miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mlu/mlu_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mlu.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mlu/mlu_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mlu/mlu_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mlu.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mlu/mlu_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
105.67
95.57
85.47
75.47
65.37
55.27
45.17
35.57
267
11.97
017
-10.97
-21.17
-31.17
-41.17
-51.17
-61.17
-71.17
-81.17
-91.17
-101.17





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
MLU_65_16896 7.3e+6 14500243 14493765 0 6478 yes blast uauugcacuugucccggccugu agguugggaucaguugcaaugcu agguugggaucaguugcaaugcuguguuucucuaugguauugcacuugucccggccugu NW_005871112.1:4655955..4656014:-
MLU_3_2287 6.6e+6 13085302 13085221 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguguuauauauaaaguauugcacuugucccggccugu NW_005871050.1:5437578..5437639:+
MLU_172_25643 5.6e+6 11009519 10695311 0 314208 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaaaaaaccaccgaccguugacuguacc NW_005871221.1:1292832..1292892:-
MLU_2047_42544 5.4e+6 10695984 10695872 0 112 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaauuaaagucaaaaccaucgaccguugauuguacc NW_005873021.1:27263..27325:+
MLU_639_37192 6.5e+5 1286450 1286348 1 101 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc NW_005871680.1:357097..357170:+
MLU_15_8136 6.3e+5 1240566 1210969 28 29569 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuccccacuagauugugagcuccugga NW_005871062.1:6409528..6409590:-
MLU_61_16409 6.2e+5 1231625 1205391 47 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaggccacagaggggcuuucagucggauguuugcagc NW_005871107.1:3040875..3040938:-
MLU_156_24699 6.1e+5 1206513 769710 0 436803 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu NW_005871205.1:2601558..2601617:+
MLU_276_30174 4.6e+5 915326 915228 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuauacccugggaguuaacuguacaaccuucuagcuuucc NW_005871314.1:1252650..1252717:+
MLU_366_32778 4.5e+5 891392 881903 100 9389 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgcuuuguucacaguggcuaaguucug NW_005871408.1:481181..481243:-
MLU_252_29351 3.9e+5 774941 774150 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu NW_005871310.1:951200..951260:+
MLU_250_29297 3.0e+5 601971 600186 138 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaagaaauuuuguggucacaaauucguaucuaggggaau NW_005871302.1:962562..962624:-
MLU_120_22136 2.6e+5 513859 513853 0 6 yes blast uucaaguaauccaggauaggcu ccuauucuugauuacuuguuuc uucaaguaauccaggauaggcuguuuccaccugugaggccuauucuugauuacuuguuuc NW_005871167.1:1891895..1891955:+
MLU_325_31739 2.6e+5 513834 513704 4 126 yes blast uucaaguaauccaggauaggcu ccuauucucgguuacuugcacg uucaaguaauccaggauaggcugugcaggucccgaugggccuauucucgguuacuugcacg NW_005871367.1:38318..38379:-
MLU_6_4551 2.1e+5 413793 413593 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacauagucacagauucgauucuaggggaaua NW_005871053.1:7064781..7064843:-
