1090182..1090247:-
MBR_167514_31812 9.4e+1 181 77 0 104 yes blast ucuggccaagccccccagcgau cacuggggugccuggccag cacuggggugccuggccagucuagguuaggggcugagggccguuuucagucuggccaagccccccagcgau NW_005369942.1:3692869..3692940:-
MBR_152776_8696 9.3e+1 188 183 0 5 no blast acucgcacccgcugcuggcg cucucacacccacugccagu cucucacacccacugccagugacagccucacucgcacccgcugcuggcg NW_005355204.1:539528..539577:-
MBR_151032_1969 9.2e+1 179 162 0 17 yes blast ugggggaugucugacugcugga uggcagucggacuucccucuc ugggggaugucugacugcuggaugacugacuaucuggcagucggacuucccucuc NW_005353460.1:1273138..1273193:-
MBR_168232_36811 9.1e+1 175 168 0 7 yes blast ccagcagucggacauccccuga gagagggauguccgacugc gagagggauguccgacugcuacagggaucaggccuaacauugugucccuaaaccagcagucggacauccccuga NW_005370660.1:923199..923273:+
MBR_162642_24999 8.9e+1 173 167 0 6 yes blast ucggggaucaucaugucacgag ugugacagauugauaacugaaag ucggggaucaucaugucacgagauaccacuuugcacuugugacagauugauaacugaaag NW_005365070.1:2371909..2371969:-
MBR_158814_19746 8.8e+1 170 161 0 9 yes blast cgcacugaccaccagggggc ccccuuggugaucagugugug cgcacugaccaccagggggcaguuccugcacugagcaucugccccuuggugaucagugugug NW_005361242.1:28628..28690:-
MBR_167487_31564 8.6e+1 166 161 0 5 yes blast aggugacgcaccccggaaucagg gguuccgggugcaucaccug aggugacgcaccccggaaucaggcucccuccucucugguuccgggugcaucaccug NW_005369915.1:2593168..2593224:+
MBR_162642_24991 8.6e+1 166 162 0 4 yes blast caaagugcucauagugcagguag uacuguagugugagcacuucugg caaagugcucauagugcagguaguuuugccauuauucuacuguagugugagcacuucugg NW_005365070.1:2065286..2065346:-
MBR_157002_17280 8.6e+1 165 135 0 30 yes blast ucaggccugggcaggggacc ccccccgcccaggccugaugccu ccccccgcccaggccugaugccucucacugaggcaucaggccugggcaggggacc NW_005359430.1:505630..505685:-
MBR_168982_41100 8.5e+1 174 171 0 3 no blast cggcggcggcggcggcu cccucguccucgccccuc cccucguccucgccccucacucuugagaaacgguagcggcggcggcggcggcu NW_005371410.1:9731685..9731738:-
MBR_167603_32423 8.5e+1 163 130 0 33 yes blast cgcacugaccaccagggggc ugccccuggugguccgugugcu cgcacugaccaccagggggcagaugcccaaugcaagagcugccccuggugguccgugugcu NW_005370031.1:282354..282415:+
MBR_168101_35808 8.5e+1 164 112 0 52 yes blast gccccgaucgccccucaggag ccugaggggcgaucggggccagu gccccgaucgccccucaggagaagggggagguagagaagcccugaggggcgaucggggccagu NW_005370529.1:985510..985573:-
MBR_165720_29065 8.5e+1 172 169 0 3 no blast uaggccggcagucggacaucc ggucccggacugcgaga uaggccggcagucggacaucccccaggggucccggacugcgaga NW_005368148.1:3752308..3752352:-
MBR_156515_16699 8.4e+1 163 162 0 1 yes blast ugggggaugucugacugcugga ccgguagucggacaucccucu ugggggaugucugacugcuggaugucuaaaccgguagucggacaucccucu NW_005358943.1:4946101..4946152:-
MBR_157329_17727 8.4e+1 161 160 0 1 yes blast cacuggcagugggugugagcgg aguggcagcucuggugc aguggcagcucuggugccagcugugggugcgagcagggcuggcacuggcagugggugugagcgg NW_005359757.1:392169..392233:+
MBR_168232_36840 8.3e+1 159 156 0 3 yes blast ugcaggcaaggcggcuccuggg ccggggugccgccuugccug ccggggugccgccuugccugcgcccggcuuuccaguuacgaucacgaucacaggcugcaggcaaggcggcuccuggg NW_005370660.1:702240..702317:-
MBR_152829_8798 8.2e+1 160 157 0 3 yes blast cgggggaugucugacugccagg ccugccagccugaucaccc cgggggaugucugacugccagguuaggccugaucccugugaucaugcuucuaccugccagccugaucaccc NW_005355257.1:1880..1951:+
MBR_152687_8478 8.2e+1 157 156 0 1 yes blast gccccgaucgccccucaggag ccugaggggcaaucggg gccccgaucgccccucaggagcaggggaagguggagaagcccugaggggcaaucggg NW_005355115.1:3781956..3782013:+
MBR_160011_21529 8.2e+1 158 154 3 1 yes blast ugucaggccugggcaggggac acccucacccaggccug ugucaggccugggcaggggacacccaucucccucccauggccggcuccacccucacccaggccug NW_005362439.1:4294898..4294963:-
MBR_152209_7135 8.1e+1 157 156 0 1 yes blast ugcaggcaaggcggcuccuggg cgggguguugccuugcc ugcaggcaaggcggcuccugggucccgggguguugccuugcc NW_005354637.1:1054..1096:-
MBR_156935_17203 8.1e+1 157 156 0 1 yes blast ugcaggcaaggcggcuccuggg cgggguguugccuugcc ugcaggcaaggcggcuccugggucccgggguguugccuugcc NW_005359363.1:1219..1261:-
MBR_162727_25060 8.1e+1 156 92 0 64 yes blast caauuggggaguggggcuagcc ccagcaccgccccccaaucacc caauuggggaguggggcuagccagugaacgggccagcaccgccccccaaucacc NW_005365155.1:2391451..2391505:+
MBR_160106_21610 8.0e+1 154 101 0 53 yes blast ucaggccugggcaggggacc cccccagcccaggccugaug cccccagcccaggccugaugccucuggcccaggcuucaggccugggcaggggacc NW_005362534.1:1493896..1493951:+
