miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mda/mda_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mda.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mda/mda_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mda/mda_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mda.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mda/mda_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
105.56
95.56
85.56
75.46
65.36
55.26
45.16
35.46
26.56
12.26
01.26
-116
-21.16
-31.16
-41.16
-51.16
-61.26
-71.26
-81.26
-91.26
-101.26





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
MDA_13748_32619 7.5e+6 14792701 14786127 0 6574 yes blast uauugcacuugucccggccugu agguugggaucaguugcaaugcu agguugggaucaguugcaaugcuguguuucuguaugguauugcacuugucccggccugu NW_006294998.1:1900960..1901019:+
MDA_9756_22390 6.8e+6 13361589 13361508 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguguuauauauaaaguauugcacuugucccggccugu NW_006291006.1:9114..9175:-
MDA_13150_30875 5.4e+6 10730766 10416558 0 314208 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggacuugaagaaaccaccgaccguugacuguacc NW_006294400.1:3620441..3620501:-
MDA_14573_34645 5.3e+6 10417327 10417215 0 112 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaauuaaagucaaaaccaucgaccguugauuguacc NW_006295823.1:686088..686150:-
MDA_11094_25711 8.1e+5 1588959 1559541 28 29390 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuccccacuagauugugagcuccugga NW_006292344.1:1601964..1602026:+
MDA_93719_47308 6.5e+5 1286743 1286641 1 101 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc NW_006374969.1:268..341:+
MDA_15375_36873 6.2e+5 1231632 1205392 53 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaggccacagacgggcuuucagucggauguuugcagc NW_006296625.1:64418..64481:-
MDA_12819_30013 6.1e+5 1206481 769702 0 436779 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu NW_006294069.1:1736370..1736429:+
MDA_3002_4806 5.6e+5 1113254 1107016 0 6238 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugaggacguccaggaucacaggugagguucuugggagc NW_006284252.1:56053..56112:+
MDA_14975_35530 4.6e+5 916172 916074 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuauacccugggaguuaacuguacaaccuucuagcuuucc NW_006296225.1:1140444..1140511:+
MDA_2190_2916 4.4e+5 872026 862537 100 9389 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgcuuuguucacaguggcuaaguucug NW_006283440.1:1159541..1159603:-
MDA_12819_30082 3.9e+5 774370 773579 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu NW_006294069.1:3309669..3309729:-
MDA_14566_34403 3.2e+5 631616 629429 0 2187 yes blast caacggaaucccaaaagcagcug cugcgcuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc NW_006295816.1:1298685..1298749:-
MDA_17378_40788 3.0e+5 601946 600186 113 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaaggaauuuuguggucacaaauucguaucuaggggaau NW_006298628.1:2778854..2778916:+
MDA_4979_9924 2.6e+5 510750 510744 0 6 yes blast uucaaguaauccaggauaggcu ccuauucuugauuacuuguuuc uucaaguaauccaggauaggcuguuuccaccugugaggccuauucuugauuacuuguuuc NW_006286229.1:232215..232275:+
MDA_10304_24317 2.6e+5 510725 510595 4 126 yes blast uucaaguaauccaggauaggcu ccuauucucgguuacuugcacg uucaaguaauccaggauaggcugugcaggucccgaugggccuauucucgguuacuugcacg NW_006291554.1:326516..326577:-
MDA_7365_16597 2.1e+5 413793 413593 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacauagucacagauucgauucuaggggaaua NW_006288615.1:14410127..14410189:-
MDA_10845_25144 2.1e+5 413782 413281 5 496 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagguucuucacugcacccggcucggggcagcucaguacaggau NW_006292095.1:2219880..2219943:+
MDA_10845_25261 2.0e+5 402274 402010 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagccgggugcagugaagaaccucggggcagcucaguacaggau NW_006292095.1:2219879..2219942:-
MDA_1624_1986 1.6e+5 332296 328572 0 3724 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcuac uguaaacauccccgacuggaagcuguaaaacagaacuaagcuuucagucagauguuugcuac NW_006282874.1:1682214..1682276:+
MDA_14314_33959 1.5e+5 306415 286162 0 20253 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaucucauggcaacagcagucgaugggcugu NW_006295564.1:859834..859893:-
MDA_15375_36870 1.4e+5 281176 281169 0 7 no blast uguaaacauccuacacucucagcu gagaguacugagugacagauac gagaguacugagugacagauacuguaaacauccuacacucucagcu NW_006296625.1:39949..39995:-
MDA_2849_4497 1.0e+5 205288 205269 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc NW_006284099.1:28513..28585:-
MDA_93719_47310 1.0e+5 202828 202771 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguaguuauuuuacccuguucaggagauaacuauacaaucuauugccuuccc NW_006374969.1:647..725:+
MDA_6662_14616 8.9e+4 175401 174506 0 895 yes blast caaaacgugaggcgcugcuau cagcagcaauucauguuuugaa cagcagcaauucauguuuugaagugcuuuacauaguucaaaacgugaggcgcugcuau NW_006287912.1:200036..200094:-
MDA_2381_3545 8.6e+4 169400 169306 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaacauuaaacaccaauauuauugugcugcuuu NW_006283631.1:1580459..1580523:-
MDA_7832_17426 8.6e+4 169225 169216 1 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaauuaucuccaguauuaacugugcugcugaa NW_006289082.1:914360..914424:+
MDA_1624_1972 6.8e+4 134676 71580 0 63096 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucuccuccccuacuagacugaagcuccuugagga NW_006282874.1:92584..92642:+
MDA_1667_2124 6.7e+4 132223 132157 0 66 yes blast agcuacaucuggcuacugggucuc ggcucaguagucaguguagauc ggcucaguagucaguguagauccugucuuuuauaaucaguagcuacaucuggcuacugggucuc NW_006282917.1:247503..247567:-
MDA_11316_25976 6.5e+4 128154 128116 0 38 yes blast gugcaucuccgugcggccccu ggguggcacggggaggccacggc ggguggcacggggaggccacggcgaauuugcgacaccgugcaucuccgugcggccccu NW_006292566.1:348768..348826:-
MDA_8145_18366 6.3e+4 124165 124098 18 49 yes blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucuuacugaagguuuccuggaaaccacgcacaugcuguugccacuaaccucaaccu NW_006289395.1:4363709..4363788:+
MDA_10177_23750 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga NW_006291427.1:126166..126226:-
MDA_101759_48161 5.8e+4 115323 115319 0 4 yes blast aaaagcuggguugagagggcga gccuucucuucccgguucuucccg gccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggcga NW_006383009.1:732651..732705:+
MDA_18456_43331 5.8e+4 114854 114777 0 77 yes blast uauugcacucgucccggccucc agggacgggacgcggugcagugu agggacgggacgcggugcaguguuguucuuccccccgccaauauugcacucgucccggccucc NW_006299706.1:1291719..1291782:+
MDA_101766_49340 5.0e+4 99806 99707 0 99 yes blast uagguaguuuccuguuguuggg ucgacagcacgacacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgacacugccuuc NW_006383016.1:2366064..2366121:+
MDA_101766_49339 5.0e+4 99708 99707 0 1 no blast uagguaguuuccuguuguuggg cggcggcgggcaagcaccagaacugg cggcggcgggcaagcaccagaacuggucggugauuuagguaguuuccuguuguuggg NW_006383016.1:2366029..2366086:+
MDA_14975_35532 4.3e+4 84570 45288 0 39282 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuucaguaacaucacaagucaggcucuugggaccu NW_006296225.1:1187396..1187457:+
MDA_8569_19804 4.3e+4 84474 78788 87 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaggagcuuucagucggauguuuacagc NW_006289819.1:647807..647871:+
MDA_15559_37343 4.2e+4 83726 77666 1 6059 yes blast uaauacugccugguaaugaugac caucuuacugggcagcauugga caucuuacugggcagcauuggauggugucaggucucuaauacugccugguaaugaugac NW_006296809.1:257994..258053:+
MDA_4667_9377 4.0e+4 78797 78726 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuugaacucggcaacaagaaacugccuga NW_006285917.1:637599..637657:-
MDA_15250_36467 3.9e+4 76636 76583 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc NW_006296500.1:791725..791804:-
MDA_17378_40786 3.1e+4 60860 60785 0 75 yes blast uagguaguuucauguuguuggg caacgacaugaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacaugaaaccacccga NW_006298628.1:2724802..2724861:+
MDA_7856_17799 2.9e+4 58135 58100 19 16 yes blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugaggaggaggccagacccaccgagggaugaaugucac NW_006289106.1:137720..137783:-
MDA_2381_3547 2.7e+4 53190 52227 1 962 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauacuauagucaagaugcgaaucauuauuugcugcucu NW_006283631.1:1580606..1580665:-
MDA_12718_29895 2.5e+4 50682 45498 0 5184 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggag NW_006293968.1:397261..397321:-
MDA_10177_23751 2.4e+4 48904 48224 0 680 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuucccga caaagugcuguucgugcagguagugugauuaccugaccuacugcugagcuagcacuucccga NW_006291427.1:126368..126430:-
MDA_100924_47379 2.4e+4 48754 31435 15 17304 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuagggcagggauuuugcccacaaggagguaacuauacgaccugcugccuuucu NW_006382174.1:933..1009:+
MDA_1667_2122 2.4e+4 47152 45506 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguuaagcaacagcuacauugucugcuggguuu NW_006282917.1:246801..246863:-
MDA_11446_26465 2.0e+4 39645 39483 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucaaaauagcacuggacuuggagucagaaggc NW_006292696.1:1075021..1075081:+
MDA_15155_35974 1.8e+4 36653 36647 1 5 no blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaaugggauccggugguucuagacuugccaacu NW_006296405.1:653373..653437:+
MDA_2190_2918 1.8e+4 36246 36120 0 126 yes blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauuaaaaucacauugccagggauuaccacg NW_006283440.1:1159763..1159824:-
MDA_4993_10357 1.7e+4 35068 33637 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa NW_006286243.1:2338826..2338883:+
MDA_3792_6884 1.4e+4 29375 29020 0 355 yes blast gagagaucagaggcgcagagu ccugugccuuuuaccucuuuaa gagagaucagaggcgcagagugcgucaaugucaaugaagccugugccuuuuaccucuuuaa NW_006285042.1:1898361..1898422:+
MDA_7351_16198 1.4e+4 29087 28950 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac NW_006288601.1:648272..648334:-
MDA_15369_36739 1.2e+4 24403 24333 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca NW_006296619.1:263481..263542:+
MDA_6662_14614 1.0e+4 21331 18189 5 3137 yes blast gaguauuguuucugcugcccgg uagcagcgggaacaguacug uagcagcgggaacaguacugcaguggguuauccguauucuggaguauuguuucugcugcccgg NW_006287912.1:199696..199759:-
MDA_7856_17801 1.0e+4 20989 18901 0 2088 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc NW_006289106.1:137897..137958:-
MDA_10570_24645 1.0e+4 19812 18007 3 1802 yes blast ucccuguccuccaggagcuc agcuccucggggccagagccc ucccuguccuccaggagcucaccugcguccggccgugagcuccucggggccagagccc NW_006291820.1:511929..511987:-
MDA_10177_23753 1.0e+4 19755 16305 1438 2012 yes blast ccgcacuguggguacuuacu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccucucgugcuaccgcacuguggguacuuacu NW_006291427.1:126587..126646:-
MDA_6297_13695 9.7e+3 19045 19040 0 5 yes blast uuagggcccuggcuccaucuccu aguggggcuuugacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuuugacccuaacc NW_006287547.1:2607087..2607152:-
MDA_12219_28392 9.5e+3 18817 12024 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu NW_006293469.1:244284..244340:-
MDA_15377_37001 8.9e+3 17515 17431 0 84 yes blast uggcagucagacauccucugagg gagagggauguccgacugcc gagagggauguccgacugccgauugggccuaaacuggcagucagacauccucugagg NW_006296627.1:44683..44740:+
MDA_4747_9572 8.1e+3 16037 16022 0 15 no blast gacacgugaugcugggcugaug acuagcggugggguaucugaagcugg gacacgugaugcugggcugauguaguggcguucacugugacguucacugcaccaacuagcggugggguaucugaagcugg NW_006285997.1:3410967..3411047:+
MDA_3996_7623 7.9e+3 15593 15592 0 1 no blast ucgugcacugggccucuagu cagccaggccuagggac cagccaggccuagggaccucacccauugacaaauuucgugcacugggccucuagu NW_006285246.1:49273..49328:+
MDA_17271_40607 7.4e+3 14592 14585 0 7 yes blast acgcccuucccccccuucuuca aggagggaggagaggggccacg aggagggaggagaggggccacguucccucugccuggaacgcccuucccccccuucuuca NW_006298521.1:1323000..1323059:+
MDA_11316_25980 7.2e+3 14290 12427 4 1859 yes blast cacuccucuccucccgucuucu aggacgggaggagaggagggugc aggacgggaggagaggagggugcgguguuugcagguccucacuccucuccucccgucuucu NW_006292566.1:458075..458136:-
MDA_936_499 7.2e+3 14257 14226 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauagaauuuucuagcaccaucugaaaucgguua NW_006282186.1:738599..738659:+
MDA_10304_24308 6.2e+3 12351 12255 0 96 yes blast agcugguguugugaaucaggccg gcuacuucacaacaccagggu agcugguguugugaaucaggccguugccaaucagagaacggcuacuucacaacaccagggu NW_006291554.1:1269524..1269585:+
MDA_1131_876 6.2e+3 12211 12202 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagcgcauccucuuacccggcuauuucacgacaccaggguu NW_006282381.1:99122..99191:+