MLU_192_26818 2.1e+5 413781 413280 5 496 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagguucuucauugcacccggcucggggcagcucaguacaggau NW_005871242.1:2270153..2270216:+
MLU_192_26837 2.0e+5 402273 402009 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagccgggugcaaugaagaaccucggggcagcucaguacaggau NW_005871242.1:2270152..2270215:-
MLU_20_9251 2.0e+5 401541 401340 11 190 yes blast ccucgacacaaggguuugu ugcuucugggucgggguu ugcuucugggucgggguuucauacauagcagagcagcucccuugcugcaaucagcccucgacacaaggguuugu NW_005871067.1:6241598..6241672:+
MLU_314_31399 1.6e+5 332242 328518 0 3724 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcuac uguaaacauccccgacuggaagcuguaagacagaacuaagcuuucagucagauguuugcuac NW_005871355.1:342045..342107:-
MLU_101_20420 1.5e+5 306447 286172 0 20275 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaucucauggcaacagcagucgaugggcugu NW_005871147.1:2300059..2300118:+
MLU_61_16406 1.4e+5 285180 285173 0 7 no blast uguaaacauccuacacucucagcu gagaguacugagugacagauac gagaguacugagugacagauacuguaaacauccuacacucucagcu NW_005871107.1:3018137..3018183:-
MLU_169_25495 1.0e+5 205288 205269 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc NW_005871217.1:498550..498622:-
MLU_639_37194 1.0e+5 202828 202771 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguaguuauuuuacccuguucaggagauaacuauacaaucuauugccuuccc NW_005871680.1:357476..357554:+
MLU_435_34413 8.6e+4 169770 169676 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaacauuaaacaccaauauuauugugcugcuuu NW_005871471.1:668641..668705:-
MLU_8_5429 8.6e+4 169525 169516 1 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaauuaucuccaguauuaacugugcugcugaa NW_005871055.1:8829524..8829588:-
MLU_993_40013 8.4e+4 165568 102230 0 63338 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucucauccccuacuagacugaagcuccuugagga NW_005872003.1:38444..38502:-
MLU_77_18210 6.6e+4 129615 129549 0 66 yes blast agcuacaucuggcuacugggucuc ggcucaguagucaguguagauc ggcucaguagucaguguagauccugucuuuuauaaucaguagcuacaucuggcuacugggucuc NW_005871124.1:4515870..4515934:-
MLU_388_33268 6.3e+4 124165 124098 18 49 yes blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucuuacugaagguuuccuggaaaccacgcacaugcuguugccacuaaccucaaccu NW_005871464.1:350600..350679:+
MLU_1_17 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga NW_005871048.1:701414..701474:+
MLU_210_27712 5.8e+4 114874 114797 0 77 yes blast uauugcacucgucccggccucc agggacgggacgcggugcagugu agggacgggacgcggugcaguguuguucuuucccccgccaauauugcacucgucccggccucc NW_005871259.1:2198423..2198486:-
MLU_54_15594 5.0e+4 99735 99636 0 99 yes blast uagguaguuuccuguuguuggg ucgacagcacgacacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgacacugccuuc NW_005871100.1:3749149..3749206:+
MLU_54_15593 5.0e+4 99637 99636 0 1 no blast uagguaguuuccuguuguuggg cggcggcgggcaagcaccagaacugg cggcggcgggcaagcaccagaacuggucggugauuuagguaguuuccuguuguuggg NW_005871100.1:3749114..3749171:+
MLU_3_2271 4.5e+4 89646 88752 0 894 yes blast caaaacgugaggcgcugcuau cagcagcaauucauguuuugaa cagcagcaauucauguuuugaagugcuuuacauaguucaaaacgugaggcgcugcuau NW_005871050.1:5135115..5135173:+