MBR_152919_8891 7.9e+1 152 77 0 75 yes blast ugagggaugucugacugccggu cagcagucagacaucccucuca ugagggaugucugacugccgguuuaggcccaaucucacagggauuggaccuaaaccagcagucagacaucccucuca NW_005355347.1:631724..631801:+
MBR_169266_42063 7.8e+1 150 63 0 87 yes blast acugaucaccagggggcaagu ucugcccccugguggucagugc acugaucaccagggggcaaguccugugcugagugucugcccccugguggucagugc NW_005371694.1:171804..171860:-
MBR_156221_16208 7.8e+1 149 97 0 52 yes blast agacgagugugaaugggagagu ucucccauccacacucgucuau ucucccauccacacucgucuaucugaaacaaguauacaagacgagugugaaugggagagu NW_005358649.1:6018957..6019017:-
MBR_156221_16210 7.8e+1 149 97 0 52 yes blast agacgagugugaaugggagagu ucucccauccacacucgucuau ucucccauccacacucgucuaucugaaacaaguauacaagacgagugugaaugggagagu NW_005358649.1:6030815..6030875:-
MBR_158963_19868 7.6e+1 145 93 0 52 yes blast gccccgaucgccccucaggac uccugaggggcaauuggggccag gccccgaucgccccucaggacuucugccccucccccugcuccugaggggcaauuggggccag NW_005361391.1:1057991..1058053:+
MBR_167694_32940 7.6e+1 146 135 0 11 yes blast cacccgcugcuggcgcccagca cucggcgccaucagcaggugu cacccgcugcuggcgcccagcaccaguccugaucacucggcgccaucagcaggugu NW_005370122.1:524874..524930:+
MBR_167614_32510 7.5e+1 144 139 0 5 yes blast cugggcacuggcagcgggugu cacccgcugauggcgcagagcga cacccgcugauggcgcagagcgaucagaccagcacugggcacuggcagcgggugu NW_005370042.1:449738..449793:-
MBR_168410_37966 7.5e+1 144 131 0 13 yes blast aaugucugccugccggcuuagg uaagccggcagguggacaucccu aaugucugccugccggcuuaggcccgauccccuaagccggcagguggacaucccu NW_005370838.1:1132201..1132256:+
MBR_163743_26534 7.4e+1 143 141 0 2 yes blast ugaugucuggccucauucucagg uggguggagcccaggcauugguga ugaugucuggccucauucucagggauuccaaauuagucuggguggagcccaggcauugguga NW_005366171.1:4781171..4781233:+
MBR_168272_37089 7.4e+1 152 149 0 3 no blast uggugacgcacccaggaaucagg caucuccugaggggucccggauua caucuccugaggggucccggauuacaagagagcaguucucuggugacgcacccaggaaucagg NW_005370700.1:31335..31398:+
MBR_154091_11760 7.4e+1 142 139 0 3 yes blast gaugucugacugcuggcuuagu cuaagccagcaggcggacauccccu gaugucugacugcuggcuuagucccaaucuccagaggaauugggccuaagccagcaggcggacauccccu NW_005356519.1:1698280..1698350:+
MBR_164171_27067 7.3e+1 142 134 0 8 yes blast cgggggaugucugacugccagg ccagcaguuggacaucccucuca cgggggaugucugacugccagggaucaagccuaaaccagcaguuggacaucccucuca NW_005366599.1:3237028..3237086:-
MBR_165381_28602 7.3e+1 140 93 0 47 yes blast ucaggccugggcaggggacu agccccuugcccaggccugacg ucaggccugggcaggggacucccaucucucaucucccuuugaucgccagaucagccccuugcccaggccugacg NW_005367809.1:757563..757637:+
MBR_158023_18708 7.2e+1 139 127 0 12 yes blast cgcacugaccaccagggggc uccccugguggucagugcaca cgcacugaccaccagggggcacuccugcauugagcaucuguccccugguggucagugcaca NW_005360451.1:71..132:+
MBR_151881_5915 7.2e+1 139 120 0 19 yes blast cugccuagaccccugcucacc uggggcggggguucugggcugg uggggcggggguucugggcugggcuggguguacucccugccuagaccccugcucacc NW_005354309.1:580451..580508:+
MBR_167938_34745 7.2e+1 138 134 0 4 yes blast cacccgcugcuggcgcccagca cuuggcgccaucagcggguu cacccgcugcuggcgcccagcaccaguccugaucgcuuggcgccaucagcggguu NW_005370366.1:1605997..1606052:-
MBR_168130_36111 7.2e+1 139 135 0 4 yes blast uaagccagcagucggacaucu gaugucugacuucuggcuuagg gaugucugacuucuggcuuaggccugcuccccuaagccagcagucggacaucu NW_005370558.1:3383439..3383492:+
MBR_168133_36150 7.1e+1 137 106 0 31 yes blast ccagcagucggacauccccuga ugggggauguccgacugccaggu ugggggauguccgacugccagguuaggcccgcuaccagcagucggacauccccuga NW_005370561.1:95613..95669:+
MBR_154687_13557 7.1e+1 137 124 10 3 yes blast cacacugaccaccagggggc cccccuggaggucagugcgcu cacacugaccaccagggggcauaugcuuaacucaggagcugcccccuggaggucagugcgcu NW_005357115.1:3292595..3292657:+
MBR_168359_37814 7.0e+1 134 99 1 34 yes blast ugccccaaucgccccucaggag ccucaggggcgaucaggga ugccccaaucgccccucaggagcagggggagauggagaagcccucaggggcgaucaggga NW_005370787.1:2931865..2931925:-
MBR_167952_34854 6.9e+1 132 120 0 12 yes blast auguccaacugccagcuuagg uaagcuggcagcuggacaucc auguccaacugccagcuuaggagcagggagugagccuaagcuggcagcuggacaucc NW_005370380.1:51153..51210:+
MBR_151881_5926 6.9e+1 141 139 0 2 no blast uccggaauggggcuucagcgcug uggggagccccaguccugguuc uccggaauggggcuucagcgcuggagaucucguacaauggggagccccaguccugguuc NW_005354309.1:741669..741728:+