MDA_4890_9858 6.2e+3 12167 8859 3300 8 yes blast aaauggauuuuuggagcaggga ucuguucuuaucaguuuaaua ucuguucuuaucaguuuaauauaugauacguccucuauccgaggacaauauauuaaauggauuuuuggagcaggga NW_006286140.1:4122995..4123071:-
MDA_8166_18840 6.0e+3 11796 11790 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu NW_006289416.1:5424619..5424679:-
MDA_13743_32576 6.0e+3 11796 11790 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucaacugugcaauggauuugguccccuucaaccagcugu NW_006294993.1:1226053..1226113:-
MDA_7856_17785 4.9e+3 9761 9504 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccugucacaaaucacauugccagggauuucca NW_006289106.1:165285..165343:+
MDA_13748_32612 4.9e+3 9739 8507 0 1232 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua NW_006294998.1:1900260..1900318:+
MDA_8488_19456 4.9e+3 9678 9659 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucuuaaacaucuagcaaaucauuuuuuacucucca NW_006289738.1:8034..8095:+
MDA_11757_27245 4.8e+3 9572 7342 1 2229 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcacauagaauugucucacacagaaaucgcacccguc NW_006293007.1:1837171..1837236:+
MDA_5728_12575 4.6e+3 9114 8564 0 550 yes blast augcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcuuucugaaugcaaugcaccugggcaaggauucuga NW_006286978.1:852271..852333:+
MDA_6930_15490 4.6e+3 9048 8663 305 80 no blast guagucguggccgagugguuaag ccgacuacgcagccgagcuuuu guagucguggccgagugguuaaggcgauggacuugaaauccauuggggucuccccgcgcagguucgaauccugccgacuacgcagccgagcuuuu NW_006288180.1:211371..211466:-
MDA_14566_34372 4.4e+3 8739 8678 2 59 yes blast ugcacugaccuccagggagcag ugcccccugguggucagugcaca ugcacugaccuccagggagcagcuccugcguugagcaucugcccccugguggucagugcaca NW_006295816.1:7077675..7077737:+
MDA_7844_17759 4.3e+3 8562 3865 0 4697 yes blast agccacugcccaccgcacacug cugugcgugugacagcggcuga agccacugcccaccgcacacugcgcugcuccggacccacugugcgugugacagcggcuga NW_006289094.1:460980..461040:-
MDA_12449_28753 4.1e+3 8117 7173 0 944 yes blast uccgguucucagggcuccacc aggaagcccuggaggggcuggagg aggaagcccuggaggggcuggaggugauggauguguuccuccgguucucagggcuccacc NW_006293699.1:357112..357172:+
MDA_7365_16362 3.8e+3 7570 7377 133 60 no blast ucuggcuccgugucuucacuccc gagggagggacgggggcugugc ucuggcuccgugucuucacucccguguguguccgaggagggagggagggacgggggcugugc NW_006288615.1:7849155..7849217:+
MDA_13359_31385 3.8e+3 7553 6715 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau NW_006294609.1:261719..261779:-
MDA_2849_4495 3.7e+3 7442 7432 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugugggguagggauuuaaggccccaauagaagauaacuauacaacuuacuacuuuccc NW_006284099.1:27676..27757:-
MDA_13150_30821 3.7e+3 7366 6308 5 1053 yes blast gggacucuugugugaccuccgg gagaucacacacgagucccccu gagaucacacacgagucccccucucuccacccuggggggacucuugugugaccuccgg NW_006294400.1:5577993..5578051:+
MDA_1624_1988 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaauacauggauuggcugggagguggauguuuacuuc NW_006282874.1:1687764..1687824:+
MDA_1011_723 3.4e+3 6740 4484 0 2256 yes blast ucccccaggugugauucugauuug uuaucagaaucuccagggguac uuaucagaaucuccagggguacuuauaauuugaaaaagucccccaggugugauucugauuug NW_006282261.1:82199..82261:+
MDA_101766_49359 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucugaguaugauagcagucagugcacuacagaacuuugu NW_006383016.1:3233369..3233429:+
MDA_14975_35528 3.0e+3 5887 5074 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu NW_006296225.1:1139724..1139784:+
MDA_15155_35970 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa NW_006296405.1:649264..649326:+
MDA_11442_26435 2.6e+3 5161 5001 0 160 yes blast gucaacacuugcugguuuccucu gggagccaggaaguauugauguu gggagccaggaaguauugauguuucugccaguuuagcgucaacacuugcugguuuccucu NW_006292692.1:793052..793112:+
MDA_5728_12565 2.5e+3 5053 4100 0 953 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguugucaucuuaauuacccucccacacccaaggcuugca NW_006286978.1:845178..845237:+
MDA_4991_10262 2.5e+3 5044 4976 0 68 yes blast caagugcacgcgcuuugggac uucacaaagcccauacacuucac caagugcacgcgcuuugggacagugaaacaaaggauguucacaaagcccauacacuucac NW_006286241.1:539065..539125:-
MDA_13748_32613 2.3e+3 4710 4487 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug NW_006294998.1:1900399..1900462:+
MDA_8145_18382 2.2e+3 4457 4129 23 305 no blast acugccccaggugcugcuggg cgcauccccuagggcauuggugu cgcauccccuagggcauuggugugaagcuggagacccacugccccaggugcugcuggg NW_006289395.1:45495..45553:-
MDA_13302_31093 2.2e+3 4371 4370 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc NW_006294552.1:94007..94066:-
MDA_9757_22474 2.2e+3 4348 2799 0 1549 yes blast uaaugccccuaaaaauccuuau aagggacuuucaggggcagcugu aagggacuuucaggggcagcuguguuuucugacucaagucauaaugccccuaaaaauccuuau NW_006291007.1:2662756..2662819:-
MDA_18780_44290 2.0e+3 4045 4040 0 5 yes blast ugcccugaucgccccuuaggag cccugaggggcgaucgggg ugcccugaucgccccuuaggagcaggggaagguggagaagcccugaggggcgaucgggg NW_006300030.1:322970..323029:+
MDA_13359_31421 2.0e+3 4042 4040 0 2 yes blast ugcccugaucgccccuuaggag ccucagggacaaucagggccagc ugcccugaucgccccuuaggagcagcgggagguggagaagcccucagggacaaucagggccagc NW_006294609.1:2783286..2783350:-
MDA_10133_23498 1.9e+3 3889 3837 0 52 yes blast gucugaaccagagcacuuugaga ucaaguguucuaguucagaca gucugaaccagagcacuuugagaguggugcugaaugcucucaaguguucuaguucagaca NW_006291383.1:40284..40344:+
MDA_4063_8054 1.9e+3 3854 3570 0 284 yes blast cuccuggggcccgcacucuugc uggggagcggcccccgggcggg uggggagcggcccccgggcgggccucugcucuggccccuccuggggcccgcacucuugc NW_006285313.1:1504479..1504538:-
MDA_9757_22475 1.9e+3 3787 3266 0 521 yes blast ugggucuuugcgggcgagauga aacuggccuacaaagucccagu ugggucuuugcgggcgagaugagggugucgguucaacuggccuacaaagucccagu NW_006291007.1:2674840..2674896:-
MDA_17022_40121 1.8e+3 3725 2080 0 1645 no blast aguugguccgacgguugu guuauuguuaagcugauu aguugguccgacgguuguguguuauuguuaagcugauu NW_006298272.1:1979126..1979164:-
MDA_6209_13322 1.6e+3 3308 3293 1 14 yes blast uggcagucagacauccucugaca uuggaggauguccaccugcug uuggaggauguccaccugcuggcuuaggccuggucccugggggaucgggccuaagcuggcagucagacauccucugaca NW_006287459.1:19517..19596:-
MDA_9756_22388 1.6e+3 3242 3211 0 31 yes blast aauugcacgguauccaucugu cggguggaucacgaugcaauuuu cggguggaucacgaugcaauuuugauuaguauaauaggugaaaaauugcacgguauccaucugu NW_006291006.1:8957..9021:-
MDA_13528_32093 1.5e+3 3118 3102 0 16 yes blast uagaaacguccagaggcaccgga cgggucccugugacguucccaga cgggucccugugacguucccagaagauucaugcugacaccuagaaacguccagaggcaccgga NW_006294778.1:1074712..1074775:+
MDA_15163_36118 1.5e+3 3034 3030 3 1 yes blast ugaccuaugaauugacagccagu ggcugccaauugcauaggu ugaccuaugaauugacagccagugaucuugucuccccucuggcugccaauugcauaggu NW_006296413.1:4092735..4092794:+
MDA_15559_37345 1.4e+3 2799 2416 1 382 yes blast uaacacugucugguaacgauguu caucuuaccggacagugcugga caucuuaccggacagugcuggauuucucggcucgacucuaacacugucugguaacgauguu NW_006296809.1:258233..258294:+
MDA_14971_35349 1.3e+3 2626 2624 0 2 yes blast agccgugaucgccccucaggag ccugaggggcgaucagggc agccgugaucgccccucaggagcagggagaaguggagaagcccugaggggcgaucagggc NW_006296221.1:860648..860708:-
MDA_13838_32987 1.2e+3 2379 2353 0 26 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggc acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggc NW_006295088.1:6913..6969:-
MDA_11817_27357 1.2e+3 2379 2353 0 26 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggc acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggc NW_006293067.1:747071..747127:-
MDA_12450_28855 1.2e+3 2379 2353 0 26 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggc acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggc NW_006293700.1:3037678..3037734:+
MDA_6297_13664 1.2e+3 2379 2353 0 26 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggc acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggc NW_006287547.1:3628016..3628072:+
MDA_18140_42163 1.2e+3 2378 2357 0 21 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuaua uugggcuuacuccucacagguggcaggacaccaugaccuuccugugacauuacgcccuaua NW_006299390.1:4129756..4129817:-
MDA_13748_32618 1.1e+3 2160 2151 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguagugguuaguuaucuacugcauuaugagcacuuaaagu NW_006294998.1:1900708..1900767:+
MDA_101763_49094 1.0e+3 2117 2115 1 1 yes blast agcuggcagguagacauccccc aggguugucugacugccagca aggguugucugacugccagcaguggcucgauccucuggggagcgggccuaagcuggcagguagacauccccc NW_006383013.1:5407059..5407131:-
MDA_8784_20583 1.0e+3 2074 2072 0 2 no blast uguguccuccugugcccucugcagg uugucggagggaaggcggacgugg uugucggagggaaggcggacgugggauaacccugugacuuguguccuccugugcccucugcagg NW_006290034.1:10662291..10662355:+
MDA_12449_28749 1.0e+3 2015 1718 0 297 no blast ggcuccccagcgcugccucucu aggggccacacucgggugacc aggggccacacucgggugaccuuggguguuuaguacgaaggcuccccagcgcugccucucu NW_006293699.1:247788..247849:+
MDA_9196_21277 9.6e+2 1894 1872 0 22 yes blast uugagggaugucugacugcugg ggcagucagacaucccucucac uugagggaugucugacugcugguuuaggccugaucccaaaauuugcacauuaccucuuuauuauaacuggcagucagacaucccucucac NW_006290446.1:47150..47240:-
MDA_10844_24978 9.4e+2 1849 1848 0 1 yes blast cuuggcaccuaguaagcacuca agugccugcugugugccaggcau cuuggcaccuaguaagcacucagucaauacuuguugagugccugcugugugccaggcau NW_006292094.1:3781067..3781126:+
MDA_7111_15876 9.4e+2 1846 1183 0 663 yes blast uugaucagcauugccucucccu agagaggcagggucugauccaca agagaggcagggucugauccacagccucaguggcaguuguugaucagcauugccucucccu NW_006288361.1:913813..913874:-
MDA_6215_13538 9.4e+2 1839 1729 0 110 yes blast ucaggcuuggacaggggacc uccccugcccaggccugaca uccccugcccaggccugacaccuccgccagaggugucaggcuuggacaggggacc NW_006287465.1:110378..110433:-
MDA_9273_21356 9.1e+2 1796 1794 0 2 no blast aagguuauagaaauuucagacaguc acauuuuggaaugguuugaggccuug acauuuuggaaugguuugaggccuugcccugcugcuucuggagcaagguuauagaaauuucagacaguc NW_006290523.1:382883..382952:-
MDA_18013_41868 8.9e+2 1767 1760 0 7 no blast uacgucaucguugucaucauua guggugacgccgauggugcgagc guggugacgccgauggugcgagcuggaaauggggugcuacgucaucguugucaucauua NW_006299263.1:2355920..2355979:-
MDA_15029_35673 8.6e+2 1690 1625 0 65 yes blast aggccagcagucggacaucccc gauguccgacugccagcuuagg gauguccgacugccagcuuaggcagggagcagaccuaggccagcagucggacaucccc NW_006296279.1:1234935..1234993:+
MDA_10715_24773 8.5e+2 rRNA 1692 1034 656 2 no blast ccugguuaguacuuggaug gucuauggccauaccacccu gucuauggccauaccacccugaacacgcccgaucucaucugaucucggaagcuaagcagggucaggccugguuaguacuuggaug NW_006291965.1:5058600..5058685:-
MDA_6421_13864 8.4e+2 1658 1560 0 98 yes blast ucaggggaugucugacugccaga accggcagucggacaucccucu ucaggggaugucugacugccagaugucccugggaucaggccuaaaccggcagucggacaucccucu NW_006287671.1:1914549..1914615:+
MDA_6122_13153 8.3e+2 1644 1560 0 84 yes blast ucaggggaugucugacugccaga accggcagucggacaucccucu ucaggggaugucugacugccagaugucccugggaucaggccuaaaccggcagucggacaucccucu NW_006287372.1:810291..810357:+
MDA_101761_48819 8.3e+2 1625 1474 0 151 yes blast uggccccaauugccccucaggag ccugaggggugauuggggccg uggccccaauugccccucaggagcaggggaagauggagaaguccugaggggugauuggggccg NW_006383011.1:14639369..14639432:-
MDA_9210_21308 8.0e+2 1572 1565 6 1 yes blast ucaggggaugucugacugccaga cagcagucagauaucccucu ucaggggaugucugacugccagaggcccaaccccaaagggaucccugugggaucgggccuaaaccagcagucagauaucccucu NW_006290460.1:444221..444305:+
MDA_12280_28493 7.8e+2 1537 1530 1 6 yes blast ucaggcuuggacaggggaccccu ugacccccgcccaggccug ucaggcuuggacaggggaccccuaucucuccccgaucacuggcucugacccccgcccaggccug NW_006293530.1:389035..389099:-
MDA_12866_30239 7.8e+2 1537 1530 1 6 yes blast ucaggcuuggacaggggaccccu ugacccccgcccaggccug ucaggcuuggacaggggaccccuaucucuccccgaucacuggcucugacccccgcccaggccug NW_006294116.1:866794..866858:-
MDA_8774_20147 7.8e+2 1534 1520 8 6 yes blast ucaggcuuggacaggggaccccu ugacccccgcccaggccug ucaggcuuggacaggggaccccugucuccccccgaucacuggcucugacccccgcccaggccug NW_006290024.1:198501..198565:-
MDA_13618_32277 7.6e+2 1501 1497 0 4 no blast agcuggcagguggacaacccc gggguccuggacugcuagagggcac agcuggcagguggacaaccccugagggguccuggacugcuagagggcac NW_006294868.1:147529..147578:-
MDA_17374_40683 7.5e+2 1484 1469 0 15 yes blast uggccccaauugccccucaggag cucaggggugaucggggccagc uggccccaauugccccucaggagcuggagaagcccucaggggugaucggggccagc NW_006298624.1:122054..122110:+
MDA_3588_6154 7.5e+2 1479 1474 1 4 yes blast uggccccaauugccccucaggag ccugaggggugaucggggcca uggccccaauugccccucaggagcagggggagguggagaagcccugaggggugaucggggcca NW_006284838.1:697231..697294:+