MLU_276_30176 4.3e+4 84559 45277 0 39282 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuucaguaacaucacaagucaggcucuugggaccu NW_005871314.1:1297436..1297497:+
MLU_38_13213 4.3e+4 84474 78788 87 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaggagcuuucagucggauguuuacagc NW_005871085.1:2513745..2513809:-
MLU_7610_44475 4.2e+4 83733 77673 1 6059 yes blast uaauacugccugguaaugaugac caucuuacugggcagcauugga caucuuacugggcagcauuggauggugucaggucucuaauacugccugguaaugaugac NW_005878639.1:5097..5156:+
MLU_275_30145 4.1e+4 81504 81041 0 463 no blast uccccggcaucuccacca guaugaggccccggguu guaugaggccccggguucguuccccggcaucuccacca NW_005871317.1:854746..854784:+
MLU_160_24972 4.0e+4 78799 78728 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuugaacucggcaacaagaaacugccuga NW_005871208.1:2443319..2443377:+
MLU_778_38737 3.9e+4 76636 76583 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc NW_005871822.1:226580..226659:-
MLU_10848_45057 3.5e+4 68707 64212 4479 16 no blast cagucgguccugagagaug cuuugaaggccgaagug cuuugaaggccgaaguggaaaaggguuccaugugaacagcaguugaacaugagucagucgguccugagagaug NW_005881875.1:1772..1845:+
MLU_250_29299 3.1e+4 60880 60786 0 94 yes blast uagguaguuucauguuguuggg caacgacauuaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacauuaaaccacccga NW_005871302.1:1014661..1014720:-
MLU_304_31078 2.9e+4 58116 58100 0 16 yes blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugaggacggaggccagacccaccgagggaugaaugucac NW_005871358.1:484707..484771:+
MLU_435_34415 2.7e+4 53190 52227 1 962 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauacuauagucaagaugcgaaucauuauuugcugcucu NW_005871471.1:668788..668847:-
MLU_1048_40367 2.6e+4 51628 51509 0 119 no blast ugauuagaggucuuggggc aucucaaccuauucucaaacu ugauuagaggucuuggggcugaaacgaucucaaccuauucucaaacu NW_005872051.1:78416..78463:-
MLU_2045_42538 2.6e+4 51628 51509 0 119 no blast ugauuagaggucuuggggc aucucaaccuauucucaaacu ugauuagaggucuuggggcugaaacgaucucaaccuauucucaaacu NW_005873268.1:16442..16489:+
MLU_598_36795 2.5e+4 50671 45487 0 5184 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggag NW_005871635.1:389540..389600:-
MLU_1_16 2.4e+4 48904 48224 0 680 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuucccga caaagugcuguucgugcagguagugugauuaccugaccuacugcugagcuagcacuucccga NW_005871048.1:701210..701272:+
MLU_639_37195 2.4e+4 48755 31435 15 17305 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuagggcagggauuuugcccacaaggagguaacuauacgaccugcugccuuucu NW_005871680.1:360029..360105:+
MLU_77_18208 2.4e+4 47153 45507 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguuaagcaacagcuacauugucugcuggguuu NW_005871124.1:4515185..4515247:-
MLU_160_24977 2.1e+4 42334 39047 18 3269 yes blast uccgagccugggucucccucu ggggguccccggugcucggau ggggguccccggugcucggaucuugagggugcuuauuguucgguccgagccugggucucccucu NW_005871208.1:2484860..2484924:+
MLU_366_32780 2.1e+4 41569 41443 0 126 yes blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauuaaaaucacauugccagggauuaccacg NW_005871408.1:481404..481465:-
MLU_205_27468 2.0e+4 39488 39326 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc NW_005871250.1:120900..120960:-