MBR_168589_38868 6.9e+1 132 108 0 24 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacgggguguaugugaugggguuggcgu NW_005371017.1:82058..82114:-
MBR_161984_24088 6.9e+1 133 92 0 41 yes blast gagacugacgaguucccggga ugcaggaacuugugagucuccu ugcaggaacuugugagucuccuauugacaauaaacaggagacugacgaguucccggga NW_005364412.1:738453..738511:-
MBR_168745_39618 6.8e+1 139 79 0 60 no blast acccucugcugucccugugcggu ugccuggggagcagaugcuggucc ugccuggggagcagaugcugguccgcuuuaagaaggcaaggggacccucugcugucccugugcggu NW_005371173.1:1368222..1368288:-
MBR_113265_732 6.8e+1 139 79 0 60 no blast acccucugcugucccugugcggu ugccuggggagcagaugcuggucc ugccuggggagcagaugcugguccgcuuuaagaaggcaaggggacccucugcugucccugugcggu NW_005315693.1:711..777:-
MBR_136852_1148 6.8e+1 131 105 0 26 yes blast auguccaacugccagcuuagg ugagccagcagucggacaucc auguccaacugccagcuuaggucugagccagcagucggacaucc NW_005339280.1:214..258:-
MBR_162486_24691 6.7e+1 128 116 0 12 yes blast ggaggggccucucugugugccu cacguggagaggccucucugc ggaggggccucucugugugccugugggcccccagcacaggcacguggagaggccucucugc NW_005364914.1:2886424..2886485:-
MBR_156797_17013 6.7e+1 130 82 0 48 yes blast acucugcagacgccugugucu cacccagguguuuguuggaaucu cacccagguguuuguuggaaucuuuaugcuuaaaggacucugcagacgccugugucu NW_005359225.1:4762080..4762137:+
MBR_151055_2131 6.7e+1 128 122 0 6 yes blast acccgcugcuggugcccggc ucagcacugucagugggug acccgcugcuggugcccggcacugguccugauugcucagcacugucagugggug NW_005353483.1:33341..33395:-
MBR_167845_34116 6.7e+1 127 122 0 5 yes blast cuggccaagccccccagcgga ugcugggguuucuggccagccu ugcugggguuucuggccagccuggaugaggugcugauggcuguuuggaggcuggccaagccccccagcgga NW_005370273.1:464168..464239:-
MBR_162454_24620 6.6e+1 128 63 35 30 yes blast accgucagcaggugugaguggu acuugcaucagcuaauggug acuugcaucagcuaauggugcagagcaauuggggccagcaccaguagcgggugcgagcagggcugguaccgucagcaggugugaguggu NW_005364882.1:2533235..2533324:-
MBR_151329_3459 6.6e+1 128 123 0 5 yes blast auguccaacugccagcuuagg aagcugucagucgaacauccu auguccaacugccagcuuaggagagugggccuaagcugucagucgaacauccu NW_005353757.1:862587..862640:-
MBR_160198_21786 6.6e+1 135 129 0 6 no blast cugggcacuggcagcgggugc cacccacugacagcaccgagca cacccacugacagcaccgagcaauugggaccugcacugggcacuggcagcgggugc NW_005362626.1:4096256..4096312:-
MBR_169448_42847 6.5e+1 125 116 0 9 yes blast caucuguccccugguagucagu ugaccaccagggggcagcuccu ugaccaccagggggcagcuccugcauugagcaucuguccccugguagucagu NW_005371876.1:605858..605910:+
MBR_167536_31957 6.5e+1 125 123 0 2 yes blast ggccccaauugccccucaggac ccugaggggcgaucagggc ggccccaauugccccucaggacuucucuaccucccccugcuccugaggggcgaucagggc NW_005369964.1:1428465..1428525:-
MBR_167699_32980 6.4e+1 124 119 0 5 yes blast uccccugcccaggucugaca ccucaggccugggcaaggggc uccccugcccaggucugacaucucugguggaggccucaggccugggcaaggggc NW_005370127.1:1030048..1030102:+
MBR_165167_28436 6.4e+1 124 123 0 1 yes blast cagcagucugacaucccucuca gggggauguccaacugc gggggauguccaacugccaguucaggcccacaggaauugggccuaaaccagcagucugacaucccucuca NW_005367595.1:4002..4072:-
MBR_157696_18248 6.4e+1 124 112 0 12 yes blast acugaccuccagggagcag ugccccugguggucagugca acugaccuccagggagcagacacucaaugcagaagcugccccugguggucagugca NW_005360124.1:10111123..10111179:+
MBR_158249_19055 6.4e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaccguuuuucauuauugcuccugacc NW_005360677.1:1720087..1720145:+
MBR_160157_21684 6.3e+1 121 120 0 1 yes blast cuggggggcagggcaaaggcga ccuuugcccugcccccg cuggggggcagggcaaaggcgauccccagggcugccuuugcccugcccccg NW_005362585.1:700650..700701:+
MBR_161040_22906 6.3e+1 121 115 1 5 yes blast cgcacugaccaccagggggc cccccuuguggucagugcac cgcacugaccaccagggggcaccuccugcauugagugucugcccccuuguggucagugcac NW_005363468.1:1649606..1649667:+
MBR_168806_40151 6.2e+1 120 100 0 20 yes blast aucugccucucuguccccaga auggggauaguguugaggugguu auggggauaguguugaggugguucaagagccuucugaucugccucucuguccccaga NW_005371234.1:723534..723591:+
MBR_154246_12229 6.2e+1 119 114 0 5 yes blast cagcagucggacaucccucucu gggggaugucagacugcugguu gggggaugucagacugcugguuuagguccgauccuugcagucggacaugcagcagucggacaucccucucu NW_005356674.1:3537887..3537958:+
MBR_166279_29809 6.1e+1 117 112 2 3 yes blast ucgccaaccuuucggaccu uccgaaagguuggugaccgcugc ucgccaaccuuucggaccuagugcagcagucgccaacugguggucugugagguccgaaagguuggugaccgcugc NW_005368707.1:4914175..4914250:-