MDA_9381_21600 7.5e+2 1479 1354 0 125 yes blast cccccgguggucagugugcuu cgcacugaccaccagggggc cgcacugaccaccagggggcagacacuugacgcaggagcugccccccgguggucagugugcuu NW_006290631.1:2443153..2443216:-
MDA_13433_31832 7.5e+2 1475 1474 0 1 yes blast uggccccaauugccccucaggag ccugaggggcaauugggg uggccccaauugccccucaggagcagggggaaguggagaagcccugaggggcaauugggg NW_006294683.1:17022..17082:+
MDA_8089_18033 7.4e+2 1467 1327 0 140 yes blast cccccgguggucagugugcuu cgcacugaccaccagggggc cgcacugaccaccagggggcagauguucaacacaggagcuucccccgguggucagugugcuu NW_006289339.1:221583..221645:+
MDA_6660_14495 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu NW_006287910.1:565564..565623:+
MDA_18140_42194 7.2e+2 1421 1252 0 169 yes blast ucgccaaccuuucggaccucac gcggaccaucgguuggcgacu ucgccaaccuuucggaccucacagacccccaguggucugcggaccaucgguuggcgacu NW_006299390.1:7187546..7187605:-
MDA_14846_35283 7.2e+2 1416 1411 0 5 yes blast aagcuggcagucggacauccuc uaugucugacugccggcuuaga uaugucugacugccggcuuagacccguucccuaagcuggcagucggacauccuc NW_006296096.1:964848..964902:+
MDA_11660_26854 7.2e+2 1417 1404 12 1 yes blast cccccgguggucagugugcuu ugcacugaccgccagga ugcacugaccgccaggaggcagacacucaaugcaggagcugcccccgguggucagugugcuu NW_006292910.1:176718..176780:-
MDA_15034_35814 6.4e+2 1268 1198 0 70 yes blast cagcagacggacaucccccgagg gagagggaugucugacugcc gagagggaugucugacugccgguuuaggcccgauccgggauugggccuaaaccagcagacggacaucccccgagg NW_006296284.1:2152322..2152397:-
MDA_101760_48328 6.3e+2 1258 1172 0 86 yes blast uugggcuuacuccucacgggugg uccugugacauuacgcccuauaca uugggcuuacuccucacggguggcagaauacuauggccuuccugugacauuacgcccuauaca NW_006383010.1:8882335..8882398:+
MDA_7365_16254 6.3e+2 1258 1172 0 86 no blast uugggcuuacuccucacgggugg uccugugacauuacgcccuauaca uugggcuuacuccucacggguggcagaauacuauggccuuccugugacauuacgcccuauaca NW_006288615.1:327634..327697:+
MDA_18465_43544 6.2e+2 1227 1172 0 55 yes blast uugggcuuacuccucacgggugg uccugugacauuacgcccuauaca uugggcuuacuccucacggguggcagaauacuauggccuccugugacauuacgcccuauaca NW_006299715.1:4741860..4741922:+
MDA_17016_40028 6.1e+2 1206 1204 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucuggaagguacaguacugugauaacugaa NW_006298266.1:260592..260649:-
MDA_7008_15777 6.1e+2 1209 1172 0 37 yes blast uugggcuuacuccucacgggugg uccugugacauuacgcccuauaca uugggcuuacuccucacggguggcagaauacuauggccuuccugugacauuacgcccuauaca NW_006288258.1:430415..430478:-
MDA_16323_38782 6.0e+2 1192 1191 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa NW_006297573.1:3104349..3104406:-
MDA_11751_27083 6.0e+2 1190 1183 0 7 yes blast ucaggcuuggacaggggacc ucccugcccaggccugaggccu ucaggcuuggacaggggacccacaucucucccgaaucacuggcucuggucccugcccaggccugaggccu NW_006293001.1:390753..390823:-
MDA_12530_29290 5.9e+2 1171 1060 0 111 no blast auggauuuuuggagcaggga uccacuccacgcaucgacc auggauuuuuggagcagggaggugcacuaagagcuugcuccacuccacgcaucgacc NW_006293780.1:323319..323376:+
MDA_10000_23433 5.8e+2 1139 487 0 652 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg NW_006291250.1:121614..121678:-
MDA_101761_48639 5.7e+2 1127 1050 0 77 yes blast cacuggggugccuggccagccu cuggccaagccccccagcgga cacuggggugccuggccagccugggugaggggcugauggcagauugcaggcuggccaagccccccagcgga NW_006383011.1:19794753..19794824:+
MDA_101756_47800 5.6e+2 1110 1098 0 12 yes blast ucaggcuuggacaggggacc cuugcccaggccugaugccu cuugcccaggccugaugccuccgcccgaggugucaggcuuggacaggggacc NW_006383006.1:6883898..6883950:-
MDA_954_636 5.6e+2 1110 1102 3 5 yes blast cacuggggugccuggccagccu agcuggucacacacccuucaggguagggguc cacuggggugccuggccagccuuggugaggggaugauggcuguuuacagcuggucacacacccuucaggguagggguc NW_006282204.1:919109..919187:+
MDA_11980_27619 5.6e+2 1104 1031 3 70 yes blast cacuggggugccuggccagccu gcuggccacgccccccagca cacuggggugccuggccagccugggugagggguugagggcuguuuucaggcuggccacgccccccagca NW_006293230.1:66852..66921:+
MDA_13359_31388 5.5e+2 1085 921 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu NW_006294609.1:298386..298442:-
MDA_936_494 5.3e+2 1055 1054 0 1 yes blast ucaggcuuggacaggggacc cccccgcccaggccugaggccuc ucaggcuuggacaggggacccucaucuccccccaucacuggcucagacccccgcccaggccugaggccuc NW_006282186.1:236647..236717:+
MDA_7837_17556 4.9e+2 973 972 0 1 yes blast uguaacagcaacuccaugugga ccaguggagaugcuguuacuu uguaacagcaacuccauguggacuguguaccaauuuccaguggagaugcuguuacuu NW_006289087.1:3833437..3833494:+
MDA_8148_18582 4.9e+2 958 822 0 136 yes blast uaagccagcagucggacaucc gaugucugacugccagcuuagg gaugucugacugccagcuuaggccugcucccuacagagggccuaagccagcagucggacaucc NW_006289398.1:5981933..5981996:-
MDA_3093_5198 4.8e+2 948 884 0 64 yes blast uaagccagcagucggacaucc gauguccgacugcuggcuuagg gauguccgacugcuggcuuaggcccgauccccagggaaucgggccuaagccagcagucggacaucc NW_006284343.1:1022752..1022818:-
MDA_13334_31112 4.6e+2 907 894 0 13 yes blast ugucaggcuuggacaggggacu cuugcccaggccugaugccu cuugcccaggccugaugccuccgccagaggugucaggcuuggacaggggacu NW_006294584.1:164109..164161:-
MDA_12703_29746 4.5e+2 899 894 0 5 yes blast ugucaggcuuggacaggggacu ccccuugcccagaccugacgccu ccccuugcccagaccugacgccugcgccagaggugucaggcuuggacaggggacu NW_006293953.1:790403..790458:-
MDA_16560_39254 4.5e+2 897 889 0 8 yes blast ugcccugaucgccccucagcag ccugaggggcgaucagggccgg ugcccugaucgccccucagcagcagggggagguagaguagcccugaggggcgaucagggccgg NW_006297810.1:182555..182618:+
MDA_13932_33158 4.5e+2 897 894 0 3 yes blast ugucaggcuuggacaggggacu gccccugcccaggccugaggccu ugucaggcuuggacaggggacucccaucuccccucaaucaauggcucuggccccugcccaggccugaggccu NW_006295182.1:207959..208031:+
MDA_101763_48991 4.5e+2 895 894 0 1 yes blast ugucaggcuuggacaggggacu gccccuugccaggccug gccccuugccaggccugacgccuccgcagaggugucaggcuuggacaggggacu NW_006383013.1:3744378..3744432:+
MDA_19125_46169 4.4e+2 886 627 0 259 no blast cucagucggacauccccuga gagagggaugucugacugccagu gagagggaugucugacugccaguuuaaauccucagucggacauccccuga NW_006300375.1:6502360..6502410:+
MDA_6294_13585 4.4e+2 859 855 2 2 yes blast ucaggcuuggacaggggacc gcccccgcccaggccug ucaggcuuggacaggggacccccaagucccccaaucacugacucuggcccccgcccaggccug NW_006287544.1:274286..274349:-
MDA_18140_42121 4.3e+2 853 844 0 9 yes blast ucugcccccugguugucaaugc cauacugaccaccagggggcacc cauacugaccaccagggggcacccccuguauugggcaucugcccccugguugucaaugc NW_006299390.1:6187065..6187124:+
MDA_15163_36116 4.1e+2 819 767 0 52 yes blast uguaacagcaacuccaugugga ccaguggggcugcuguuaucugg uguaacagcaacuccauguggaagugcccacucguuccaguggggcugcuguuaucugg NW_006296413.1:4092535..4092594:+
MDA_6441_13975 4.1e+2 813 801 0 12 yes blast ucaggcuuggacaggggacc cuugcccaggccugaugccu cuugcccaggccugaugccuccgccagagguaucaggcuuggacaggggacc NW_006287691.1:49001..49053:+
MDA_3698_6605 3.9e+2 784 783 0 1 no blast cucggcgcugucagcgggugc gcccgugauggucccucuc gcccgugauggucccucucauaccugcugcuggcacccucggcgccagucccaauugcucggcgcugucagcgggugc NW_006284948.1:23237..23315:+
MDA_2744_4383 3.8e+2 764 468 0 296 no blast ccccgguccgacggagcacuuc aagggcuguuuugguaccggaga ccccgguccgacggagcacuucagugaaugggaauagaagggcuguuuugguaccggaga NW_006283994.1:1281778..1281838:-
MDA_2338_3395 3.7e+2 741 591 0 150 yes blast cuaagcuggcagguggacaucc gaugucugacugccagcuuagg gaugucugacugccagcuuaggccuuauccccuggggagcaggccuaagcuggcagguggacaucc NW_006283588.1:1787217..1787283:-
MDA_18798_44852 3.7e+2 723 719 0 4 yes blast cucggcgcugucagcgggugu acccgcugccagugcccagc acccgcugccagugcccagcgccagccccaaucacucggcgcugucagcgggugu NW_006300048.1:5840872..5840927:-
MDA_101767_49641 3.5e+2 686 663 0 23 yes blast agagaggcagggucugaucca ugaucagcuguugccucucccu agagaggcagggucugauccacagcgucuuuggcagcuguugaucagcuguugccucucccu NW_006383017.1:995676..995738:+
MDA_4230_8117 3.4e+2 688 685 0 3 no blast gacuccaagguccgcggcugcu uggccgcugccccugggaugcc uggccgcugccccugggaugcccauugcaauucgggacuccaagguccgcggcugcu NW_006285480.1:543201..543258:+
MDA_18782_44425 3.4e+2 669 665 0 4 yes blast acucacacucacugcuggcac accaucagugggugugagcgg acucacacucacugcuggcaccagccccaauugcucugcaccaucagugggugugagcgg NW_006300032.1:1274748..1274808:-
MDA_6209_13330 3.3e+2 659 656 2 1 yes blast ugccucugguggucagugcacu ugcacugaccaucagggg ugcacugaccaucaggggcagaugcucaaugcaggagcugccucugguggucagugcacu NW_006287459.1:625151..625211:-
MDA_12699_29622 3.3e+2 654 375 0 279 yes blast uggcaguuggacauccccugagu gagagggauguccgacugcca gagagggauguccgacugccaggaucaggccuuaacuggcaguuggacauccccugagu NW_006293949.1:12828..12887:-
MDA_2389_3686 3.2e+2 642 639 0 3 yes blast gagagggauguccgacugccaga uggcaguccgacaucccc gagagggauguccgacugccagauuaggcccaaucacacagggauugggucuaaacuggcaguccgacaucccc NW_006283639.1:433898..433972:+
MDA_8464_19355 3.2e+2 631 630 0 1 yes blast gagagggauguccgacugccaga uggcagucagacaucaccuga gagagggauguccgacugccagaugucugacugcagggacugggccuaaacuggcagucagacaucaccuga NW_006289714.1:1393155..1393227:-
MDA_13359_31364 3.1e+2 622 618 1 3 yes blast ugcacuaaccaccaggcggcagc ugcccccuaguggucagugc ugcacuaaccaccaggcggcagcuccugcauggagcgucugcccccuaguggucagugc NW_006294609.1:5317055..5317114:+
MDA_8320_19098 3.1e+2 627 517 0 110 no blast uccacacccggcuggcugcgg gacagacagcaggugugugggcu gacagacagcaggugugugggcugcaaguauauuugguccacacccggcuggcugcgg NW_006289570.1:3722947..3723005:-
MDA_10300_24163 3.1e+2 616 571 0 45 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagaag augcugacauauuuacuagaagggugaaauuaauagccuucuaguaagaguggcaguugaag NW_006291550.1:132888..132950:+
MDA_15377_37113 3.0e+2 597 527 0 70 yes blast auguucgccugccagcuuagg uaagcuggcaggcagacauccc auguucgccugccagcuuagggccacagggaacugggccuaagcuggcaggcagacauccc NW_006296627.1:5019921..5019982:-
MDA_9784_22957 3.0e+2 599 594 0 5 no blast uguucccgacgucgguucccuu aggagccgcucgccgggagc aggagccgcucgccgggagcggugcaguuccuguugcuguucccgacgucgguucccuu NW_006291034.1:79146..79205:+
MDA_18798_44704 2.9e+2 580 490 0 90 yes blast cuaagcuggcagguggacaucc augucugacuaccagcuuagg augucugacuaccagcuuaggauugaucccccagggagcgggacuaagcuggcagguggacaucc NW_006300048.1:42674..42739:+
MDA_18467_43716 2.9e+2 577 450 0 127 yes blast gagagggauguccgacugcca agcagucggacaucccucgagg gagagggauguccgacugccaguuuaggcccgauccggaucagcggcaucaggccuaaaccagcagucggacaucccucgagg NW_006299717.1:1473336..1473419:-
MDA_6071_13037 2.9e+2 572 555 0 17 yes blast ugggggauguccaccuguuggc gcuggcagucagacaucccucuggcag ugggggauguccaccuguuggcuuaggcccgcucccugggggauugggccuaugcuggcagucagacaucccucuggcag NW_006287321.1:330417..330497:-
MDA_4118_8098 2.9e+2 572 555 0 17 yes blast ugggggauguccaccuguuggc gcuggcagucagacaucccucuggcag ugggggauguccaccuguuggcuuaggccugcucccugggagaucaggccuuagcuggcagucagacaucccucuggcag NW_006285368.1:35016..35096:+
MDA_10637_24682 2.8e+2 556 534 0 22 yes blast cuaggcuggcagguggacaucc gauauccgacugccagcuuagg gauauccgacugccagcuuaggcccaaucgccguggggcgugggccuaggcuggcagguggacaucc NW_006291887.1:88..155:-
MDA_953_605 2.8e+2 550 534 0 16 yes blast uguggccucuggguguguacccu aguguacuuccuugggcuucu aguguacuuccuugggcuucugggcauauaauuccuguggccucuggguguguacccu NW_006282203.1:210496..210554:+
MDA_15167_36244 2.7e+2 545 544 0 1 yes blast uucccuuugucauccuuugccuc gcagggacggcaaaggggugc uucccuuugucauccuuugccucgggcucggagcggggcagggacggcaaaggggugc NW_006296417.1:434868..434926:+
MDA_5728_12578 2.7e+2 547 536 0 11 yes blast uacccauugcauaucggaguug accuccugugugcauggauuaca uacccauugcauaucggaguuguaaauucucaaagcaccuccugugugcauggauuaca NW_006286978.1:854330..854389:+
MDA_10845_25182 2.7e+2 540 467 0 73 yes blast uugggggaugucugacugcugga uggcagucggacaucccucuca uugggggaugucugacugcuggaugacugacuaucuggcagucggacaucccucuca NW_006292095.1:5380547..5380604:+
MDA_10133_23509 2.7e+2 539 457 0 82 yes blast agaaacagaauuuccggaggau uccuccggaaauucuguuucuu uccuccggaaauucuguuucuuuguuauggggugaggccacaacauuaguuacaaagaaacagaauuuccggaggau NW_006291383.1:2321122..2321199:+
MDA_9432_22101 2.7e+2 538 453 0 85 yes blast uaagccagcagucggacaucc gauguccgacugcuggcuuagg gauguccgacugcuggcuuaggcagcaguggagggggagugggccuaagccagcagucggacaucc NW_006290682.1:2006989..2007055:-
MDA_10478_24442 2.7e+2 536 522 0 14 yes blast caggggaugucugacugccag uggcagucagacaucccucuc caggggaugucugacugccaguacgggauugggccuaaacuggcagucagacaucccucuc NW_006291728.1:534394..534455:+
MDA_18137_41996 2.7e+2 531 521 0 10 yes blast caggggaugucugacugccag uggcagucagacaucccucuugca caggggaugucugacugccaguauaggcccaaucccucagggauuccugcaggaucagccuaaacuggcagucagacaucccucuugca NW_006299387.1:44294..44383:+
MDA_5568_12183 2.7e+2 541 348 0 193 no blast augcacacugaccaccagggac ugugugugugugugugugugu uguguguguguguguguguguaugacuaagcaacuguuacgacgaaaugaccggucacuauuaugcacacugaccaccagggac NW_006286818.1:47219..47303:+