MLU_46_14434 1.8e+4 36653 36647 1 5 yes blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaaugggauccggugguucuagacuugccaacu NW_005871094.1:6867647..6867711:+
MLU_11_6580 1.7e+4 35068 33637 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa NW_005871058.1:6544289..6544346:-
MLU_1570_41906 1.6e+4 31536 29983 827 726 no blast ugccgggguuguggcucgcgc cgcggggucgcgccccgggga ugccgggguuguggcucgcgccgaggccgagucgugcgcggggucgcgccccgggga NW_005872786.1:40609..40666:+
MLU_50_15068 1.5e+4 31027 26174 0 4853 yes blast cacgcucaugcacacacccaca ugagugugugugugugagugu ugagugugugugugugagugugugucgcucggguccacgcucaugcacacacccaca NW_005871096.1:5577244..5577301:-
MLU_30_11742 1.5e+4 30709 29983 0 726 no blast ugccgggguuguggcucgcgc cgcggggucgcgccccgggga ugccgggguuguggcucgcgccgaggccgggucgugcgcggggucgcgccccgggga NW_005871077.1:9814205..9814262:+
MLU_87_19179 1.4e+4 29375 29020 0 355 yes blast gagagaucagaggcgcagagu ccugugccuuuuaccucuuuaa gagagaucagaggcgcagagugcgucaaugucaaugaagccugugccuuuuaccucuuuaa NW_005871132.1:2910196..2910257:-
MLU_90_19317 1.4e+4 29088 28951 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac NW_005871136.1:987446..987508:+
MLU_315_31436 1.4e+4 27737 20944 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu NW_005871360.1:999466..999522:-
MLU_100_20382 1.2e+4 24403 24333 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca NW_005871145.1:1167013..1167074:-
MLU_1_13 1.2e+4 24172 19048 1438 3686 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccucucgugcuaccgcacuguggguacuugcu NW_005871048.1:700995..701054:+
MLU_3_2273 1.0e+4 21331 18189 5 3137 yes blast gaguauuguuucugcugcccgg uagcagcgggaacaguacug uagcagcgggaacaguacugcaguggguuauccguauucuggaguauuguuucugcugcccgg NW_005871050.1:5135424..5135487:+
MLU_304_31076 1.0e+4 20989 18901 0 2088 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc NW_005871358.1:484534..484595:+
MLU_199_27187 9.8e+3 19331 19322 0 9 yes blast ucacagugaaccggucucuuu gggggccgaugcacuguacgaga gggggccgaugcacuguacgagagugaguagcaggucucacagugaaccggucucuuu NW_005871243.1:894327..894385:+
MLU_63_16633 9.7e+3 19046 19041 0 5 yes blast uuagggcccuggcuccaucuccu aguggggcuuugacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuuugacccuaacc NW_005871110.1:2999990..3000055:-
MLU_174_25775 8.1e+3 16090 16080 3 7 no blast gacacgugaugcugggcugaug gccaacuagcggugggguaucugaagcu gacacgugaugcugggcugauguaguggcguucacugugacguucgcugcgccaacuagcggugggguaucugaagcu NW_005871219.1:917981..918059:-
MLU_24_10568 8.0e+3 15858 15411 0 447 yes blast uggcagucagacauccucugagg gagagggauguccgacugcca gagagggauguccgacugccaguuuaggaccgaucccuacaggauggcgccuaaacuggcagucagacauccucugagg NW_005871072.1:1508534..1508613:-
MLU_10093_44940 7.8e+3 15385 15384 0 1 no blast uggcagucagacauccucugagg gcgagagggugcaggccg uggcagucagacauccucugaggggucccagauugcgagagggugcaggccg NW_005881128.1:3709..3761:+
MLU_578_36527 7.4e+3 14571 14564 0 7 yes blast acgcccuucccccccuucuuca aggagggaggagaggggccacg aggagggaggagaggggccacguucccucugccuggaacgcccuucccccccuucuuca NW_005871630.1:418157..418216:+