MBR_154986_14219 6.0e+1 115 91 0 24 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacagaguguaugugaugggguuggcgu NW_005357414.1:2423853..2423909:+
MBR_153700_10814 6.0e+1 114 97 0 17 yes blast gauguccgacugcuggcuuagg cuaagccagcagucagacauccc gauguccgacugcuggcuuaggccuaagccagcagucagacauccc NW_005356128.1:731217..731263:+
MBR_152537_8050 5.9e+1 113 107 0 6 yes blast uagcguggccacguccgcacu uguuagcguggccacguccgc uguuagcguggccacguccgcacucgcaggucacagcguuagcguggccacguccgcacu NW_005354965.1:162103..162163:-
MBR_156139_16016 5.9e+1 112 111 0 1 yes blast cgcugggggacuuggccagccu ggcuggccaggcaccccag cgcugggggacuuggccagccugaaaacagcuaucagccacucaccccggcuggccaggcaccccag NW_005358567.1:2679512..2679579:+
MBR_169281_42182 5.8e+1 110 108 0 2 yes blast ugcuggcagugagugugagug ucucgcacccgcugauggcac ucucgcacccgcugauggcaccgagcgauuggggcuggcgcugggugcuggcagugagugugagug NW_005371709.1:3748994..3749060:-
MBR_167705_33083 5.6e+1 108 43 0 65 yes blast uuucgugcaucuggcucuagu cuagaggccuggugcacgaaau uuucgugcaucuggcucuaguguauuauaaaaguaacuagaggccuggugcacgaaau NW_005370133.1:950071..950129:-
MBR_158647_19550 5.5e+1 106 105 0 1 yes blast ucugucucagucguugccccga aggggggagacugagacacagc aggggggagacugagacacagcgaaaaguucggagucucugucucagucguugccccga NW_005361075.1:593808..593867:-
MBR_155418_15001 5.4e+1 103 74 0 29 yes blast guggaccagacccugccucucu agaggcaaguacugauaaacagc agaggcaaguacugauaaacagcuggcacugaggcuguggaccagacccugccucucu NW_005357846.1:1120131..1120189:+
MBR_159557_20698 5.2e+1 99 98 0 1 yes blast uggcagucagacauccucug aggauguccaccugcugg aggauguccaccugcuggcuuaggcccuuucccuaggguauugggcccaagcuggcagucagacauccucug NW_005361985.1:745..817:-
MBR_151539_4593 5.2e+1 109 107 1 1 no blast ucucacucgcggcccggaag gccgggccgacagucaaa ucucacucgcggcccggaagcuggagggacgaggugugcggacaauggucagggccgggccgacagucaaa NW_005353967.1:14612738..14612809:-
MBR_168072_35663 5.2e+1 98 66 0 32 yes blast ugcuggggggcuuggccagccu acuggccgggcaccccagcggg ugcuggggggcuuggccagccugcaaagagccaucagccacucacccagacuggccgggcaccccagcggg NW_005370500.1:1169855..1169926:+
MBR_157997_18651 5.1e+1 96 93 0 3 yes blast gccccgaucgccccucaggac uccugaggggcaaucgggaccg gccccgaucgccccucaggacuucuccaucucccccugcuccugaggggcaaucgggaccg NW_005360425.1:533093..533154:-
MBR_162763_25118 4.9e+1 93 85 0 8 yes blast cuugggggauguccgacugccguuu ccagcaguuggacaucccucuca cuugggggauguccgacugccguuuuagacccaguccuggggaucggcuuaaaccagcaguuggacaucccucuca NW_005365191.1:129470..129546:+
MBR_168896_40386 4.8e+1 92 79 0 13 yes blast ucaggggaugucugccugccagu uggcagucagacaucccucuc ucaggggaugucugccugccaguucaggcacaaucccggggggaucgggccuucgcuggcagucagacaucccucuc NW_005371324.1:2595307..2595384:+
MBR_168745_39574 4.8e+1 92 87 0 5 yes blast gagagggaugucugacuacuggu cagcaauuggacauccccugag gagagggaugucugacuacugguuuaggucagaucccugugggccuaaaccagcaauuggacauccccugag NW_005371173.1:3871035..3871107:+
MBR_169217_41752 4.6e+1 87 79 0 8 yes blast cccugaucgccccuuaggag ccugaggggugauuggggccag cccugaucgccccuuaggagcagggggagguagagaagcccugaggggugauuggggccag NW_005371645.1:607545..607606:+
MBR_151539_4632 4.6e+1 86 82 0 4 yes blast ugcccccugguggucagugugc cgcacugaccaucaggggg cgcacugaccaucagggggcaacuccugcguugagcgccugcccccugguggucagugugc NW_005353967.1:19823564..19823625:-
MBR_157050_17414 4.5e+1 88 69 0 19 yes blast cuaugcuguccugggcuucucc agagauccggggcugccuggauu agagauccggggcugccuggauuuccuccgcucugucuaugcuguccugggcuucucc NW_005359478.1:351018..351076:-
MBR_168276_37158 4.5e+1 94 35 0 59 no blast cagccgggcgaucuucccauu gggaaagugcgaccaggcugcgc gggaaagugcgaccaggcugcgcaguggaaggacgagcucagccgggcgaucuucccauu NW_005370704.1:1137683..1137743:+
MBR_168276_37156 4.5e+1 94 35 0 59 no blast cagccgggcgaucuucccauu gggaaagugcgaccaggcugcgc gggaaagugcgaccaggcugcgcaguggaaggacgagcucagccgggcgaucuucccauu NW_005370704.1:1117387..1117447:+
MBR_162161_24156 4.5e+1 86 84 0 2 yes blast acucgcacccgcugacagcg cuggcagugggugcaagc acucgcacccgcugacagcgccaacugaccagggccggcacagggcgcuggcagugggugcaagc NW_005364589.1:5..70:+
MBR_162243_24346 4.5e+1 85 43 1 41 yes blast uccccugguggucagugcacucca augcgcacugaccaccaggggg augcgcacugaccaccagggggaagacacucaaugcaggagcuguccccugguggucagugcacucca NW_005364671.1:2313686..2313754:-