MDA_10637_24681 2.7e+2 536 534 1 1 no blast cuaggcuggcagguggacaucc ggcaccggccaggcugag cuaggcuggcagguggacauccugcgagggguccuggacugugagagggcaccggccaggcugag NW_006291887.1:45..110:-
MDA_16323_38666 2.7e+2 527 522 0 5 yes blast cacugaccaccaggaugcagcu ugcccccugcuggucagugcg cacugaccaccaggaugcagcuccugcguugagcaucugcccccugcuggucagugcg NW_006297573.1:380077..380135:+
MDA_18786_44590 2.4e+2 486 416 0 70 yes blast uggcaguaggacauccccugaga gagagggaugucugacugcc gagagggaugucugacugccgguuuaggcccauuccacagggauggguccuaaacuggcaguaggacauccccugaga NW_006300036.1:3994080..3994158:-
MDA_8781_20358 2.4e+2 480 404 0 76 yes blast caggggaugucugacugccag cagcagucggacaucccucuc caggggaugucugacugccaguuuaggccugauccccccuaaaccagcagucggacaucccucuc NW_006290031.1:4524282..4524347:-
MDA_6665_14687 2.4e+2 478 468 0 10 yes blast cauaggucagggcaugugcagga ugcacaugcccugaccaggaa ugcacaugcccugaccaggaauugaaccaugaccucauaggucagggcaugugcagga NW_006287915.1:4678328..4678386:+
MDA_13748_32653 2.4e+2 470 394 0 76 yes blast uggcaguaggacauccccugagg gagagggauguccgacugcc gagagggauguccgacugcccauagggauugagccuaaacuggcaguaggacauccccugagg NW_006294998.1:4275192..4275255:+
MDA_18229_42365 2.3e+2 466 460 0 6 yes blast uacggccaagcacccgcagggc cggcggguuuguuggcuuugcgu cggcggguuuguuggcuuugcguuuucaaccuuugcguacggccaagcacccgcagggc NW_006299479.1:351729..351788:+
MDA_2104_2632 2.3e+2 460 245 0 215 yes blast caggaaucaaaccugcaacccu guuugcagguucgauucugguc caggaaucaaaccugcaacccuucggugagugggcagguuugcagguucgauucugguc NW_006283354.1:1601530..1601589:-
MDA_15902_38138 2.3e+2 460 459 0 1 yes blast uaagccagcagucggacaucc auguccaacugccagcu auguccaacugccagcuaagggaccuaagccagcagucggacaucc NW_006297152.1:519334..519380:-
MDA_18465_43572 2.2e+2 445 414 11 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugcuugccaggucugaggaaaacaugguuccgucaagcacca NW_006299715.1:6748757..6748819:+
MDA_936_498 2.2e+2 441 381 4 56 yes blast gcugguuucauauggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu NW_006282186.1:738244..738308:+
MDA_5428_11896 2.2e+2 438 433 0 5 yes blast agggaugucugacugcuggcu gccggcacguggacauccc agggaugucugacugcuggcuuagaacugcuccccaugggaagcaggccuaugccggcacguggacauccc NW_006286678.1:6274199..6274270:+
MDA_8569_19849 2.1e+2 423 262 0 161 yes blast gccgacaggcgggcaggaccagg uggccugcccgccagucggg uggccugcccgccagucgggcucugcugucuauuguuugggccgacaggcgggcaggaccagg NW_006289819.1:2912837..2912900:+
MDA_12282_28522 2.1e+2 423 318 0 105 yes blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua NW_006293532.1:1865453..1865511:+
MDA_5728_12568 2.0e+2 407 382 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca NW_006286978.1:845565..845625:+
MDA_4996_10529 2.0e+2 405 401 0 4 yes blast agggaugucugacugcuggcu cagcaggcggacaucccccaag agggaugucugacugcuggcuuacaucagauagggcucuccuguggggagcgagccuaagccagcaggcggacaucccccaag NW_006286246.1:487250..487333:-
MDA_101755_47502 2.0e+2 401 372 0 29 yes blast ucuacagugcacgugucuccagu ggagacgcggcccuguuggagu ucuacagugcacgugucuccaguguggcucggaggcuggagacgcggcccuguuggagu NW_006383005.1:2555975..2556034:+
MDA_3594_6410 1.9e+2 389 353 0 36 yes blast gaugcucagauuggcgaccacu ugguggcagaccugagugcugg gaugcucagauuggcgaccacugucagggugagcaagugguggcagaccugagugcugg NW_006284844.1:882615..882674:-
MDA_1131_907 1.9e+2 389 288 6 95 yes blast ccuugacacaaggguuugu ugcuucugggucgggguu ugcuucugggucgggguuucauagauagcagagcaggcugccucgcugcgaucuauuaaaaggcagcccuugacacaaggguuugu NW_006282381.1:1274663..1274749:+
MDA_8148_18593 1.9e+2 381 380 0 1 yes blast uggcaguguauuguuagcuggu cagcuaacaugcaacugcuaccu uggcaguguauuguuagcuggucgguguguggaugacaucagcuaacaugcaacugcuaccu NW_006289398.1:6948838..6948900:-
MDA_13743_32545 1.9e+2 375 365 0 10 yes blast aucucagguucgucagcccgug aggacugaccaaccugagaaug aggacugaccaaccugagaauggugucuccaggucaaucucagguucgucagcccgug NW_006294993.1:278019..278077:+
MDA_14975_35542 1.9e+2 374 199 0 175 yes blast ucuggccaagccccccagcgg ugcuggggugccuggccaguc ugcuggggugccuggccagucugggggagugacugauggcuguuugcagucuggccaagccccccagcgg NW_006296225.1:598869..598939:-
MDA_3998_7699 1.9e+2 371 357 0 14 yes blast ugcccccugguggucagugcgu cacacugaccaccaggaggca cacacugaccaccaggaggcagcuccugcauugagugucugcccccugguggucagugcgu NW_006285248.1:1200409..1200470:+
MDA_7837_17558 1.9e+2 371 312 0 59 yes blast augaccuaugaauugacagaca ucugucauuucuguaggccaau augaccuaugaauugacagacaguguggcuaagugugucugucauuucuguaggccaau NW_006289087.1:3833697..3833756:+
MDA_18465_43575 1.8e+2 367 257 0 110 yes blast gagagggaugucugacugccagu ccagcaguuggacauccccugu gagagggaugucugacugccaguuuacauguucuguggaauugggccuaaaccagcaguuggacauccccugu NW_006299715.1:7567170..7567243:+
MDA_5342_11358 1.8e+2 358 319 0 39 yes blast cagcagucagacaucccucucaaa ucggaggaugucugacugccaguu ucggaggaugucugacugccaguuuaggcccgaucccaaaaccagcagucagacaucccucucaaa NW_006286592.1:535303..535369:-
MDA_4549_9203 1.8e+2 350 132 0 218 yes blast gaugucugacugccagcuuagg cugagcuggcagguggacauc gaugucugacugccagcuuaggccugauccccuggggagugggccugagcuggcagguggacauc NW_006285799.1:1197337..1197402:+
MDA_4755_9744 1.8e+2 350 266 0 84 yes blast gagagggaugucugacugccagu cggcagucggacauccccugagu gagagggaugucugacugccaguuuaggcccaaugccggcagucggacauccccugagu NW_006286005.1:19983..20042:-
MDA_9981_23376 1.7e+2 347 335 0 12 yes blast ugcccccugguggucagugcgu cacacugaccaccaggaggca cacacugaccaccaggaggcaggcgcucaaugcaagaguugcccccugguggucagugcgu NW_006291231.1:3141683..3141744:-
MDA_18343_42741 1.7e+2 343 311 0 32 yes blast uaagccagcagucggacaccc auguccaacugccggcuuagg auguccaacugccggcuuaggcaugcccuguggggagcgggccuaagccagcagucggacaccc NW_006299593.1:1286774..1286838:+
MDA_11838_27446 1.7e+2 343 339 3 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugagucauaaugaaggaagcaaucagcaaguauacugcccu NW_006293088.1:7269601..7269666:+
MDA_14566_34378 1.7e+2 336 331 0 5 yes blast gccaaccuuucggaccucacggau ucugcggaccaccgguuggcg gccaaccuuucggaccucacggaucaugacuggucugcggaccaccgguuggcg NW_006295816.1:7850558..7850612:+
MDA_2995_4781 1.7e+2 334 209 0 125 yes blast cgccaucagcaggugcgagugg acuuguacccacugcuggcac acuuguacccacugcuggcacugacuccaguugcucugcgccaucagcaggugcgagugg NW_006284245.1:820975..821035:-
MDA_11753_27213 1.6e+2 330 329 0 1 yes blast cgggggaugucugacugccagga ccgguagucggacaucccucu cgggggaugucugacugccaggauagggccuaaaccgguagucggacaucccucu NW_006293003.1:1881442..1881497:-
MDA_8148_18576 1.6e+2 324 319 0 5 yes blast cagcagucagacaucccucucaaa ccuuggggaaugucugacugcc ccuuggggaaugucugacugccgguuuaggccaaggaucaggccuaaaccagcagucagacaucccucucaaa NW_006289398.1:5674641..5674714:-
MDA_4535_8848 1.6e+2 323 313 5 5 yes blast ugcccccugguggucagugcgu cacugaucaccaugggguagcu cacugaucaccaugggguagcuccuguguugagugccugcccccugguggucagugcgu NW_006285785.1:686424..686483:-
MDA_11084_25520 1.6e+2 313 307 0 6 yes blast uccccugcccaggucugacg ucaggccugggcugggg ucaggccugggcugggggcagaaccagugauagggggaaaugaggguccccugcccaggucugacg NW_006292334.1:2261832..2261898:-
MDA_3613_6478 1.5e+2 308 290 0 18 yes blast ccuaagccggcagucagacauc uguccaccugcuggcuuaggucu uguccaccugcuggcuuaggucugggagugggccuaagccggcagucagacauc NW_006284863.1:31770..31824:+
MDA_5025_10686 1.5e+2 306 286 0 20 yes blast uaagcuggcagucggacaucc gauguccaccugccggcuuagu gauguccaccugccggcuuaguccugcucccugggggagcaggccuaagcuggcagucggacaucc NW_006286275.1:708663..708729:+
MDA_16586_39781 1.5e+2 316 238 0 78 no blast caggcuaggggagaugaccggau uucacuuaccucccagccuaca caggcuaggggagaugaccggauagaaaacguuguucuauucacuuaccucccagccuaca NW_006297836.1:189344..189405:+
MDA_4996_10557 1.5e+2 305 63 0 242 yes blast uuagaccauugucaauugagaug ucucuucugcaugcauggucuaga uuagaccauugucaauugagauggaguaaccauuucaucucuucugcaugcauggucuaga NW_006286246.1:3585886..3585947:-
MDA_17995_41566 1.5e+2 297 290 2 5 yes blast cuugcaccugcugauggcgcug ugccagcagugggugugagc cuugcaccugcugauggcgcugagcgauuggggcucgcagugggugugagcggcggcuccagugccagcagugggugugagc NW_006299245.1:5930357..5930439:+
MDA_11982_27712 1.5e+2 298 288 0 10 yes blast cuaauaugcuaauggucggga cagaccauuagcauauuagcu cuaauaugcuaauggucgggacgccauaacguguaugaccagaccauuagcauauuagcu NW_006293232.1:2421199..2421259:+
MDA_4890_9776 1.4e+2 290 286 0 4 yes blast cuugcaccugcugauggcgcug caccagcagugggugcaagcagc cuugcaccugcugauggcgcugagcaauuuggaccagagccaggcaccagcagugggugcaagcagc NW_006286140.1:1234654..1234721:+
MDA_8469_19445 1.4e+2 288 284 0 4 yes blast cuugcaccugcugauggcgcug caccagcagugggugcaagcagc cuugcaccugcugauggcgcugagcaauugggaccagagccaggcaccagcagugggugcaagcagc NW_006289719.1:150082..150149:-
MDA_14308_33811 1.4e+2 285 279 0 6 yes blast cacucccacccacugacugugc accagcagcaggugggagc cacucccacccacugacugugcagagcaaaugcuggcaccagcagcaggugggagc NW_006295558.1:207728..207784:-
MDA_15549_37281 1.4e+2 290 289 0 1 no blast ggcagcacccagcaggaccug ggccugcuggaugguggu ggccugcuggauggugguggcagugaccgaggagcauauaaucggcgccccaaggcagcacccagcaggaccug NW_006296799.1:403398..403472:+
MDA_15154_35955 1.4e+2 280 119 0 161 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguaugugaugggguuggcgu NW_006296404.1:433877..433924:+
MDA_16561_39365 1.4e+2 277 241 1 35 yes blast cacuggggugccuggccagcc cuggccaagccccccagcggg cacuggggugccuggccagccggggugaguggcugaggggcguuuucaggcuggccaagccccccagcggg NW_006297811.1:4593687..4593758:-
MDA_18021_41913 1.4e+2 274 271 0 3 yes blast uaagccagcagucggacaucc ugugucugauugcagguuuagg ugugucugauugcagguuuaggcccgcuucuccuaagccagcagucggacaucc NW_006299271.1:155600..155654:+
MDA_13103_30730 1.4e+2 273 268 0 5 yes blast ccgggugccagcaguggguguga caccugcugacggcgccgagu caccugcugacggcgccgagugaucgggacuggcgccgggugccagcaguggguguga NW_006294353.1:1139540..1139598:-
MDA_6665_14710 1.4e+2 273 184 0 89 yes blast cgccuuugcccugccccccaga cuggggggcagggcaaagg cuggggggcagggcaaaggcgccuuugcugccagggccgccuuugcccugccccccaga NW_006287915.1:714137..714196:-
MDA_17547_41135 1.4e+2 271 94 0 177 yes blast cuggccaagccccccagcggga ugcuggggugccuggccaguc ugcuggggugccuggccagucugggugaguggcugauggcaguuuguaggcuggccaagccccccagcggga NW_006298797.1:96068..96140:+
MDA_7642_17246 1.4e+2 271 265 1 5 yes blast cccagauugccccucaggag ccugaggggcaauuggggccaac cccagauugccccucaggagcagggggagguggagaagcccugaggggcaauuggggccaac NW_006288892.1:1627056..1627118:+
MDA_18960_45083 1.3e+2 271 265 0 6 yes blast ugagggaugucugacugcugg gcaguuggacaucccccaagg ugagggaugucugacugcugguuuaggccugauuaaacuggcaguuggacaucccccaagg NW_006300210.1:1091698..1091759:-
MDA_3090_5081 1.3e+2 269 124 0 145 yes blast acuggucaacaggucauucug gaacaaccugucgaccaguug acuggucaacaggucauucuguuacaacggaacgaccagaacaaccugucgaccaguug NW_006284340.1:1260869..1260928:-
MDA_16572_39686 1.3e+2 263 260 0 3 yes blast gagagggauguccgacugcca cagucagacaucccccaaggggu gagagggauguccgacugccaaaaccggcagucagacaucccccaaggggu NW_006297822.1:369993..370044:+
MDA_12450_28917 1.3e+2 257 215 0 42 yes blast gggaugucugacugcuggcuua aagcuggcagucggacauc gggaugucugacugcuggcuuaggcaugcucaagcuggcagucggacauc NW_006293700.1:3848152..3848202:-
MDA_14575_34861 1.3e+2 256 253 0 3 yes blast ugaccucuaaucacuggcuguu acagucagggaaaagaggucagu ugaccucuaaucacuggcuguugucauuuuuuuaauuugacagucagggaaaagaggucagu NW_006295825.1:2269585..2269647:-
MDA_12866_30200 1.3e+2 253 140 0 113 yes blast cagcaggcggacaucccccgagga gagagggaugucugccugccagu gagagggaugucugccugccaguuuaggccaggaauugggccuaagccagcaggcggacaucccccgagga NW_006294116.1:1241874..1241945:+
MDA_13362_31483 1.2e+2 247 242 0 5 yes blast uccugaggggcaauuggggccaa agucccaaucgucccucagg agucccaaucgucccucaggcuccuuccccugcuccugaggggcaauuggggccaa NW_006294612.1:244543..244599:+
MDA_14485_34209 1.2e+2 247 244 0 3 yes blast ugcccugaucgccccucaggau ccucaggggcaaucagggcca ugcccugaucgccccucaggauaagggaagguggagaagcccucaggggcaaucagggcca NW_006295735.1:837340..837401:-
MDA_12063_27977 1.2e+2 258 213 0 45 no blast cauggaggucucugucuggcu uuugaucguuccccuccauaca cauggaggucucugucuggcuuagcacagcuggcuaaguuugaucguuccccuccauaca NW_006293313.1:3423627..3423687:-
MDA_12812_29919 1.2e+2 243 115 0 128 yes blast ucaggccugggcaggggacc gccccuugcccagccugacgcc ucaggccugggcaggggacccccagaccccuccaauugcuugaucggccccuugcccagccugacgcc NW_006294062.1:227938..228006:+
MDA_7001_15654 1.2e+2 244 239 0 5 yes blast cagcagucggacaucccucucaaa cucggaggauguccgacugccaau cucggaggauguccgacugccaauuuaggccuagucccgaucgagccuaaaccagcagucggacaucccucucaaa NW_006288251.1:467339..467415:-