MLU_46_14405 7.2e+3 14257 14226 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauagaauuuucuagcaccaucugaaaucgguua NW_005871094.1:5882468..5882528:+
MLU_1_1179 6.0e+3 11875 11815 2 58 yes blast ugcacugaccuccagggagcag ugcccccugguggucagugcu ugcacugaccuccagggagcagauaaucaacacaggagcugcccccugguggucagugcu NW_005871048.1:44165162..44165222:-
MLU_204_27442 5.9e+3 11590 11584 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu NW_005871248.1:768403..768463:-
MLU_575_36467 5.9e+3 11590 11584 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucaacuguucaauggauuugguccccuucaaccagcugu NW_005871604.1:420360..420420:+
MLU_499_35578 5.6e+3 11053 11049 0 4 yes blast ucgccaaccuuucggaccucacg gcgggccguaguuugagg gcgggccguaguuugaggaccccugcucuagggcagcggucgccaaccuuucggaccucacg NW_005871534.1:325637..325699:-
MLU_1150_40851 5.1e+3 10103 8321 3 1779 yes blast ucccuguccuccaggagcuc agcuccucggggccagagccc ucccuguccuccaggagcucaccugcguccggccgugagcuccucggggccagagccc NW_005872159.1:4930..4988:-
MLU_193_26873 5.0e+3 9848 9298 0 550 yes blast augcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcuuucugaaugcaaugcaccugggcaaggauucuga NW_005871244.1:1439519..1439581:+
MLU_65_16905 4.9e+3 9716 8484 0 1232 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua NW_005871112.1:4656656..4656714:-
MLU_3_2448 4.9e+3 9678 9659 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucuuaaacaucuagcaaaucauuuuuuacucucca NW_005871050.1:17127905..17127966:+
MLU_433_34382 4.8e+3 9572 7342 1 2229 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcacauagaauugucucacacagaaaucgcacccguc NW_005871512.1:447594..447659:-
MLU_318_31522 4.3e+3 8591 8590 0 1 yes blast cacgcucaugcacacacccac gggugcgggcaugugagugu gggugcgggcaugugaguguaugugugugaguaugugucgcucagguucacgcucaugcacacacccac NW_005871375.1:178103..178172:-
MLU_207_27557 4.3e+3 8588 8580 5 3 yes blast ugcacugaccuccagggagcag ugccccaugguggucagugca ugcacugaccuccagggagcagcuccugcauugagcaucugccccaugguggucagugca NW_005871252.1:1309512..1309572:-
MLU_226_28401 4.3e+3 8446 8444 0 2 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc NW_005871269.1:1482198..1482257:-
MLU_10296_44971 4.3e+3 8446 8444 0 2 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc NW_005881330.1:4642..4701:-
MLU_193_26863 4.2e+3 8303 7350 0 953 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguugucaucuuaauuacccucccacacccaaggcuugca NW_005871244.1:1431923..1431982:+
MLU_18_8877 4.1e+3 8182 8161 6 15 no blast cagcugaucgauguuucuc gggcaugugccuugguugcgggc gggcaugugccuugguugcgggcacauccccgguggggagugugcaggaggcagcugaucgauguuucuc NW_005871065.1:12500483..12500553:-
MLU_310_31268 4.1e+3 8124 7180 0 944 yes blast uccgguucucagggcuccacc aggaagcccuggaggggcuggagg aggaagcccuggaggggcuggaggugauggauguguuccuccgguucucagggcuccacc NW_005871384.1:305658..305718:-
MLU_6_4294 3.8e+3 7566 7377 133 56 no blast ucuggcuccgugucuucacuccc gagggagggacgggggcugugc ucuggcuccgugucuucacucccguguguguccgaggagggagggagggacgggggcugugc NW_005871053.1:719721..719783:+
MLU_1237_41183 3.8e+3 7553 6715 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau NW_005872250.1:56833..56893:-