MBR_159727_21029 4.3e+1 89 88 0 1 no blast ccucugcccucugucugccucagg ccaggccccacagaagag ccucugcccucugucugccucaggccaggcggcaggaagccucaaagcagccaccagggccaggccccacagaagag NW_005362155.1:274323..274400:-
MBR_168272_37115 4.2e+1 80 52 0 28 yes blast ucaaguguucuaguucagaca gucugaaccagagcacuuuu gucugaaccagagcacuuuugagaguggugcugaaugcucucaaguguucuaguucagaca NW_005370700.1:2957955..2958016:+
MBR_161040_22880 4.2e+1 78 74 0 4 yes blast acucgcaccugcugacggcaug gccagcagugggugugagugg acucgcaccugcugacggcauggagcgauuggggccagugccagcagugggugugagugg NW_005363468.1:136080..136140:+
MBR_168654_39102 4.2e+1 77 62 0 15 yes blast cgccagcagugggugcgagc uugcacccacugauggcgcggag uugcacccacugauggcgcggagcaacuggggccagcgccagcagugggugcgagc NW_005371082.1:3732294..3732350:+
MBR_167763_33620 4.1e+1 77 74 0 3 yes blast acucgcaccugcugacggcaug ugccagcagcaggugcaag acucgcaccugcugacggcauggagcaauuggggcuggugccagcagcaggugcaag NW_005370191.1:982384..982441:+
MBR_157416_17924 4.1e+1 77 74 0 3 yes blast acucgcaccugcugacggcaug ugccagcagcaggugcaag acucgcaccugcugacggcauggagcaauuggggcuggugccagcagcaggugcaag NW_005359844.1:213596..213653:+
MBR_1976_16 4.0e+1 77 68 0 9 yes blast uaagccgucaguuggacauccc auguccgacugacagcuuaggc auguccgacugacagcuuaggcccacuaagccgucaguuggacauccc NW_005204404.1:187..235:-
MBR_153831_11208 3.9e+1 75 48 0 27 yes blast cacguugggaaacuguggcauc ugccacagcaccggacucugcc ugccacagcaccggacucugccuugcaugugaugacagacacguugggaaacuguggcauc NW_005356259.1:7361098..7361159:-
MBR_169054_41328 3.8e+1 73 71 1 1 yes blast aagagggauguccgacugcca cagucagacauccccugau aagagggauguccgacugccaaucuaggcccgauccugccugcgggcucaggccuaaaaccagucagacauccccugau NW_005371482.1:429..508:+
MBR_154477_12980 3.7e+1 69 40 2 27 yes blast ugcuggggugccugggcagucu gcuggccaagccccccagcagg ugcuggggugccugggcagucuguuugaguggcugauggcaguuugcaggcuggccaagccccccagcagg NW_005356905.1:4281912..4281983:+
MBR_159527_20641 3.7e+1 78 73 0 5 no blast uggccaccgagggcucgccc agugggcucgcgggcggccagc agugggcucgcgggcggccagcaaguccuccccgcuggccaccgagggcucgccc NW_005361955.1:4992172..4992227:+
MBR_151539_4536 3.7e+1 69 68 0 1 yes blast ccuggcugugcguccugcucacg agagaggacacgcagccuugggc agagaggacacgcagccuugggccugcacggagccugccgcugugcccuggcugugcguccugcucacg NW_005353967.1:6461232..6461301:-
MBR_163336_25968 3.6e+1 70 57 0 13 yes blast ugguuacucugagaagucugaa uaggcuucucauaguaaucaga ugguuacucugagaagucugaaauaugugcuguuuaggcuucucauaguaaucaga NW_005365764.1:1052489..1052545:+
MBR_163336_25970 3.6e+1 70 57 0 13 yes blast ugguuacucugagaagucugaa uaggcuucucauaguaaucaga ugguuacucugagaagucugaaauaugugcuguuuaggcuucucauaguaaucaga NW_005365764.1:1056350..1056406:+
MBR_168779_39772 3.6e+1 68 50 0 18 yes blast cgccaucagcaggugcgagugg acucacacucacugcuggc acucacacucacugcuggcgcgggccccaaucacuccacgccaucagcaggugcgagugg NW_005371207.1:655287..655347:+
MBR_150912_1575 3.6e+1 76 75 0 1 no blast gggucccucggccuggccug agguggugccagggcuc agguggugccagggcucgaagggagucugcagagugagccgggucccggguuccucuggcagguggcgggucccucggccuggccug NW_005353340.1:110630..110717:+
MBR_158248_18982 3.6e+1 68 63 0 5 yes blast accgucagcaggugugaguggu cucucacacccacugccagu cucucacacccacugccagugccuggugccagccccaaucgcuuggcaccgucagcaggugugaguggu NW_005360676.1:1218451..1218520:-
MBR_164782_27827 3.6e+1 75 72 0 3 no blast agcugccggcccugaucacccc ggcccggcgccggcccug ggcccggcgccggcccugaucacuccgcacagucagcuggugugaguggcagcugccggcccugaucacccc NW_005367210.1:336677..336749:+
MBR_168480_38281 3.5e+1 74 68 0 6 no blast cacccgcugcuggugcccagu ucagcgcagucagugggug cacccgcugcuggugcccagugcuggucccaaacgcucagcgcagucagugggug NW_005370908.1:1232785..1232840:-
MBR_155171_14587 3.5e+1 66 58 0 8 yes blast ggcccugaucaccccugaggac uccugaggggcgaucgggga ggcccugaucaccccugaggacuucucuaccucccccugcuccugaggggcgaucgggga NW_005357599.1:446012..446072:-
MBR_152835_8822 3.5e+1 65 64 0 1 yes blast cacuggcagugggugugagcga cuccagcgccggcugcu cuccagcgccggcugcuggugugaccggggucagcacuggcagugggugugagcga NW_005355263.1:576031..576087:-
MBR_157696_18216 3.4e+1 64 58 0 6 yes blast cuggcccugaucaccccugagga ccugaggggugauuggggc cuggcccugaucaccccugaggacuucuucaccucccccuaccccugaggggugauuggggc NW_005360124.1:6391327..6391389:+
MBR_167717_33231 3.4e+1 65 23 3 39 yes blast uagcagcacagaaauauuggca ccaauauuggcugagcugcuccag uagcagcacagaaauauuggcacugggaagagucugccaauauuggcugagcugcuccag NW_005370145.1:30847..30907:-