MDA_6421_13867 1.2e+2 243 199 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua NW_006287671.1:286628..286692:-
MDA_7383_16840 1.2e+2 240 210 0 30 yes blast cugcagucugacaucccccgag caggggaugucagacugcgagga caggggaugucagacugcgaggauugggccaaaaccugcagucugacaucccccgag NW_006288633.1:1987676..1987733:-
MDA_12866_30195 1.1e+2 228 143 1 84 yes blast ugcccccugguagucagugugc ugaccaccagggggcagacacu ugaccaccagggggcagacacuuaacucaggagcugcccccugguagucagugugc NW_006294116.1:830056..830112:+
MDA_101761_48597 1.1e+2 225 222 0 3 yes blast aaagaaacagaauuuccggagg cccagaaauucuguuucuuuguu cccagaaauucuguuucuuuguuacuaauguuguuauuaacccauaauaaagaaacagaauuuccggagg NW_006383011.1:16453607..16453677:+
MDA_18626_44005 1.1e+2 226 221 0 5 yes blast ugcccccuggucgucagugca gcacugacuaccaaggggcaga gcacugacuaccaaggggcagacacucaaggcaggagcugcccccuggucgucagugca NW_006299876.1:165601..165660:+
MDA_10317_24368 1.1e+2 224 215 0 9 yes blast cugcagucugacaucccccgag aggggaugucggacugccaguu aggggaugucggacugccaguuuugacccgauccgaaacugcagucugacaucccccgag NW_006291567.1:1807785..1807845:-
MDA_15377_37088 1.1e+2 224 215 0 9 yes blast cugcagucugacaucccccgag aggggaugucggacugccaguu aggggaugucggacugccaguuuugacccgauccgaaacugcagucugacaucccccgag NW_006296627.1:3564994..3565054:-
MDA_17097_40287 1.1e+2 221 146 0 75 yes blast gcuggccaagccccccagcagga ugcuggggugccugggcagucu ugcuggggugccugggcagucugugugaguggcugauggcaguuuacaggcuggccaagccccccagcagga NW_006298347.1:281866..281938:+
MDA_3792_6866 1.1e+2 218 199 0 19 yes blast ucuggccaagccccccagcgg ggugaggggcugauggcug ucuggccaagccccccagcggggacccucaccccaugaggguguggccauccugggugaggggcugauggcug NW_006285042.1:639082..639155:+
MDA_12529_29242 1.1e+2 217 157 0 60 yes blast ccuggccugcucuccccacaga aaggggagagaaggccagagca aaggggagagaaggccagagcaucgcccuaaccugccuggccugcucuccccacaga NW_006293779.1:7376226..7376283:-
MDA_14574_34717 1.1e+2 216 213 0 3 yes blast gaucgggccuaaaccagcagu cugcugguuuaggcccgauc cugcugguuuaggcccgaucccuguaggaucgggccuaaaccagcagu NW_006295824.1:876248..876296:-
MDA_3364_5747 1.1e+2 216 215 0 1 yes blast ucugacugcagcuuaggcccga gggccuaagccagcagguggacauc ucugacugcagcuuaggcccgauccccugggaagugggccuaagccagcagguggacauc NW_006284614.1:329275..329335:-
MDA_2383_3607 1.1e+2 230 198 30 2 no blast ccggcugugaguuugacaugcu acauuagaaucaccuggg ccggcugugaguuugacaugcuugcccuacagcagugguucucaaccuuggcuguacauuagaaucaccuggg NW_006283633.1:527185..527258:-
MDA_8563_19494 1.1e+2 230 198 30 2 no blast ccggcugugaguuugacaugcu acauuagaaucaccuggg ccggcugugaguuugacaugcuugcccuacagcagugguucucaaccuuggcuguacauuagaaucaccuggg NW_006289813.1:809208..809281:+
MDA_16323_38750 1.1e+2 212 136 0 76 yes blast uaagccagcagucggacaucu augucugacugcuggcuuagg augucugacugcuggcuuaggccacgagaagugggccuaagccagcagucggacaucu NW_006297573.1:72766..72824:-
MDA_101763_49000 1.0e+2 rRNA 211 203 7 1 yes blast uccggcggcggcggcggc cugcugcugcugcugcua uccggcggcggcggcggcugcugcugcugcuccugcugcugcugcugcugcua NW_006383013.1:4865696..4865749:+
MDA_6117_13132 1.0e+2 209 193 0 16 yes blast uugggggauguccaacugcugu cagcagucagacaucccucuua uugggggauguccaacugcuguuuuaggcccgauccugcaaccagcagucagacaucccucuua NW_006287367.1:155982..156046:+
MDA_93361_47256 1.0e+2 209 193 0 16 yes blast uugggggauguccaacugcugu cagcagucagacaucccucuua uugggggauguccaacugcuguuuuaggcccgauccugcaaccagcagucagacaucccucuua NW_006374611.1:949898..949962:+
MDA_2338_3408 1.0e+2 207 205 0 2 yes blast gaucgggccuaaaccagcagu cugccgguuuaggccugaua cugccgguuuaggccugauaccugggaucgggccuaaaccagcagu NW_006283588.1:3029470..3029516:-
MDA_11838_27448 1.0e+2 207 191 1 15 yes blast uagugcacugaccaccagggga cccccgguggucagugugc uagugcacugaccaccaggggacagcuccugcauugagugucugcccccgguggucagugugc NW_006293088.1:7483805..7483868:+
MDA_8563_19554 1.0e+2 207 186 0 21 yes blast uaaccgguugaacaacugaacc uuacaguuguucaaccaguuacu uuacaguuguucaaccaguuacuaaucuaacuaauuguaaccgguugaacaacugaacc NW_006289813.1:7106993..7107052:+
MDA_15155_36013 1.0e+2 206 197 0 9 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguuccucucaaccguagucaggaagcccuuaccccaaaaagca NW_006296405.1:1746663..1746728:-
MDA_15377_37024 1.0e+2 205 196 0 9 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguacauaacucaauagccggaagcccuuaccccaaaaagca NW_006296627.1:1728821..1728884:+
MDA_14574_34718 1.0e+2 204 201 0 3 yes blast gaucgggccuaaaccagcagu cugcugguuuaggcccgauc cugcugguuuaggcccgaucccuguaggaucgggccuaaaccagcagu NW_006295824.1:876248..876296:-
MDA_14975_35541 1.0e+2 204 199 0 5 yes blast ucuggccaagccccccagcgg ggugaggggcugguggcug ucuggccaagccccccagcggggacccucgccccaugaggguguggccaucuugggugaggggcugguggcug NW_006296225.1:598817..598890:-
MDA_17384_40947 1.0e+2 210 203 0 7 no blast cugcagucugacaucccccgag agagggugcaggucaggcu cugcagucugacaucccccgaggaguccuggauugcuagagggugcaggucaggcu NW_006298634.1:353085..353141:-
MDA_18455_43234 1.0e+2 200 152 0 48 yes blast ugcccugaucgccccucag ugaggggagaucggggcuggcag ugcccugaucgccccucaggagcagggggagguggagaggcccugaggggagaucggggcuggcag NW_006299705.1:8495027..8495093:-
MDA_14566_34405 1.0e+2 208 207 0 1 no blast ccucgagccgcuucccuucgcc ggaggggaggcugcuccu ccucgagccgcuucccuucgcccggcugucugugcgcggaggggaggcugcuccu NW_006295816.1:1338290..1338345:-
MDA_15374_36795 1.0e+2 200 195 0 5 yes blast uugggggauguccgacugauggu cgacagucggacauccuuagcacug uugggggauguccgacugaugguuuaggcccgcuccccgugggagccgacagucggacauccuuagcacug NW_006296624.1:338506..338577:-
MDA_9765_22734 1.0e+2 197 105 0 92 yes blast gaugucugacugcccgcuuagg uaagcuggcaggcagacauccc gaugucugacugcccgcuuaggccagggggaaaucaggccuaagcuggcaggcagacauccc NW_006291015.1:2711100..2711162:+
MDA_9382_21619 1.0e+2 196 192 0 4 yes blast gaucgggccuaaaccagcagu ugccaguuuaggccugaucc ugccaguuuaggccugauccccgggaucgggccuaaaccagcagu NW_006290632.1:1316555..1316600:+
MDA_14574_34671 1.0e+2 195 193 0 2 yes blast gaucgggccuaaaccagcagu cugcugguuuaggcccgauc cugcugguuuaggcccgauccuacagggaucgggccuaaaccagcagu NW_006295824.1:876249..876297:+
MDA_6297_13671 1.0e+2 193 170 0 23 yes blast ugccagcagcgggugugagc cucgcacccacugauggcacug cucgcacccacugauggcacugagcaaucgggaccagugccgggugccagcagcgggugugagc NW_006287547.1:3982148..3982212:+
MDA_4529_8708 1.0e+2 192 157 0 35 yes blast ugcuggcagugagugugagug ucucgcacccacugacagcacca ucucgcacccacugacagcaccaagccauuggggccgguguugagugcuggcagugagugugagug NW_006285779.1:7581857..7581923:-
MDA_2744_4390 9.9e+1 191 135 0 56 yes blast ccaucgguuggcgaccgcu ucgccaaccuuucagaccucacgga ucgccaaccuuucagaccucacggaccaucgguuggcgaccgcu NW_006283994.1:1491793..1491837:-
MDA_17475_41100 9.9e+1 190 177 0 13 yes blast ugcuggggugccuggccaguc cuggccaagccccccaguggga ugcuggggugccuggccagucugagugaggggcugguggcuguuuguaggcuggccaagccccccaguggga NW_006298725.1:215806..215878:+
MDA_2994_4660 9.7e+1 189 151 0 38 yes blast aggggauguucaacugcugguu ccggcagucagacaucccucu aggggauguucaacugcugguuuaaccggcagucagacaucccucu NW_006284244.1:3427137..3427183:+
MDA_9067_21115 9.5e+1 185 179 5 1 yes blast cacacugaccaccagggggc guguauaugugugugugugu cacacugaccaccagggggcauucauagcaggcacugugugugugcauuuguguguguguguauaugugugugugugu NW_006290317.1:265..343:-
MDA_101756_47605 9.5e+1 192 179 0 13 no blast ggaccaucgguuggcgacc caccagccuuucggaccucacgga caccagccuuucggaccucacggaccaccaguggucugcggaccaucgguuggcgacc NW_006383006.1:4968449..4968507:+
MDA_101759_48240 9.3e+1 181 154 0 27 yes blast ugagcccacccgucugcccuaca uuggguaguugggguucugacuggca uuggguaguugggguucugacuggcaucuuguuccuuuggugugagcccacccgucugcccuaca NW_006383009.1:3095991..3096056:-
MDA_10133_23534 9.3e+1 180 179 0 1 yes blast acgauggagagaggcacuggg cagggacucucccuccagcgac acgauggagagaggcacuggggugaugauggagcccagggacucucccuccagcgac NW_006291383.1:3900402..3900459:+
MDA_7351_16203 9.1e+1 184 183 0 1 no blast aucugccccuaucucaugccug aggacugaguuuggggcuguugu aucugccccuaucucaugccugguguuggaguucccuugagauacaggacugaguuuggggcuguugu NW_006288601.1:1409294..1409362:-
MDA_12534_29447 9.0e+1 173 79 0 94 yes blast cuuguacccgcugauggcaca ugccagcagcaggugcaagugg cuuguacccgcugauggcacagagcgauugggaccugugccagcagcaggugcaagugg NW_006293784.1:4344870..4344929:-
MDA_16504_39149 8.9e+1 172 145 1 26 yes blast gccccgaucgccccucaggag cccugaggggcgaucggggcu gccccgaucgccccucaggagcagggggagguggagaagcccugaggggcgaucggggcu NW_006297754.1:2418997..2419057:-
MDA_627_127 8.9e+1 173 147 0 26 yes blast aggggauguucaacugcugguu ggcagucagacaucccucucac aggggauguucaacugcugguuuggacauauaaauaaugacaaauaaacuggcagucagacaucccucucac NW_006281877.1:103679..103751:-
MDA_6662_14609 8.9e+1 173 167 0 6 yes blast ucggggaucaucaugucacgag ugugacagauugauaacugaaag ucggggaucaucaugucacgagauaccacuuugcacuugugacagauugauaacugaaag NW_006287912.1:194854..194914:-
MDA_6667_14782 8.7e+1 167 140 0 27 yes blast ugcuggggugccuggccagccu cuggccaagccccccaguggu ugcuggggugccuggccagccugggugagugacugauggcuguuugcaugcuggccaagccccccaguggu NW_006287917.1:130875..130946:-
MDA_6074_13085 8.6e+1 166 158 0 8 yes blast ugcuggcagugagugugagug gcuggcagugggugugaga ugcuggcagugagugugaguggcggcucuggugcuggcagcaggugcgagcagggccguugcuggcagugggugugaga NW_006287324.1:960132..960211:-
MDA_9756_22393 8.6e+1 167 162 0 5 yes blast caaagugcucauagugcagguag acuguagugugagcacuucuag caaagugcucauagugcagguaguuuugccauuauucuacuguagugugagcacuucuag NW_006291006.1:9381..9441:-
MDA_6871_15116 8.5e+1 165 164 0 1 yes blast augucaaacucgcagcuggugg ccggccgcgaguuugacaug augucaaacucgcagcuggugggccacaugccggccgcgaguuugacaug NW_006288121.1:502647..502697:+
MDA_11092_25599 8.5e+1 164 137 0 27 yes blast ugcccccuguuggucagugagc cacugaccaccaggggacagcu cacugaccaccaggggacagcuccugcauugagcaccugcccccuguuggucagugagc NW_006292342.1:527160..527219:+
MDA_11751_27082 8.4e+1 161 148 0 13 yes blast cgcuggggugccuggccagccu cuggccaagucccccagcaggg cgcuggggugccuggccagccugggggaggggcugauggcuguuuguaggcuggccaagucccccagcaggg NW_006293001.1:369423..369495:-
MDA_5233_11014 8.3e+1 161 160 0 1 yes blast cggcagucggacaucccucu gggggauguccaacugc gggggauguccaacugcugguguaggcccgauccccaccggcagucggacaucccucu NW_006286483.1:311531..311589:-
MDA_5425_11674 8.3e+1 161 160 0 1 yes blast cggcagucggacaucccucu aggggauguccaacugc aggggauguccaacugccgguuuaagcccaaucccacagggacaccggcagucggacaucccucu NW_006286675.1:1562835..1562900:-
MDA_2389_3789 8.3e+1 158 154 0 4 yes blast uugggggaugucugccugcu agguggacauccccugaggggu uugggggaugucugccugcugguuuaggccugcuuccccugagcaggcagguggacauccccugaggggu NW_006283639.1:3750495..3750565:-
MDA_10474_24430 8.2e+1 159 153 0 6 yes blast gcuggccaagccccccagcagga ugcuggggugccuggccauuc ugcuggggugccuggccauucugggugaggggcuaauggcuguuugcaggcuggccaagccccccagcagga NW_006291724.1:62880..62952:-
MDA_10474_24428 8.2e+1 159 153 0 6 yes blast gcuggccaagccccccagcagga ugcuggggugccuggccauuc ugcuggggugccuggccauucugggugaggggcuaauggcuguuugcaggcuggccaagccccccagcagga NW_006291724.1:62640..62712:-
MDA_9191_21219 8.0e+1 154 152 0 2 yes blast gauguccgacugcuggcuuagga uaagccggcauuuggacacc gauguccgacugcuggcuuaggagcgggccuaagccggcauuuggacacc NW_006290441.1:1383033..1383083:-
MDA_10568_24593 7.9e+1 153 142 0 11 yes blast cacuggcagugggugugagcgg cucacacccacugauggcacc cucacacccacugauggcaccaagugauugggacuaucacugggcacuggcagugggugugagcgg NW_006291818.1:2165304..2165370:+
MDA_11323_26024 7.9e+1 153 152 0 1 yes blast ccugaggggugauuggggccg agccccgaucaccccuca agccccgaucaccccucaaggcuuuuccaccccuuccuguuccugaggggugauuggggccg NW_006292573.1:987280..987342:-
MDA_5424_11491 7.9e+1 152 141 1 10 yes blast ugcuggggugccuggccagccu gcuggccacgccccccagcga ugcuggggugccuggccagccuggaugagaggcugauggccauuuucaggcuggccacgccccccagcga NW_006286674.1:1523729..1523799:+
MDA_14485_34197 7.9e+1 152 134 0 18 yes blast ccagcagucggacauccccuga aggagauguccgacugccaguu aggagauguccgacugccaguuuacagcccaauccccuggucugcggggauugagcccuaaaccagcagucggacauccccuga NW_006295735.1:1081785..1081869:+
MDA_3588_6176 7.9e+1 151 147 2 2 yes blast uccugaggggcaauuggggccag ggccccgaucaccccucag ggccccgaucaccccucagggcuucuccaccucccccugcuccugaggggcaauuggggccag NW_006284838.1:697230..697293:-
MDA_2510_3832 7.8e+1 149 138 0 11 yes blast cgcacugaccaccagggggc ccccuuguggucagugcgcguca cgcacugaccaccagggggcagcuccugcauugagcgccugcccccuuguggucagugcgcguca NW_006283760.1:121330..121395:-
MDA_11757_27242 7.4e+1 142 141 0 1 yes blast ugcccugaucgccccucag ucaggggcaaucagggccggc ugcccugaucgccccucaggaacaggggagguggagaagcccucaggggcaaucagggccggc NW_006293007.1:1778603..1778666:+
MDA_101756_47658 7.4e+1 142 130 0 12 yes blast augucugacugcuggcuuagga cuaagccagcagucagacauccc augucugacugcuggcuuaggagcuugccuaagccagcagucagacauccc NW_006383006.1:8287018..8287069:+