MLU_169_25493 3.7e+3 7442 7432 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugugggguagggauuuaaggccccaauagaagauaacuauacaacuuacuacuuuccc NW_005871217.1:497726..497807:-
MLU_641_37231 3.7e+3 7366 6308 5 1053 yes blast gggacucuugugugaccuccgg gagaucacacacgagucccccu gagaucacacacgagucccccucucuccacccuggggggacucuugugugaccuccgg NW_005871668.1:317001..317059:+
MLU_29_11529 3.5e+3 6979 6971 0 8 yes blast ucccuccuuucccuuccucu gaggaagggagacggcggg ucccuccuuucccuuccucucccgaccggcucacccgggaggaagggagacggcggg NW_005871074.1:1793104..1793161:-
MLU_314_31397 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaauacauggauuggcugggagguggauguuuacuuc NW_005871355.1:336531..336591:-
MLU_5_3727 3.4e+3 6740 4484 0 2256 yes blast ucccccaggugugauucugauuug uuaucagaaucuccagggguac uuaucagaaucuccagggguacuuauaauuugaaaaagucccccaggugugauucugauuug NW_005871052.1:1047232..1047294:+
MLU_325_31736 3.3e+3 6639 6543 0 96 yes blast agcugguguugugaaucaggccg gcuacuucacaacaccagggu agcugguguugugaaucaggccguugccaaucagagaacggcuacuucacaacaccagggu NW_005871367.1:901222..901283:+
MLU_54_15603 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucugaguaugauagcagucagugcacuacagaacuuugu NW_005871100.1:4580871..4580931:+
MLU_276_30172 2.9e+3 5874 5061 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu NW_005871314.1:1251927..1251987:+
MLU_164_25214 2.8e+3 5594 5491 0 103 yes blast ugagaacugaauuccauaggcugu ugcccuagggacucaguucug ugagaacugaauuccauaggcugugagcucuagcaaaugcccuagggacucaguucug NW_005871210.1:903642..903700:+
MLU_46_14430 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa NW_005871094.1:6863338..6863400:+
MLU_3_2207 2.6e+3 5163 5003 0 160 yes blast gucaacacuugcugguuuccucu gggagccaggaaguauugauguu gggagccaggaaguauugauguuucugccaguuuagcgucaacacuugcugguuuccucu NW_005871050.1:593170..593230:+
MLU_439_34474 2.5e+3 5043 4976 0 67 no blast caagugcacgcgcuuugggac uucacaaagcccauacacuucac caagugcacgcgcuuugggacagugaagcaaagaauguucacaaagcccauacacuucac NW_005871480.1:242702..242762:-
MLU_65_16904 2.3e+3 4710 4487 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug NW_005871112.1:4656512..4656575:-
MLU_156_24712 2.3e+3 4541 2992 0 1549 yes blast uaaugccccuaaaaauccuuau aagggacuuucaggggcagcugu aagggacuuucaggggcagcuguguuuucugacucaagucauaaugccccuaaaaauccuuau NW_005871205.1:110896..110959:-
MLU_520_35847 2.0e+3 3998 3996 0 2 yes blast ugcccugaucgccccuuaggag ccucagggacaaucagggccagc ugcccugaucgccccuuaggagcagagggagguggagaagcccucagggacaaucagggccagc NW_005871559.1:457701..457765:-
MLU_208_27593 1.9e+3 3851 3570 0 281 yes blast cuccuggggcccgcacucuugc uggggagcggcccccgggcggg uggggagcggcccccgggcgggccucugcucuggccccuccuggggcccgcacucuugc NW_005871266.1:2200460..2200519:+
MLU_2507_42993 1.9e+3 3787 3266 0 521 yes blast ugggucuuugcgggcgagauga aacuggccuacaaagucccagu ugggucuuugcgggcgagaugagggugucgguucaacuggccuacaaagucccagu NW_005873494.1:7967..8023:-
MLU_1512_41789 1.6e+3 3282 2949 26 307 no blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauugguguaaagcuggagacccacugccccaggugcugcug NW_005872638.1:9688..9744:+