MBR_168169_36326 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucauuuccugcccuggcccgagggaccgacu NW_005370597.1:360230..360291:-
MBR_155418_15016 3.4e+1 71 68 1 2 no blast uacuggagugccuggccagccu cuggccaagccccccag uacuggagugccuggccagccugggugagggacugauggcuguuugcacacuggccaagccccccag NW_005357846.1:2122916..2122983:+
MBR_168349_37668 3.3e+1 63 47 0 16 yes blast gcccugauugucccuuaggagc ccugaggggcaaucgaggcca gcccugauugucccuuaggagcagggggagguggaaaaacccugaggggcaaucgaggcca NW_005370777.1:4253486..4253547:+
MBR_167124_30918 3.3e+1 62 58 1 3 yes blast ggcccugaucaccccugaggac ccugaggggcaaucggg ggcccugaucaccccugaggacuucuccaacucccccugcuccugaggggcaaucggg NW_005369552.1:4182459..4182517:+
MBR_169127_41595 3.3e+1 62 61 0 1 yes blast ccgcucgcacccgcugaaggca accggcagugggugccagugg ccgcucgcacccgcugaaggcacggagcuauuggggcuggcaccggcagugggugccagugg NW_005371555.1:1556776..1556838:-
MBR_168245_36915 3.3e+1 63 32 0 31 yes blast accucugacccaaaugaaccag guucaugugcgucugagggcu accucugacccaaaugaaccagcccuucccccucugguucaugugcgucugagggcu NW_005370673.1:818128..818185:-
MBR_153476_10228 3.3e+1 69 68 0 1 no blast cacccgcugcuggugcccagu cggugccaucagcaggug cacccgcugcuggugcccagugccagccccaaucccucggugccaucagcaggug NW_005355904.1:259175..259230:+
MBR_154763_13843 3.2e+1 64 42 1 21 yes blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucgugugucgugugugggauccgucucaguuacuuuauagcc NW_005357191.1:1551260..1551325:-
MBR_154465_12903 3.2e+1 61 54 2 5 yes blast gcuccucucagcucugugcug agcuacagagcugggacuggaa agcuacagagcugggacuggaacccagauguccugcuguguauacguggcuccucucagcucugugcug NW_005356893.1:211533..211602:+
MBR_154091_11764 3.2e+1 60 55 0 5 yes blast acuugcacccacugacggcacu ugccggcagugggugcgagcgg acuugcacccacugacggcacugagcaaucggggccagcacugggugccggcagugggugcgagcgg NW_005356519.1:2333298..2333365:+
MBR_167652_32698 3.2e+1 60 49 0 11 yes blast cacacccgcugcuggcgcccagc cucagcaccaucagcgggug cacacccgcugcuggcgcccagcgcuggccccaauugcucagcaccaucagcgggug NW_005370080.1:4249208..4249265:+
MBR_161603_23746 3.2e+1 59 45 0 14 yes blast cucacacccgcugauggcacag caccaguagcgggugcgagcg cucacacccgcugauggcacagagcaguuggggccggcaccaguagcgggugcgagcg NW_005364031.1:3069059..3069117:-
MBR_151881_5907 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucagggggcucugaauguguacaguagucugcacauugguu NW_005354309.1:175709..175771:+
MBR_157050_17496 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucaggacaaugccguuguacaguagucugcacauugguu NW_005359478.1:4694406..4694466:-
MBR_164956_28023 3.1e+1 63 49 0 14 yes blast aauuacagauugucuaagagga ucucucaggcgaccuguaggu aauuacagauugucuaagaggaaaacauauauauucucucaggcgaccuguaggu NW_005367384.1:652558..652613:-
MBR_156797_17075 3.0e+1 57 46 0 11 yes blast agcggacuggccgccugcuucu agccaggcggucaaugcgcug agcggacuggccgccugcuucucguucagcagagccaggcggucaaugcgcug NW_005359225.1:4880424..4880477:-
MBR_152123_6791 3.0e+1 55 32 1 22 yes blast gcuggccaagccccccagcgg ugcuggggugucuggccagccu ugcuggggugucuggccagccugggcgaggggcugagggucauuuucaggcuggccaagccccccagcgg NW_005354551.1:1436477..1436547:-
MBR_151957_6072 3.0e+1 55 49 0 6 yes blast ugccccaaucgccccucagga ucaggggcaaucagggcuggca ugccccaaucgccccucaggaucaggaggcgguggagaaguucucaggggcaaucagggcuggca NW_005354385.1:8546208..8546273:+
MBR_159727_21054 2.9e+1 54 52 0 2 yes blast uccucucacccccgucccccaga gugggggugugggcagga gugggggugugggcaggagaggaguggacaggcccucaucuccucucacccccgucccccaga NW_005362155.1:1558033..1558096:-
MBR_153405_10055 2.8e+1 53 42 0 11 yes blast gccggcgcagacgcucccgccu agggagggcuguggcgaccgagu agggagggcuguggcgaccgaguggagcucggccggcgcagacgcucccgccu NW_005355833.1:898683..898736:+
MBR_159841_21121 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu NW_005362269.1:811817..811871:+
MBR_151110_2372 2.8e+1 51 33 0 18 yes blast ugccccaaucgucccucaggag ugaggggugauuggggcuggca ugccccaaucgucccucaggagcagggggagguagagaagcccugaggggugauuggggcuggca NW_005353538.1:4476264..4476329:+
MBR_167848_34180 2.7e+1 51 49 0 2 yes blast ucuggcaucuuggggucuccag agagacccgaaggagcgagaggaaa agagacccgaaggagcgagaggaaaggggugcucccucuggcaucuuggggucuccag NW_005370276.1:621794..621852:-
MBR_164926_27937 2.7e+1 51 50 0 1 yes blast ugggacugggugagaugggu uaaccuccugcagucccuccu ugggacugggugagauggguuggacaugcccuggaacuaaccuccugcagucccuccu NW_005367354.1:1889910..1889968:-