MDA_9192_21251 7.4e+1 142 80 0 62 yes blast gagggcccucuccacgcgccu gcaugcggagaggccucucug gagggcccucuccacgcgccuguggauccccagccuaggcaugcggagaggccucucug NW_006290442.1:9460..9519:+
MDA_8563_19682 7.3e+1 141 139 1 1 yes blast ccuaaggggcaaucggggccg agccccaauugccccucagg agccccaauugccccucagggcuucuccaccucccccuacuccuaaggggcaaucggggccg NW_006289813.1:5302567..5302629:-
MDA_101756_47819 7.3e+1 140 127 0 13 yes blast ucgggggauaucugacugcuggu uggcagucagacaucccucucg ucgggggauaucugacugcugguuuagguaucccuucuggaucggaccuaaauuggcagucagacaucccucucg NW_006383006.1:8216781..8216856:-
MDA_4363_8382 7.3e+1 140 128 0 12 yes blast ucgggggauaucugacugcuggu ugcagucagauaucccucucac ucgggggauaucugacugcugguuuugccauguggaucaggccuaaaccugcagucagauaucccucucac NW_006285613.1:584363..584434:+
MDA_11092_25638 7.3e+1 139 120 0 19 yes blast cugccuagaccccugcucacc uggggcggggguucugggcugg uggggcggggguucugggcugggccuggguguacucccugccuagaccccugcucacc NW_006292342.1:464505..464563:-
MDA_5233_11009 7.2e+1 139 84 49 6 yes blast gagagggauguccgacugcc gcaguuggacaucccccaagg gagagggauguccgacugccgguggggaucgggccuacaccagcaguuggacaucccccaagg NW_006286483.1:311530..311593:+
MDA_8781_20305 7.2e+1 138 106 0 32 yes blast ccugaggggcgaucagggccugc cggccccaauugccccucaggag cggccccaauugccccucaggagcagggggagguagagaggcccugaggggcgaucagggccugc NW_006290031.1:6316534..6316599:+
MDA_8781_20303 7.2e+1 138 106 0 32 yes blast ccugaggggcgaucagggccugc cggccccaauugccccucaggag cggccccaauugccccucaggagcagggggagguagagaggcccugaggggcgaucagggccugc NW_006290031.1:6315916..6315981:+
MDA_17109_40484 7.2e+1 145 144 0 1 no blast cuuggucuguguccuggggag uccuggaacgccgccgggccaag uccuggaacgccgccgggccaagcuuggucuguguccuggggag NW_006298359.1:380745..380789:-
MDA_6871_15138 7.1e+1 137 136 0 1 yes blast agagaggcagggucugauc cagcccuugccucucucuuu agagaggcagggucugaucugcagccucuguggcagcuguugaucagcccuugccucucucuuu NW_006288121.1:1328753..1328817:+
MDA_74655_47105 7.1e+1 140 135 0 5 yes blast cugguguugaguuguaugcguu gccauacaacucaacucca gccauacaacucaacuccauuuuguauguguuuuuccucaacuucgguuggaaguauaugucuuccugguguugaguuguaugcguu NW_006355905.1:362..449:+
MDA_13340_31192 7.0e+1 143 138 0 5 no blast ggguucgauucccggucaggg ucggcugcaggcucgauccccagc ggguucgauucccggucaggggcagggaccucggcugcaggcucgauccccagc NW_006294590.1:1983660..1983714:+
MDA_16187_38631 7.0e+1 142 137 0 5 no blast uucccgcucaccucccgga ccggguugcugggucgggu ccggguugcugggucgggugcuggucaaaggcuucccgcucaccucccgga NW_006297437.1:1539..1590:+
MDA_11092_25629 7.0e+1 142 140 0 2 no blast uccggaauggggcuucagcgcug cggggagccccaguccugguuc uccggaauggggcuucagcgcuggagaucucguacaacggggagccccaguccugguuc NW_006292342.1:272999..273058:-
MDA_2190_2877 6.9e+1 140 133 0 7 no blast agcuccaccgugugcccucucu agcgggcagcgugggggag agcuccaccgugugcccucucucccgagucagagcugugcggagcgggcagcgugggggag NW_006283440.1:773432..773493:+
MDA_13089_30578 6.8e+1 130 114 0 16 yes blast gccccgaucgccccucaggag cugaggggcgauugggacc gccccgaucgccccucaggagcggggggaggagaagcccugaggggcgauugggacc NW_006294339.1:1097189..1097246:-
MDA_11084_25526 6.8e+1 130 119 9 2 yes blast aaugucugccugccggcuuagg cgcugcaggcgggcagu cgcugcaggcgggcaguaaggagcggagcgagggguccuggacugccagagacccagacugugagaggaaugucugccugccggcuuagg NW_006292334.1:2446507..2446597:-
MDA_101756_47639 6.7e+1 128 115 0 13 yes blast ucaggccugggcaggggacc cccccggcccaggccugaugccu ucaggccugggcaggggacccccagaccccucuguccggcuuggcucccccggcccaggccugaugccu NW_006383006.1:6820939..6821008:+
MDA_7604_17075 6.7e+1 130 82 0 48 yes blast acucugcagacgccugugucu cacccagguguuuguuggaaucu cacccagguguuuguuggaaucuuuaugcuuaaaggacucugcagacgccugugucu NW_006288854.1:239759..239816:+
MDA_4363_8435 6.6e+1 128 127 0 1 yes blast ucgggggauaucugacugcuggu cuggaagucggacaucccucu ucgggggauaucugacugcugguuuaggcuccauccugggaucaggccaaaacuggaagucggacaucccucu NW_006285613.1:312373..312446:-
MDA_4547_9128 6.6e+1 140 138 0 2 no blast ugauugggcugccuccagagga acucugaagcugaccaauuggg acucugaagcugaccaauugggcaaaaucuuugacuugauugggcugccuccagagga NW_006285797.1:184093..184151:-
MDA_6665_14723 6.5e+1 125 124 0 1 yes blast ucgggggaugucugccugccagu ccgcaggcggacaucccc ucgggggaugucugccugccaguuagguccauuacccgcaggcggacaucccc NW_006287915.1:1630298..1630351:-
MDA_7008_15717 6.5e+1 125 34 0 91 yes blast ugcuggugggcuuggccagccu acuggccaggcaccccagcaa ugcuggugggcuuggccagccugcaaacagccaucaacuccucacccaaacuggccaggcaccccagcaa NW_006288258.1:295908..295978:+
MDA_16323_38777 6.5e+1 124 110 0 14 yes blast augucugacugcuggcuuagg aagccagcagucggacauaa augucugacugcuggcuuaggcccuuuuauggggagugggccuaagccagcagucggacauaa NW_006297573.1:2111375..2111438:-
MDA_101756_47774 6.5e+1 146 144 0 2 no blast aaugugugucugauguagaagc uucugcagcagaucuccag aaugugugucugauguagaagcaagcuuagacagguagacucuucugcagcagaucuccag NW_006383006.1:4633969..4634030:-
MDA_7365_16527 6.4e+1 122 119 0 3 yes blast aaugucugccugccggcuuagg uaagccggcaggcagacauccc aaugucugccugccggcuuaggcccaauagaggccuaagccggcaggcagacauccc NW_006288615.1:6124789..6124846:-
MDA_7603_17028 6.4e+1 124 123 0 1 yes blast ccggccgugaguuugacaugc augucaaacucucagcuggugga augucaaacucucagcugguggacaaaugaggcauguggcccuccggccgugaguuugacaugc NW_006288853.1:3242534..3242598:-
MDA_12993_30383 6.4e+1 123 122 0 1 yes blast ugccagcagcgggugugagc ucacaccugcugaaggc ucacaccugcugaaggcauggagugauuguuggaaccggugccagcagcgggugugagc NW_006294243.1:2778664..2778723:+
MDA_15155_35994 6.4e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaccguuuuucauuauugcuccugacc NW_006296405.1:39600..39658:-
MDA_666_222 6.2e+1 120 119 0 1 yes blast ugccccuuggugaucagugugc acacugaccacuggggg acacugaccacuggggggcagacgcuuaaugcaagagcugccccuuggugaucagugugc NW_006281916.1:116515..116575:-
MDA_16408_38922 6.1e+1 117 76 0 41 yes blast accucugacccaagugaaccag guucaugugcguccgagggcu accucugacccaagugaaccagcccuucccccucugguucaugugcguccgagggcu NW_006297658.1:247459..247516:-
MDA_13089_30587 6.1e+1 116 43 0 73 yes blast uuucgugcaucuggcucuagu cuagaggccuggugcacgaaau uuucgugcaucuggcucuaguguauuauaaaaguaacuagaggccuggugcacgaaau NW_006294339.1:2471694..2471752:-
MDA_13933_33175 6.0e+1 123 118 0 5 no blast ugacacuugccccuccccgcaga ugcaggguggaggcagguugggac ugcaggguggaggcagguugggaccagcugagcaggcggugacacuugccccuccccgcaga NW_006295183.1:695650..695712:+
MDA_5423_11413 5.9e+1 113 72 6 35 yes blast uugggggaugucugacugccaguu ccggcagucgaacaucccucuca uugggggaugucugacugccaguuuaggccugauccccugcaggccuggucgcacuaaaccggcagucgaacaucccucuca NW_006286673.1:2617868..2617950:+
MDA_9056_20954 5.8e+1 111 105 0 6 yes blast augucugacugcuggcuuagg uaagccagcaguuggacauc augucugacugcuggcuuaggcccucugcagggaguuggccuaagccagcaguuggacauc NW_006290306.1:223823..223884:+
MDA_19117_45605 5.8e+1 120 118 0 2 no blast cagugggcacaggagcggguc cccagccccucccacug cagugggcacaggagcggguccggcccauccuccacgccccugcccagccccucccacug NW_006300367.1:4806693..4806753:-
MDA_14330_34087 5.8e+1 111 74 0 37 yes blast cugaaaccggcaguccaacauu uguuggacugccgguuucagcc uguuggacugccgguuucagccccauccucacaggggcugaaaccggcaguccaacauu NW_006295580.1:353657..353716:+
MDA_2744_4372 5.8e+1 111 64 42 5 yes blast auuuccggaggauggggccc ccccauccucuggaaauucugu ccccauccucuggaaauucugugucuuuguuaugggguggggccacaacauuaguaacaaagaaaccgaauuuccggaggauggggccc NW_006283994.1:663251..663340:-
MDA_10235_23939 5.8e+1 114 108 0 6 yes blast aaugcaguggaccugggccagau uuggccugggcacacgcauca aaugcaguggaccugggccagaugagcagcuucuacauuggccugggcacacgcauca NW_006291485.1:2099554..2099612:-
MDA_12707_29830 5.7e+1 109 106 1 2 yes blast uccugaggggugaucggggcugg uggcccugauugccccucagggc uggcccugauugccccucagggcuucuccaccucccccuguuccugaggggugaucggggcugg NW_006293957.1:2362645..2362709:-
MDA_5539_12098 5.7e+1 109 103 0 6 yes blast aaguccgacugcugguuuaggc uaaaccagcagucagacaucccc aaguccgacugcugguuuaggcccaaucccaugggccuaaaccagcagucagacaucccc NW_006286789.1:33313..33373:+
MDA_15768_37559 5.6e+1 108 106 0 2 yes blast ucuggccaagucccccagcgggg cauggggguguggccagccug ucuggccaagucccccagcggggacccucaccccauggggguguggccagccug NW_006297018.1:875037..875091:-
MDA_1014_761 5.6e+1 107 99 3 5 yes blast ugcccugaucaucccugagggc uccugaggggugauggggga ugcccugaucaucccugagggcuucuccaccucccccugcuccugaggggugauggggga NW_006282264.1:413853..413913:-
MDA_6661_14538 5.6e+1 107 102 0 5 yes blast agugcacugaucacccaggggc cccucugguggucagug agugcacugaucacccaggggcaacucccguauugagccucugccccucugguggucagug NW_006287911.1:199344..199405:+
MDA_6307_13804 5.6e+1 107 102 0 5 yes blast agugcacugaucacccaggggc cccucugguggucagug agugcacugaucacccaggggcaacucccguauugagccucugccccucugguggucagug NW_006287557.1:150246..150307:+
MDA_15816_37833 5.5e+1 104 82 0 22 yes blast auggaucagacccugccucucu agaggcaaguucugaucaguggc agaggcaaguucugaucaguggcugccacagaggcuauggaucagacccugccucucu NW_006297066.1:1314891..1314949:-
MDA_16558_39198 5.4e+1 114 63 0 51 yes blast uuagaccauugucaauugagaug ucucuucugcaugcauggucu uuagaccauugucaauugagauggaguaaccauuucaucucuucugcaugcauggucu NW_006297808.1:863484..863542:+
MDA_14574_34694 5.4e+1 102 97 1 4 yes blast cccuugggggauguccgacugaa ucagucggacauccuuagu cccuugggggauguccgacugaagguuuaggcccgcuucccuggggagcgggccuaagccuucagucggacauccuuagu NW_006295824.1:2452226..2452306:+
MDA_8563_19591 5.4e+1 104 88 0 16 yes blast aggccagcagucggacauc auguccaacugccggcuuagg auguccaacugccggcuuaggcccaaucccuaggccagcagucggacauc NW_006289813.1:10706611..10706661:+
MDA_9430_21961 5.4e+1 103 80 0 23 yes blast cacacugaccaccagggggc uccccuguuggucagugugcu cacacugaccaccagggggcggacgcucaaagcaagagcuguccccuguuggucagugugcu NW_006290680.1:4228921..4228983:+
MDA_15156_36038 5.4e+1 103 94 0 9 yes blast cugggcacuggcagcgggugu acccgcugauggcgccaaguga acccgcugauggcgccaagugaucaagaccagcgcugggcacuggcagcgggugu NW_006296406.1:894375..894430:-
MDA_3790_6774 5.4e+1 102 101 0 1 yes blast agacgagugugaaugggagagu ucucccauccacacucauc ucucccauccacacucaucuaucugaaacaaguauacaagacgagugugaaugggagagu NW_006285040.1:1916404..1916464:-
MDA_5337_11154 5.4e+1 101 99 0 2 yes blast gccccgaucgccccucaggag ccugaggggcaauugggg gccccgaucgccccucaggagcaggaggagguagagaagcccugaggggcaauugggg NW_006286587.1:6963246..6963304:+
MDA_101766_49615 5.3e+1 100 96 0 4 yes blast gagagggauguccgacugcc cagucagacaucccccaaggggu gagagggauguccgacugccgguauaggcccugaccgggccuauacuggcagucagacaucccccaaggggu NW_006383016.1:11991995..11992067:-
MDA_18455_43163 5.2e+1 109 107 1 1 no blast ucucacucgcggcccggaag gccgggccgacagucaaa ucucacucgcggcccggaagcuggagggacgaggugugcggacaauggucagggccgggccgacagucaaa NW_006299705.1:83522..83593:-
MDA_7833_17482 4.9e+1 92 87 0 5 yes blast uacuggagugccuggccagccu cuggccaagacccccagugg uacuggagugccuggccagccuuggugcuggcugauggcucuuuucaggcuggccaagacccccagugg NW_006289083.1:133221..133290:+
MDA_18229_42410 4.8e+1 90 85 0 5 yes blast ucacugaccaccagggggcag ugcucccugguggucagugg ucacugaccaccagggggcagcuucugcauugagcaucugcucccugguggucagugg NW_006299479.1:1183241..1183299:-
MDA_18013_41841 4.7e+1 89 53 0 36 yes blast aaugcacugaccaccagggggu cccccugguggucagugugcgu aaugcacugaccaccaggggguagcuccuguguugagugucuccccccugguggucagugugcgu NW_006299263.1:415517..415582:-
MDA_7837_17554 4.7e+1 93 82 0 11 yes blast caggcuaggauaaaugaaugg auucacuuaucucccagccuacaa caggcuaggauaaaugaauggguagaaaaaucugcucuauucacuuaucucccagccuacaa NW_006289087.1:3777819..3777881:+
MDA_18139_42033 4.7e+1 88 82 0 6 yes blast gauguccgacugcuggcuuagg aagccgucagucagacauccuu gauguccgacugcuggcuuaggccuacuccccacaggccuaagccgucagucagacauccuu NW_006299389.1:305957..306019:-
MDA_8148_18473 4.6e+1 89 81 0 8 yes blast ggaccaucgguuggcgacu ucgccaaccuuucagaccuca ucgccaaccuuucagaccucacagaccaccagugguccauggaccaucgguuggcgacu NW_006289398.1:2883807..2883866:+
MDA_17062_40280 4.6e+1 87 77 0 10 yes blast uaaaccggcagucagacaucc ugucugacugccgguuuaggcc ugucugacugccgguuuaggcccacagggauaaggccuaaaccggcagucagacaucc NW_006298312.1:6167029..6167087:-
MDA_9940_23143 4.6e+1 86 81 0 5 yes blast agacgagugugaaugggagagu ucucccauccacacucaucuugu ucucccauccacacucaucuuguguacuuguuucagauagacgagugugaaugggagagu NW_006291190.1:8899..8959:+
MDA_10304_24304 4.5e+1 86 78 5 3 yes blast agcccagccggccuggcucagu cugggucagggcacauguu agcccagccggccuggcucaguggucgaauguggaccuaugaacccgggggucaugguucgauucugggucagggcacauguu NW_006291554.1:749787..749870:+
MDA_4981_10009 4.4e+1 84 83 0 1 yes blast ucaggccugggcaggggac cccucugcccaggcccga cccucugcccaggcccgaugccucuggcccaagcaucaggccugggcaggggac NW_006286231.1:3108827..3108881:+