MBR_167779_33675 2.7e+1 52 51 0 1 yes blast ucacucgggcuuaugccaaaga ucggugcagaggcucgagccuuaau ucacucgggcuuaugccaaagauguaaaauucggugcagaggcucgagccuuaau NW_005370207.1:958674..958729:-
MBR_161344_23289 2.7e+1 50 41 0 9 yes blast aaugcacugaccaccagggggu cccccugguggucagug aaugcacugaccaccaggggguggcuccugcauugagcucccccugguggucagug NW_005363772.1:3522409..3522465:-
MBR_151225_2943 2.7e+1 50 26 0 24 yes blast uguaugugaugggguuggug ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacgggguguaugugaugggguuggug NW_005353653.1:590887..590942:+
MBR_160671_22395 2.6e+1 49 38 0 11 yes blast cugcagcugcuggcaggggccg cccccagcccccagcugcagccu cugcagcugcuggcaggggccgccacccagggggcgcccccagcccccagcugcagccu NW_005363099.1:419206..419265:-
MBR_160106_21627 2.6e+1 48 41 0 7 yes blast ccucaggggcgaucagggccug ugcccugaucaccccucaggag ugcccugaucaccccucaggagcaggagagguagaaaagcccucaggggcgaucagggccug NW_005362534.1:4412574..4412636:+
MBR_167983_35088 2.6e+1 48 41 0 7 yes blast ccucaggggcgaucagggccug ugcccugaucaccccucaggag ugcccugaucaccccucaggagcaaggagagguggagaagcccucaggggcgaucagggccug NW_005370411.1:2116632..2116695:-
MBR_165877_29206 2.5e+1 47 24 0 23 yes blast uguaugugaugggguuggug ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacgggguguaugugaugggguuggug NW_005368305.1:1848717..1848772:-
MBR_155308_14746 2.5e+1 54 53 0 1 no blast ugccccugcccuccacacccccagc aggggggagggcagaggcu aggggggagggcagaggcugggucuccacggggccaccacccugccccugcccuccacacccccagc NW_005357736.1:514941..515008:-
MBR_164956_28056 2.5e+1 53 52 0 1 yes blast aaugggcaguuugggaauuuaga aaauuuccaaacuguaauccuaga aaauuuccaaacuguaauccuagaagaaaugggcaguuugggaauuuaga NW_005367384.1:2735044..2735094:-
MBR_154986_14214 2.4e+1 44 39 0 5 yes blast cuugcaccuacugacggcaccg ugccggcagugggugcgagcgg cuugcaccuacugacggcaccgagugaucaggacuggugcugggugccggcagugggugcgagcgg NW_005357414.1:2002994..2003060:+
MBR_160088_21586 2.4e+1 44 41 1 2 yes blast ugcacccacugacagcaccgagu ccgggugcuggcagcgggugu ugcacccacugacagcaccgagugaucggggcuggcaccgggugcuggcagcgggugu NW_005362516.1:284..342:+
MBR_167688_32894 2.4e+1 43 42 0 1 yes blast ugccuugaucgccccucaggag cccucaggggugaucgggguug ugccuugaucgccccucaggagcaggggguggugaagaagcccucaggggugaucgggguug NW_005370116.1:1359148..1359210:+
MBR_168303_37322 2.4e+1 44 32 0 12 yes blast cccugcucuccccacugcccag cagcaguggauagggccuggag cagcaguggauagggccuggaggugaaagaggcagucccugaccccccugcucuccccacugcccag NW_005370731.1:255244..255311:-
MBR_163404_26091 2.3e+1 52 51 0 1 no blast ucacucgggcuuaugccaaaga ucggugcagaggcucgagccuuaau ucacucgggcuuaugccaaagauguaaaauucggugcagaggcucgagccuuaau NW_005365832.1:790582..790637:-
MBR_168982_41002 2.3e+1 43 40 0 3 yes blast ggugggcacaggagcgggucuug cugcccggccccuccug ggugggcacaggagcgggucuuggcccauccuccgcgccccugcccggccccuccug NW_005371410.1:10863613..10863670:+
MBR_163013_25679 2.2e+1 40 38 1 1 yes blast ugucaggccugggcagggga acccucacccaggccug ugucaggccugggcaggggauccccaucucccucccaucaccggcuccacccucacccaggccug NW_005365441.1:1377264..1377329:-
MBR_169009_41192 2.2e+1 41 38 0 3 yes blast ucaggggugaucagggacagc ugccccaaucaccccucagu ugccccaaucaccccucaguagaaggggaagguggagaagcccucaggggugaucagggacagc NW_005371437.1:92485..92549:-
MBR_154284_12439 2.2e+1 40 36 0 4 yes blast cugaggggugaucagggcagu agccccgaucgccccucagg agccccgaucgccccucagggcuucuccaucucccccugcuccugaggggugaucagggcagu NW_005356712.1:2679306..2679369:+
MBR_168982_40982 2.2e+1 39 25 0 14 yes blast agccccgauugccccucaggaa ccugaggggcaaucggggcca agccccgauugccccucaggaacagggggaaguggagaagcccugaggggcaaucggggcca NW_005371410.1:8042384..8042446:+
MBR_163647_26227 2.2e+1 48 41 0 7 no blast ugcccgcucaccucccgga ccggguugcugggucuggu ccggguugcugggucuggugcuggucaacggcugcccgcucaccucccgga NW_005366075.1:145490..145541:+
MBR_156183_16069 2.1e+1 41 40 0 1 yes blast ugaucaacacuugccucucucu agagaagcagggacugaucca agagaagcagggacugauccauugccuuugugacagcuuuugaucaacacuugccucucucu NW_005358611.1:284906..284968:+
MBR_157658_18133 2.1e+1 40 26 0 14 yes blast cacggaggccuggguugggaca ucucaccccagcccuccguccga cacggaggccuggguugggacauugggaauaaaaugcaauucuucuugcagucucaccccagcccuccguccga NW_005360086.1:1789300..1789374:-
MBR_155308_14718 2.1e+1 39 37 0 2 yes blast gaacgaaauccaagcgcagcug gcugcuuuugggauuccguugcc gaacgaaauccaagcgcagcuggaaugcucuggagacaacagcugcuuuugggauuccguugcc NW_005357736.1:450676..450740:+
MBR_152167_6924 2.1e+1 37 31 0 6 yes blast ugagccagcagucggacaucc auguccaacugacggcuuaggcc auguccaacugacggcuuaggcccgcuccccauaggccuguggggagugggccugagccagcagucggacaucc NW_005354595.1:2037348..2037422:-
MBR_167699_32998 2.0e+1 38 30 0 8 yes blast ugucagaccugggcaggggaccc gccccuugcccaggccu gccccuugcccaggccugaggccuccaccagagaugucagaccugggcaggggaccc NW_005370127.1:1030045..1030102:-
MBR_163141_25782 2.0e+1 37 31 0 6 yes blast acgcgcacugaccaccagggggu gccccugguggucagugcaugu acgcgcacugaccaccagggggucauuaccagucagaccaacuggccccugguggucagugcaugu NW_005365569.1:432..498:+
MBR_168892_40347 2.0e+1 45 43 0 2 no blast caccagggccgcgcucacaccu gugagggccggcuccuguggcua gugagggccggcuccuguggcuacaggggcucgcaccagggccgcgcucacaccu NW_005371320.1:163282..163337:+
MBR_153534_10323 2.0e+1 36 30 0 6 yes blast ugugccaucagcaggugugagug gcuugcaccugcugcuggc gcuugcaccugcugcuggcgucuggugcuggucccgaucacucugugccaucagcaggugugagug NW_005355962.1:1798997..1799063:+
MBR_151539_4532 2.0e+1 36 31 0 5 yes blast cugcccuguguucucuccagu cuggagaggacagcagcagagc cuggagaggacagcagcagagccgggacauggcugcccuguguucucuccagu NW_005353967.1:6246722..6246775:-
MBR_153405_10131 1.9e+1 35 29 0 6 yes blast cggccccaauugccccucaggag ccugaggggcaaucggggcugg cggccccaauugccccucaggagcaggggaaguuggagaagcccugaggggcaaucggggcugg NW_005355833.1:2907913..2907977:-
MBR_167918_34631 1.9e+1 35 9 0 26 yes blast ccccuuggugaucagugugug acacugaucaccagggggcag acacugaucaccagggggcagcuccuggguugagugucucccccuuggugaucagugugug NW_005370346.1:173689..173750:+
MBR_168124_36063 1.8e+1 33 16 0 17 yes blast cgggcaggucugcugagccaga cuggcuggccaggcaggcucuggc cgggcaggucugcugagccagaccguguuuuccaaacagucuggcuggccaggcaggcucuggc NW_005370552.1:1462735..1462799:-
MBR_157696_18152 1.8e+1 41 40 0 1 no blast ccgucugcuggcuuaggcccaau gagggcacaggccaggcug ccgucugcuggcuuaggcccaaucugaagagggcacaggccaggcug NW_005360124.1:1026268..1026315:+
MBR_159605_20862 1.8e+1 34 33 0 1 yes blast cuccaaucugagcucugccacu aggcagagcuuggcuuuggagccca aggcagagcuuggcuuuggagcccaacccacccagucuccaaucugagcucugccacu NW_005362033.1:1041603..1041661:-
MBR_163125_25723 1.8e+1 32 29 0 3 yes blast ccugaggggugauuggggcuga agccccgauugccccucaggag agccccgauugccccucaggagcagggggagguggagaaacccugaggggugauuggggcuga NW_005365553.1:256271..256334:+
MBR_155534_15178 1.7e+1 31 30 0 1 yes blast ccccgaucgucccucaggagc ccugaggggugauuggg ccccgaucgucccucaggagcaaggggagguagaaaagcccugaggggugauuggg NW_005357962.1:924086..924142:+
MBR_154763_13849 1.7e+1 39 38 0 1 no blast acucacacccacugauggcacg cgccagcagggggugcgagc acucacacccacugauggcacggagcgauuggggcugucgccagcagggggugcgagc NW_005357191.1:1876126..1876184:-
MBR_169358_42407 1.7e+1 31 27 0 4 yes blast uuggcgcugucagcugguguga cacccgcugccagugccuagc cacccgcugccagugccuagcaccagccccgauuacuuggcgcugucagcugguguga NW_005371786.1:227555..227613:-
MBR_165561_28939 1.6e+1 29 11 0 18 yes blast acaacccugucacauacaccu uguaugugaugggguuggcgc acaacccugucacauacaccuauauuuguacaggguguaugugaugggguuggcgc NW_005367989.1:507765..507821:-
MBR_163561_26164 1.6e+1 28 15 1 12 yes blast acacugaucaccaggaggcag ugccccugguggucagugca acacugaucaccaggaggcagacgcucaacauaggagcugccccugguggucagugca NW_005365989.1:1205679..1205737:+
MBR_161214_23135 1.5e+1 28 22 0 6 yes blast ccacugcuggcaccuggugc ucagcgccgucagugggug ccacugcuggcaccuggugccagccccaauugcucagcgccgucagugggug NW_005363642.1:483015..483067:-
MBR_158963_19875 1.5e+1 38 35 0 3 no blast uuaggcagucggacaucccucu agggaauguccaacuguugguu agggaauguccaacuguugguuuaggccccaucccugccaguuuaggcagucggacaucccucu NW_005361391.1:2399809..2399873:+
MBR_160198_21713 1.5e+1 26 20 0 6 yes blast cucagugccgucagugggugc caccugcugcuggcacccagcac caccugcugcuggcacccagcaccagcuucaauugcucagugccgucagugggugc NW_005362626.1:2259939..2259995:+
MBR_160568_22229 1.4e+1 25 21 0 4 yes blast cuugcaccugcugacagugca gccagcagugggugugagugg cuugcaccugcugacagugcagagcgauuggagccggugccagcagugggugugagugg NW_005362996.1:445345..445404:-
MBR_158647_19544 1.4e+1 25 22 0 3 yes blast ccucucccauuuccuggcucc agccaggagacugggggugggggg agccaggagacuggggguggggggcagcacuugccuugccuccucucccauuuccuggcucc NW_005361075.1:531537..531599:-
MBR_163125_25737 1.4e+1 25 22 0 3 yes