MDA_3996_7634 4.3e+1 91 90 0 1 no blast caccuguugccggugcccag cuggugccaucagcugg caccuguugccggugcccagcgcuggucccaauucaccuggugccaucagcugg NW_006285246.1:362971..363025:+
MDA_16571_39616 4.3e+1 81 73 0 8 yes blast gccccgaucgccccucaggac ccugaggggcgaucagggccgg gccccgaucgccccucaggaccagggggagguggaaaagcccugaggggcgaucagggccgg NW_006297821.1:3203099..3203161:+
MDA_7111_15869 4.3e+1 81 49 0 32 yes blast agccccgaucgccccucaggau uccugaggggcaauuggggc agccccgaucgccccucaggauuucuccccaucccccugcuccugaggggcaauuggggc NW_006288361.1:266027..266087:-
MDA_18466_43651 4.2e+1 80 41 0 39 yes blast cuggcagucagacaucccucucu aggggaugucugccugccggcu aggggaugucugccugccggcuuaguccugccuggcagucagacaucccucucu NW_006299716.1:30384..30438:+
MDA_101758_48014 4.2e+1 80 75 0 5 yes blast ggggauguucaacugcugguuu ccagcaguuggacaucccucucg ggggauguucaacugcugguuuaggccccauccugccagcaguuggacaucccucucg NW_006383008.1:1882256..1882314:+
MDA_13150_30819 4.2e+1 88 77 0 11 no blast cuuggcaggcgggcccuugca ccaggggccaugccagccagagcuua ccaggggccaugccagccagagcuuacuucucucugcgaggcuuggcaggcgggcccuugca NW_006294400.1:5576294..5576356:+
MDA_14484_34180 4.1e+1 78 60 0 18 yes blast cacccgcugcuggugcccagu uuggcgccaucagcgggugaga cacccgcugcuggugcccagugccagccccaaucccuuggcgccaucagcgggugaga NW_006295734.1:30824..30882:-
MDA_18455_42976 4.1e+1 78 60 0 18 yes blast cacccgcugcuggugcccagu uuggcgccaucagcgggugaga cacccgcugcuggugcccagugccagccccaaucccuuggcgccaucagcgggugaga NW_006299705.1:2433700..2433758:+
MDA_12449_28785 4.1e+1 77 71 0 6 yes blast acugaccaucaggggguagacgcu gcugccccuugguggucagugc acugaccaucaggggguagacgcucaacgcaggagcugccccuugguggucagugc NW_006293699.1:431619..431675:-
MDA_6116_13110 4.1e+1 76 71 0 5 yes blast ugagggauguccgacugccugu ugggcagucggacaucccucuca ugagggauguccgacugccuguuuaggcccgaucccccgaucccaccggaauugggccuaaaugggcagucggacaucccucuca NW_006287366.1:245565..245650:+
MDA_15167_36262 4.0e+1 77 41 0 36 yes blast aacccugugguggguggcugac uggaccacuaggccucaggguuug aacccugugguggguggcugaccagguugguucuauggguggaccacuaggccucaggguuug NW_006296417.1:1033009..1033072:+
MDA_13626_32390 4.0e+1 76 71 0 5 yes blast uggccccgauugccccucaggaa cccugaggggugaucgggga uggccccgauugccccucaggaacagggggaaguggagaagcccugaggggugaucgggga NW_006294876.1:5147537..5147598:+
MDA_6929_15259 4.0e+1 84 55 0 29 no blast acucacacccacugauggcacu cgccagcagcaggugcgagugg acucacacccacugauggcacugaguguucaggaccggcgccagcagcaggugcgagugg NW_006288179.1:236737..236797:-
MDA_1630_2069 4.0e+1 85 82 0 3 no blast agcagucggacaucccucgagg uuagggggaccaggccug uuagggggaccaggccugcagggaagggcaguagggggcaaccagccuaaacgagcagucggacaucccucgagg NW_006282880.1:492413..492488:+
MDA_13804_32792 3.9e+1 73 61 0 12 yes blast ggaggggccucucugugugccu cacguggagaggccucucugc ggaggggccucucugugugccuguggaaccccugcgcaggcacguggagaggccucucugc NW_006295054.1:1203730..1203791:+
MDA_3984_7570 3.9e+1 82 79 0 3 no blast cugcccauuuaggccugaucccu ggcgaucaggcaggcagg ggcgaucaggcaggcaggcaggcagagggguuaggagucagcagucuggauugggagagggaugucugucugcccauuuaggccugaucccu NW_006285234.1:3060729..3060821:-
MDA_9760_22572 3.9e+1 81 70 0 11 no blast ugcuggggugccuggccaga agggcugauggcuguuugcaggc ugcuggggugccuggccagacugggugaagggcugauggcuguuugcaggc NW_006291010.1:4014814..4014865:+
MDA_8563_19751 3.9e+1 73 60 0 13 yes blast cgccagcagugggugcgagc cuuguacccgcugauggcac cuuguacccgcugauggcacugagugaucgggagggaccagcacugggcgccagcagugggugcgagc NW_006289813.1:13480698..13480766:-
MDA_11338_26069 3.8e+1 72 58 0 14 yes blast ugcccccuggugaucaaugugc cgcauugaccaccagggggcagg cgcauugaccaccagggggcaggcgcucaacacaggagcugcccccuggugaucaaugugc NW_006292588.1:467549..467610:+
MDA_2294_3068 3.8e+1 72 41 0 31 yes blast uaaaccggcagucagacaucc auguccgacugccgguuuaggac auguccgacugccgguuuaggaccgaccccgggaaucgggccuaaaccggcagucagacaucc NW_006283544.1:1481473..1481536:+
MDA_7354_16218 3.8e+1 72 70 1 1 yes blast ugcuggggugccuggccaga uggcaggugacugaagc ugcuggggugccuggccagacugagugaggggcuaaggguccuuuucaggcuggcaggugacugaagc NW_006288604.1:559835..559903:+
MDA_10177_23755 3.7e+1 69 32 0 37 yes blast cacuggccgcggguuugacaug augucaaacucguggccggca augucaaacucguggccggcaugcaaacaaggcaugcgguccacuggccgcggguuugacaug NW_006291427.1:135695..135758:-
MDA_10845_25184 3.6e+1 68 40 1 27 yes blast ucugauccgcagccuccaugg aagggggcugcggaucaggcc aagggggcugcggaucaggccuggagagagaccugcagagagaggggcagggucugauccgcagccuccaugg NW_006292095.1:5730885..5730958:+
MDA_101766_49578 3.6e+1 68 67 0 1 yes blast ugcugucagcaggugcgagcgg acucacacccgcugacag acucacacccgcugacagcccagagcgauugggcccagcgacagcagugggagcaaguggggccggugcugucagcaggugcgagcgg NW_006383016.1:8606069..8606157:-
MDA_9957_23232 3.6e+1 67 66 0 1 yes blast uuggggcuggugccagcagcaga ugcugauggugcuggccccg ugcugauggugcuggccccgcucguacccgcugacagcguaaagccauuggggcuggugccagcagcaga NW_006291207.1:64485..64555:-
MDA_3097_5299 3.5e+1 65 60 1 4 yes blast cccugaggggugaucggggcugu ugcccugaucgucccucaggagc ugcccugaucgucccucaggagcagggggagguggagaagcccugaggggugaucggggcugu NW_006284347.1:3521009..3521072:+
MDA_18010_41700 3.5e+1 66 55 0 11 yes blast ucugcccccugguagucagug ugacaaccaggaggcagacacu ugacaaccaggaggcagacacuaaacacaggaucugcccccugguagucagug NW_006299260.1:611637..611690:+
MDA_1902_2492 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucauuuccugcccuggcccgagggaccgacu NW_006283152.1:72419..72480:-
MDA_4993_10429 3.4e+1 64 47 0 17 yes blast gcccugauugucccuuaggagc ccugaggggcaaucgaggcca gcccugauugucccuuaggagcagggggagguggaaaaacccugaggggcaaucgaggcca NW_006286243.1:2574584..2574645:-
MDA_8140_18060 3.4e+1 63 42 0 21 yes blast ugccccgaucaccccucaggac ccucaggggcgaucaggg ugccccgaucaccccucaggaccagaaggagguggaaaagcccucaggggcgaucaggg NW_006289390.1:67454..67513:+
MDA_2389_3702 3.3e+1 63 60 0 3 yes blast cacccgcugcuggugcccagu cuuggugccaucagcaggu cacccgcugcuggugcccagugccauugcugaucacuuggugccaucagcaggu NW_006283639.1:1312923..1312977:+
MDA_13404_31520 3.3e+1 61 52 1 8 yes blast agccccaauugccccucaggag cugaggggcaauuggggccagc agccccaauugccccucaggagcagggggagguggagaagcccugaggggcaauuggggccagc NW_006294654.1:3889108..3889172:+
MDA_10280_24059 3.3e+1 62 23 0 39 yes blast uagcagcacagaaauauuggca ccaauauuggcugagcugcuccag uagcagcacagaaauauuggcacugggacgagccugccaauauuggcugagcugcuccag NW_006291530.1:105720..105780:-
MDA_7365_16295 3.2e+1 62 60 1 1 yes blast ucagagaggaagggcgaggag cccucucccuucuuucuc cccucucccuucuuucucuaaacauaauuuuuuaaaauauauuuuuauuaauuucagagaggaagggcgaggag NW_006288615.1:2520278..2520352:+
MDA_18010_41727 3.2e+1 61 56 0 5 yes blast ugaucaacacuugccucucucu agagaagcagggacugaucca agagaagcagggacugauccauugcuucuguggaagcuuuugaucaacacuugccucucucu NW_006299260.1:2772730..2772792:+
MDA_3691_6564 3.2e+1 60 59 0 1 yes blast uaagcaggcagucggacaucc augucugacucacugcuu augucugacucacugcuuaggcccacucccaggggagugugcuuaagcaggcagucggacaucc NW_006284941.1:25780..25844:-
MDA_10570_24639 3.2e+1 59 57 1 1 yes blast uccuggcucugugccccgcccacc ccuggcugggguggggggg ccuggcuggggugggggggcaggcgggccugcaggcugugcugcugccuccuggcucugugccccgcccacc NW_006291820.1:525690..525762:+
MDA_12063_27944 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucaggacaaugccguuguacaguagucugcacauugguu NW_006293313.1:1274057..1274117:-
MDA_17062_40224 3.2e+1 61 38 0 23 yes blast cagcagucagauaucccucuug ucggggaaugucugacugccaguu ucggggaaugucugacugccaguuuagagacagaauuucucugucucagaauuccuccuaacccagcagucagauaucccucuug NW_006298312.1:583402..583487:-
MDA_5337_11320 3.2e+1 59 58 0 1 yes blast cucggcgcugucagcaggug accugcugcuggcaccugg accugcugcuggcaccuggcaccuggcacuggucccgaucacucggcgcugucagcaggug NW_006286587.1:10464947..10465008:-
MDA_16409_38926 3.1e+1 59 44 0 15 yes blast ccuaagccggcagucagacauu auguccaccugccagcuuaagcc auguccaccugccagcuuaagccugauuccccuaggaaucgggccuaagccggcagucagacauu NW_006297659.1:38173..38238:-
MDA_18353_42923 3.1e+1 63 41 1 21 yes blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucgugugucgugugugggauccgucucaguuacuuuauagcc NW_006299603.1:1522211..1522276:-
MDA_14566_34324 3.1e+1 57 29 0 28 yes blast ccuccacgucuuugugcuugcug cagcacgaggcuguggggggugc ccuccacgucuuugugcuugcuguggaguugccagagcagcacgaggcuguggggggugc NW_006295816.1:1294270..1294330:+
MDA_7604_17095 3.0e+1 57 46 0 11 yes blast agcggacuggccgccugcuucu agccaggcggucaaugcgcug agcggacuggccgccugcuucucguucagcagagccaggcggucaaugcgcug NW_006288854.1:365710..365763:-
MDA_4890_9829 3.0e+1 57 25 0 32 yes blast uacugaccaccagggggcagaag ugcccccugguagucagug uacugaccaccagggggcagaagcucacugcagaagcugcccccugguagucagug NW_006286140.1:788322..788378:-
MDA_2520_3970 3.0e+1 56 42 0 14 yes blast ugucggacugccgguuucagc cugaaaccggcaguccgacauc ugucggacugccgguuucagcauaauccccacaguugggcugaaaccggcaguccgacauc NW_006283770.1:3189113..3189174:+
MDA_2518_3905 3.0e+1 56 50 2 4 yes blast cagcccugaucgucccucagg ugaggggcgauuggggcuggc cagcccugaucgucccucagggcuucaucacuucccccugcuccugaggggcgauuggggcuggc NW_006283768.1:2533385..2533450:-
MDA_18854_44871 3.0e+1 64 54 0 10 no blast gcuggcagcggguuugagcgg auuggggcuggcgccagca auuggggcuggcgccagcaguggguacgagcagugguuccugugcuggcagcggguuugagcgg NW_006300104.1:1661198..1661262:+
MDA_18469_43811 2.9e+1 54 50 0 4 yes blast cagcccugaucgucccucagg ugaggggugaucagggccag cagcccugaucgucccucagggcuucuccaacugcuccugaggggugaucagggccag NW_006299719.1:1698481..1698539:-
MDA_6929_15238 2.9e+1 53 44 0 9 yes blast ugcucgcaucugcugcuggug accgucagugggugugagugg ugcucgcaucugcugcuggugccugccccaaucacuccgcaccgucagugggugugagugg NW_006288179.1:236904..236965:+
MDA_12300_28673 2.8e+1 53 43 0 10 yes blast caccagcagcaggugugagcagu acuugcaccugcugacggcagc acuugcaccugcugacggcagcaagcaauugggauuggcgcugggcaccagcagcaggugugagcagu NW_006293550.1:287952..288020:+
MDA_19127_46525 2.8e+1 52 40 0 12 yes blast cuuuggggugccuggccagccu ccggccaagccccccagcagg cuuuggggugccuggccagccugggugagguucugaugacuguuugcaggccggccaagccccccagcagg NW_006300377.1:3383342..3383413:-
MDA_11446_26463 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu NW_006292696.1:856115..856169:+
MDA_11092_25650 2.8e+1 60 58 0 2 no blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucagggggcuccgaauguguacaguagucugcacauugguu NW_006292342.1:844708..844770:-
MDA_1885_2230 2.8e+1 60 59 0 1 no blast ugacgccgcucugugccccu ugggcugccggccuccug ugacgccgcucugugccccuugggcugccggccuccug NW_006283135.1:25239..25277:-
MDA_15974_38266 2.7e+1 51 26 0 25 yes blast auguccgacugccgguuuagg uaaacaggcaguuggauaucc auguccgacugccgguuuaggcucaaucccuguggguuugagccuaaacaggcaguuggauaucc NW_006297224.1:1815080..1815145:-
MDA_14037_33504 2.7e+1 51 49 0 2 yes blast ucuggcaucuuggggucuccag agagacccgaaggagcgagaggaaa agagacccgaaggagcgagaggaaaggggugcucccucuggcaucuuggggucuccag NW_006295287.1:608964..609022:-
MDA_9953_23202 2.7e+1 50 29 1 20 yes blast cugaaaccggcagucugacacc uguuggacugcuaguuucagcc uguuggacugcuaguuucagcccaaucccuacaggccaccuggccuggaggauucgggcugaaaccggcagucugacacc NW_006291203.1:370797..370877:-
MDA_14569_34516 2.7e+1 50 49 0 1 yes blast ucucggcuccgcugaucacggg gcugaucccggggccag gcugaucccggggccaggacgccucucggcucugcugaucccaggguccugaggccucucggcuccgcugaucacggg NW_006295819.1:534957..535035:-
MDA_14308_33808 2.7e+1 50 49 0 1 yes blast caccagcagugggugugagugg cuggcaccggcugugggu caccagcagugggugugagugguggcucuggcaccggcugugggu NW_006295558.1:303022..303067:+
MDA_16808_39936 2.6e+1 49 20 0 29 yes blast ugccccugccuagaccuaacg uuaggccugggcaggggacc ugccccugccuagaccuaacgccucugacugaggcguuaggccugggcaggggacc NW_006298058.1:195316..195372:+
MDA_15281_36512 2.6e+1 48 32 0 16 yes blast cggccccaauugccccucaggag cugaggggcgauugggacc cggccccaauugccccucaggagcaggguagguggagaagcccugaggggcgauugggacc NW_006296531.1:186104..186165:-
MDA_101768_49904 2.6e+1 50 47 2 1 yes blast uccugaggggcaauuggggcug gccccgcucacccccca gccccgcucaccccccagggcuucuccaccucccccugcuccugaggggcaauuggggcug NW_006383018.1:9069403..9069464:-
MDA_101761_48569 2.6e+1 49 43 0 6 yes blast cuucgcucccuucuccgcug agcagagaagggagcgaagccc agcagagaagggagcgaagcccacugagacaggcuucgcucccuucuccgcug NW_006383011.1:14940765..14940818:+
MDA_2381_3472 2.6e+1 56 55 0 1 no blast gacuacaguggggccuugacu acgaguaucccgacuaacgaguuuuucgag gacuacaguggggccuugacuuaacgaguaucccgacuaacgaguuuuucgag NW_006283631.1:1644969..1645022:+
MDA_7603_16961 2.5e+1 46 44 0 2 yes blast uuggugaccgcugcucuggag ucuggagcagcggccacc ucuggagcagcggccaccaaccuuucaaaccucacggaccagcagugguucguggaccaccgguuggugaccgcugcucuggag NW_006288853.1:4275288..4275372:+
MDA_18786_44533 2.5e+1 46 36 0 10 yes blast cucggcaccaucagugggugug cacccgcugccagugccuggug cacccgcugccagugccuggugccagucccgaucacucggcaccaucagugggugug NW_006300036.1:5254031..5254088:+
MDA_10844_25052 2.4e+1 53 52 0 1 no blast cccccgugcagggcugucugug ggacacgcucagcaggugggaa cccccgugcagggcugucugugagggugcugcaaccaggacacgcucagcaggugggaa NW_006292094.1:7045550..7045609:+
MDA_4547_9149 2.4e+1 53 40 0 13 no blast ugggacugggugagaugggu caaccuccugcagucccucccca ugggacugggugagaugggucagacacgcccuggagccaaccuccugcagucccucccca NW_006285797.1:2444610..2444670:-
MDA_11838_27559 2.4e+1 45 32 0 13 yes blast ugguuacucugagaagucugaa uaggcuucucauaguaaucaga ugguuacucugagaagucugaaauaugugcuguuuaggcuucucauaguaaucaga NW_006293088.1:6360874..6360930:-
MDA_8166_18820 2.4e+1 43 13 0 30 yes blast aggggaugucagacugccaguu uggcaguccgacauccccugaga aggggaugucagacugccaguuucgacccaauccuagcaggccaggccuucagggaucgggccgaaacuggcaguccgacauccccugaga NW_006289416.1:3418538..3418629:-
MDA_15902_38106 2.3e+1 41 35 1 5 yes blast ugccuugaucgccccucaggagc ccucaggggcaaucagggccgg ugccuugaucgccccucaggagcagggggagauggagaagcccucaggggcaaucagggccgg NW_006297152.1:2227080..2227143:+
MDA_12450_28908 2.2e+1 41 17 0 24 yes blast agagaggcaaguucugaucaaca acagaccagacccugccucucu agagaggcaaguucugaucaacagcugccacaaaggcuacagaccagacccugccucucu NW_006293700.1:2532489..2532549:-
MDA_11198_25912 2.2e+1 39 38 0 1 yes blast cgccagcagugggugugaguggu acuugcaccugcugaug acuugcaccugcugauggugcugagugaucagagccggcgccagcagugggugugaguggu NW_006292448.1:8445..8506:-
MDA_17378_40758 2.1e+1 40 26 0 14 yes blast cacggaggccuggguugggaca ucucaccccagcccuccguccga cacggaggccuggguugggacauugggaauaaaaagcaauucuucuugcagucucaccccagcccuccguccga NW_006298628.1:982566..982640:+
MDA_11084_25531 2.1e+1 39 38 0 1 yes blast ugucaggccugggcaggggaa ccccuagcccaggccug ugucaggccugggcaggggaagcucauuucucccuaucacugguucuuccccuagcccaggccug NW_006292334.1:3114757..3114822:-
MDA_8433_19120 2.1e+1 47 38 2 7 no blast gccgccgccgccgcccgcc uugggcggguggccgggc uugggcggguggccgggcucauucucucgcucuuguuccucugcgccgccgccgccgcccgcc NW_006289683.1:86938..87001:-
MDA_13531_32232 2.1e+1 38 15 0 23 yes blast agaggcaagggcugaucagcag guggaucagacccugcuucu agaggcaagggcugaucagcagcugcuacagaggcuguggaucagacccugcuucu NW_006294781.1:68351..68407:+
MDA_14566_34326 2.1e+1 39 37 0 2 yes blast gaacgaaauccaagcgcagcug gcugcuuuugggauuccguugcc gaacgaaauccaagcgcagcuggaaugcucuggagacaacagcugcuuuugggauuccguugcc NW_006295816.1:1298687..1298751:+
MDA_19124_45967 2.1e+1 53 52 0 1 no blast aaugggcaguuugggaauuuaga aaauuuccaaacuguaauccuaga aaauuuccaaacuguaauccuagaagaaaugggcaguuugggaauuuaga NW_006300374.1:435737..435787:+
MDA_2576_4292 2.1e+1 37 35 0 2 yes blast cugaggggugaucagggcagu agccccgaucaccccucag agccccgaucaccccucagggcuucucuaucucccccugcuccugaggggugaucagggcagu NW_006283826.1:2392786..2392849:-
MDA_11446_26696 2.1e+1 40 21 0 19 yes blast ugaaccaggaggucagggaa ggccuggcugguguggcucagu ggccuggcugguguggcucagugguugaacaucaacuuaugaaccaggaggucagggaa NW_006292696.1:14030315..14030374:-
MDA_8303_18937 2.0e+1 45 43 0 2 no blast caccagggccgcgcucacaccu gugagggccggcuccuguggcua gugagggccggcuccuguggcuacaggggcucacaccagggccgcgcucacaccu NW_006289553.1:149572..149627:+
MDA_101763_49049 2.0e+1 36 33 1 2 yes blast ccugaggggcgaucagggcuggaa uggcccugauugccccucagggc uggcccugauugccccucagggcuucuccaccucccccuguuccugaggggcgaucagggcuggaa NW_006383013.1:8062844..8062910:+
MDA_6212_13361 2.0e+1 36 35 0 1 yes blast ccugaggggugauuggggccagu ugcccugauugccccucagg ugcccugauugccccucagggcuucuccacuuccccugcuccugaggggugauuggggccagu NW_006287462.1:762939..763002:+
MDA_10583_24665 2.0e+1 36 30 0 6 yes blast ucagagcggccuggguccugagg cccaggacccaggcugcuu ucagagcggccuggguccugaggacaccuaaccccaggacccaggcugcuu NW_006291833.1:398487..398538:-
MDA_4363_8408 2.0e+1 36 34 0 2 yes blast ugccccgauugccccucaggaa ccucaggggcgauuggggcag ugccccgauugccccucaggaauagggggagguagagaagcccucaggggcgauuggggcag NW_006285613.1:1468110..1468172:+
MDA_14566_34426 2.0e+1 44 42 0 2 no blast ugaccuccccuccgccacccag agggugcugggguggggucagg agggugcugggguggggucaggcgggguagccaagcccagggugcugaccuccccuccgccacccag NW_006295816.1:2206971..2207038:-
MDA_101756_47756 2.0e+1 35 33 0 2 yes blast ccugaggggcgaucggggccga ggccccgauugccccucaggag ggccccgauugccccucaggagcaaggggauuuggagaagcccugaggggcgaucggggccga NW_006383006.1:3707443..3707506:-
MDA_5730_12636 2.0e+1 35 27 0 8 yes blast cccugaggggcgaucggggcu acccugaucgccccuca acccugaucgccccucaggagcagggggcaguggagaagcccugaggggcgaucggggcu NW_006286980.1:1465381..1465441:-
MDA_1146_1060 1.9e+1 35 34 0 1 yes blast uagggaagauacacaggacuug agucuuguguaucuucccuaag uagggaagauacacaggacuugcuuuaagauggcaacaagucuuguguaucuucccuaag NW_006282396.1:1074848..1074908:+
MDA_2570_4233 1.9e+1 33 32 0 1 yes blast cuuguaccugcugauggcac ccagcagcaggugugag cuuguaccugcugauggcacugagugauuggggccagcagcaggugugag NW_006283820.1:31748..31798:-
MDA_17099_40370 1.8e+1 34 33 0 1 yes blast cuccaaucugagcucugccacu aggcagagcuuggcuuuggagccca aggcagagcuuggcuuuggagcccaacccacccagucuccaaucugagcucugccacu NW_006298349.1:1200516..1200574:-
MDA_101758_48000 1.8e+1 32 27 0 5 yes blast gacgcacccaggaaucagg gguuccgggugcgucacccaag gacgcacccaggaaucaggcucccucuucucugguuccgggugcgucacccaag NW_006383008.1:690003..690057:+
MDA_9436_22146 1.8e+1 32 30 1 1 yes blast cugccccaauugccccucaggau ccugaggggugauuggg cugccccaauugccccucaggaucagggggagguggagaagcccugaggggugauuggg NW_006290686.1:1140961..1141020:+
MDA_12710_29852 1.8e+1 42 41 0 1 no blast auucccagucaggacacaugccu guguggcucagugauugaacg guguggcucagugauugaacgucaacccaugaaccaggguucgauucccagucaggacacaugccu NW_006293960.1:291721..291787:-
MDA_101757_47969 1.8e+1 32 27 0 5 yes blast aagagggaugucugacugucggg cgggagucggacaucccccag aagagggaugucugacugucggguuagggccaauccccuaaaccgggagucggacaucccccag NW_006383007.1:3664765..3664829:-
MDA_12863_30149 1.7e+1 32 27 0 5 yes blast guuccaggugugucacccgag ucaggugacgcaccccaga ucaggugacgcaccccagaaucaggcucucucauuucugguuccaggugugucacccgag NW_006294113.1:1140763..1140823:+
MDA_18230_42443 1.7e+1 31 25 0 6 yes blast gugaggcagggugugugugugu cgggcacgcagcuugacucagc gugaggcagggugugugugugugcgugcccgcacaagggcacacgggcacgcagcuugacucagc NW_006299480.1:248231..248296:-
MDA_6579_14298 1.7e+1 31 16 0 15 yes blast cccccugguggccagugccug gcgcacuaaccaccaggggca gcgcacuaaccaccaggggcagcucuuccauugagagucuucccccugguggccagugccug NW_006287829.1:97825..97887:-
MDA_3689_6548 1.6e+1 37 34 0 3 no blast ugaggccgcuccguccccugcag accaggggaggacgagggccugg accaggggaggacgagggccuggcaguccgaccucuacugaggccgcuccguccccugcag NW_006284939.1:81174..81235:-
MDA_9382_21651 1.6e+1 29 28 0 1 yes blast guguccaacugccagcuuagg uaagcugucagucagacauc guguccaacugccagcuuaggcuccccacagggagcgggccuaagcugucagucagacauc NW_006290632.1:846283..846344:-
MDA_10299_24069 1.6e+1 27 25 0 2 yes blast ccucaccugagcccccgcccg ggcgggggcucaggcga ggcgggggcucaggcgaaagcaagugaugccaaucaccucaccugagcccccgcccg NW_006291549.1:524679..524736:+
MDA_9432_22116 1.6e+1 28 15 0 13 yes blast auggccggcuacugcgcguc cacacgcggauggccggcuacu cacacgcggauggccggcuacugcgcgucaugguuuccacaugcacacguggauggccggcuacugcgcguc NW_006290682.1:3055633..3055705:-
MDA_27531_46615 1.5e+1 27 25 0 2 yes blast acucaaacugugggggcacuu ugccgccucuguuugagcuccacc acucaaacugugggggcacuuucugugcugagagcaaagugccgccucuguuugagcuccacc NW_006308781.1:120..183:-
MDA_4890_9770 1.5e+1 28 27 0 1 yes blast agagaggcagggucugauu aucaguacuugccucucuaau agagaggcagggucugauucucagccucaauggcagcuuuugaucaguacuugccucucuaau NW_006286140.1:1091906..1091969:+
MDA_13103_30713 1.5e+1 35 33 0 2 no blast cugugggcacaggggcaggucu cccagccccucccacug cugugggcacaggggcaggucuuggcccauccuccaugcccccccccagccccucccacug NW_006294353.1:502809..502870:-
MDA_10570_24638 1.5e+1 26 15 0 11 yes blast cugugcgagucagcugugccu cccgcaggcggcucgcacaca cugugcgagucagcugugccugcucgugccugagagagcggggugagcgcccgcaggcggcucgcacaca NW_006291820.1:419510..419580:+
MDA_11817_27323 1.5e+1 26 17 0 9 yes blast aaaccggcagcuggacaucccu gauguccgacugccaguuuaggc gauguccgacugccaguuuaggcuugaucccacaggaaucaggccuaaaccggcagcuggacaucccu NW_006293067.1:838010..838078:+
MDA_3366_5813 1.5e+1 26 16 0 10 yes blast acuugcacccgcugacagcgcc gccagcagugggugcaaguggu acuugcacccgcugacagcgccgagcaaucgggccagcacugggcgccagcagugggugcaaguggu NW_006284616.1:238695..238762:-
MDA_8563_19758 1.4e+1 26 8 0 18 yes blast cagcagcuggacaucccccaag gagagggauguccgacugcuggu gagagggauguccgacugcuggugugcccgaucccuaauccagcagcuggacaucccccaag NW_006289813.1:14368602..14368664:-
MDA_13302_31098 1.4e+1 33 22 0 11 no blast gauauccgacugccagcuuagg cucacagucugggaccccu cucacagucugggaccccuugagggauauccgacugccagcuuagg NW_006294552.1:314296..314342:-
MDA_16145_38549 1.4e+1 25 20 0 5 yes blast cucagugccgucagugggugc cacccacugcuggugcccaguau cacccacugcuggugcccaguaucggucccaauugcucagugccgucagugggugc NW_006297395.1:599997..600053:+
MDA_7947_17837 1.4e+1 24 17 1 6 yes blast ucaggggugaucagggacagc ugcucugauugccccucaggag ugcucugauugccccucaggagcagggggagguggagaagcccucaggggugaucagggacagc NW_006289197.1:37972..38036:+
MDA_15163_36186 1.3e+1 33 31 0 2 no blast ucugaccagagcucucuccacagc aaguggggagccugccaggag aaguggggagccugccaggagggcaauguggaccagccucugaccagagcucucuccacagc NW_006296413.1:3537523..3537585:-
MDA_2294_3170 1.3e+1 22 16 5 1 yes blast ucagugggugugagcggggcuggu agccacugcucgcaccugcug agccacugcucgcaccugcugauggugccggccccaaucgcucugcgccgucagugggugugagcggggcuggu NW_006283544.1:3854651..3854725:-
MDA_16323_38713 1.3e+1 23 17 0 6 yes blast cugaggggugaucagggcau cugcccugaucgccccugaggg cugcccugaucgccccugagggcuucucuaccucuccugauccugaggggugaucagggcau NW_006297573.1:4441597..4441659:+
MDA_17378_40830 1.3e+1 23 14 0 9 yes blast aggggauguccgacuaauggcu uggcagucagacaucccucugg uggcagucagacaucccucuggcagcgugggagcccucaggggauguccgacuaauggcu NW_006298628.1:30828..30888:-
MDA_4529_8526 1.3e+1 23 6 0 17 yes blast ugcucauacccgcugauggcgc cgcuggcagugggugugaga ugcucauacccgcugauggcgccaagcaauugggaccagcauugagcgcuggcagugggugugaga NW_006285779.1:413361..413427:+
MDA_14813_35266 1.3e+1 23 20 0 3 yes blast aacuguuugcagaggaaacugaga ucagucucaucugcaaagaag aacuguuugcagaggaaacugagacuuuguaacuacaucucagucucaucugcaaagaag NW_006296063.1:457397..457457:+
MDA_17995_41500 1.3e+1 21 18 0 3 yes blast ugccccuaucgccccucaggag ccucaggggcaaucagggcca ugccccuaucgccccucaggagcaguggaaguuagaaaagcccucaggggcaaucagggcca NW_006299245.1:807708..807770:+
MDA_8166_18666 1.3e+1 22 14 0 8 yes blast cuuguaccugcugauggcg gccagcagugggugcgag cuuguaccugcugauggcgcugagcgauuggggccagugccagcagugggugcgag NW_006289416.1:1685093..1685149:+
MDA_12534_29491 1.2e+1 22 17 0 5 yes blast uccccgauugccccucaggag ccucagggacgaucagggccgg uccccgauugccccucaggagcagggggagguagagaagcccucagggacgaucagggccgg NW_006293784.1:8574698..8574760:-
MDA_26603_46610 1.2e+1 22 21 0 1 yes blast ucacugaucaccagggagcag ugcucccuggugaucagugcgc ucacugaucaccagggagcaguuccugaauugagcaucugcucccuggugaucagugcgc NW_006307853.1:156..216:+
MDA_7365_16492 1.2e+1 21 17 0 4 yes blast ugcgaguggggccggugcc ugcuggucccaaucgcucugcacug ugcuggucccaaucgcucugcacugucaguaagugcgaguggggccggugcc NW_006288615.1:2189521..2189573:-
MDA_7184_16019 1.2e+1 21 19 0 2 yes blast cugggcgccggcagcgggugc ugccagcagcaggugcaag cugggcgccggcagcgggugcgagcagaaccagugccagcagcaggugcaag NW_006288434.1:3361533..3361585:-
MDA_18786_44615 1.2e+1 20 15 0 5 yes blast uccuucuguggggcgaucgauc uugaucaccccacagauggag uccuucuguggggcgaucgaucugggggccccgcgauugaucaccccacagauggag NW_006300036.1:5228932..5228989:-
MDA_14483_34164 1.2e+1 21 16 0 5 yes blast ccugaggggcaaucgaggcca gccccaaucacccaucaggagc gccccaaucacccaucaggagcagggagagguggggaagcccugaggggcaaucgaggcca NW_006295733.1:58301..58362:-
MDA_9291_21451 1.2e+1 19 11 0 8 yes blast ccugaggggcaaucagggccgg ugcccugauugucccucaggag ugcccugauugucccucaggagcagggggagguggauaagcccugaggggcaaucagggccgg NW_006290541.1:844391..844454:-
MDA_3482_6020 1.2e+1 20 17 0 3 yes blast acuugcacccgcugcuggcacug ugccaucagcagguguaagugg acuugcacccgcugcuggcacuggccccaauugcucugugccaucagcagguguaagugg NW_006284732.1:1290415..1290475:+
MDA_18455_43212 1.2e+1 19 17 0 2 yes blast cugaggggugaucagggcau ggccccgaucaccccucag ggccccgaucaccccucagggcuucuccaccucacccugcuccugaggggugaucagggcau NW_006299705.1:5605799..5605861:-
MDA_8463_19276 1.2e+1 20 12 0 8 yes blast gucagucggacauccccugagagc cuaaggauguccgacugcc cuaaggauguccgacugccagcauaggccugcuucccuaggcugucagucggacauccccugagagc NW_006289713.1:4824991..4825058:-
MDA_5548_12166 1.2e+1 28 15 0 13 no