MLU_3_2289 1.6e+3 3242 3211 0 31 yes blast aauugcacgguauccaucugu cggguggaucacgaugcaauuuu cggguggaucacgaugcaauuuugauuaguauaauaggugaaaaauugcacgguauccaucugu NW_005871050.1:5437732..5437796:+
MLU_103_20605 1.5e+3 3118 3102 0 16 no blast uagaaacguccagaggcaccgga cgggucccugugacguucccaga cgggucccugugacguucccagaagauucaugcugacaccuagaaacguccagaggcaccgga NW_005871151.1:2033536..2033599:+
MLU_59_16105 1.5e+3 3103 1738 0 1365 yes blast cgcggaccaucgguuggcgacc ucgccaaccuuucggaccucac ucgccaaccuuucggaccucacagaccaccagugguccgcggaccaucgguuggcgacc NW_005871108.1:3507443..3507502:+
MLU_7610_44477 1.4e+3 2799 2416 1 382 yes blast uaacacugucugguaacgauguu caucuuaccggacagugcugga caucuuaccggacagugcuggauuucucggcucgacucuaacacugucugguaacgauguu NW_005878639.1:5641..5702:+
MLU_155_24597 1.4e+3 2751 2685 0 66 yes blast aggccagcagucggacaucccc gauguccgacugccagcuuagg gauguccgacugccagcuuaggcagggagcaggccuaggccagcagucggacaucccc NW_005871204.1:436124..436182:+
MLU_9_5745 1.3e+3 2710 2687 22 1 yes blast uuuccggaggaugaggcccaga cugggccucauccuccgga cugggccucauccuccggaauuguuucuuuguuacuaauguuguggccccaccccauaacaaagaaacagaguuuccggaggaugaggcccaga NW_005871056.1:16227146..16227240:+
MLU_393_33393 1.3e+3 2622 2082 0 540 yes blast cguggaccaucgguuggcgacc ucgccaaccuuucgggccucacg ucgccaaccuuucgggccucacgaaccuccagugguccguggaccaucgguuggcgacc NW_005871478.1:88547..88606:-
MLU_309_31233 1.2e+3 2526 2473 0 53 yes blast acugguuuaggccugaucccagga ccgggaucgggucuaaacuggca acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaacuggca NW_005871352.1:994390..994447:-
MLU_104_20726 1.2e+3 2501 1243 0 1258 yes blast acccgcugcuggugcccggcg cucggcgcugucagcgggugu acccgcugcuggugcccggcgcuggcccugauugcucggcgcugucagcgggugu NW_005871150.1:1470254..1470309:-
MLU_148_24133 1.2e+3 2498 2473 0 25 yes blast acugguuuaggccugaucccagga cgggaucgggucuaaaccggc acugguuuaggccugaucccaggauguccgacugccgggaucgggucuaaaccggc NW_005871197.1:2479983..2480039:-
MLU_114_21621 1.1e+3 2256 2241 0 15 yes blast agccgugaucgccccucaggaa ccugaggggcgaucggggcca agccgugaucgccccucaggaacagggaggaguggagaagcccugaggggcgaucggggcca NW_005871160.1:727500..727562:-
MLU_65_16899 1.1e+3 2155 2146 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu NW_005871112.1:4656207..4656266:-
MLU_99_20210 1.0e+3 2104 2084 0 20 yes blast cgcggaccaucgguuggcgacc gucgccaaccuuuuggaccucacggaccac cgcggaccaucgguuggcgaccguugcuccaaagguuuccuuagccaguggucgccaaccuuuuggaccucacggaccac NW_005871148.1:3444342..3444422:+
MLU_607_36924 1.0e+3 2104 2084 0 20 yes blast cgcggaccaucgguuggcgacc ucgccaaccuuucggacc ucgccaaccuuucggaccccauggaccaccagugguccgcggaccaucgguuggcgacc NW_005871710.1:106306..106365:-
MLU_2_1775 1.0e+3 2105 2098 0 7 yes blast uacgucaucguugucaucauca guggugacgccgauggugcgagc guggugacgccgauggugcgagcuggaaauggggugcuacgucaucguugucaucauca NW_005871049.1:36516301..36516360:+
MLU_29_11603 1.0e+3 2106 2095 9 2 no blast agcuggcagguagacauccccc agggugcaggccuggcug agcuggcagguagacaucccccgaggggucccagacugugagagggugcaggccuggcug NW_005871074.1:9895524..9895584:-
MLU_85_18960 1.0e+3 2101 1829 0 272 no blast ugcccaggucggaaggagcug gccucuuuccuccugugcaga gccucuuuccuccugugcagagagacuucucuggcucugcccaggucggaaggagcug NW_005871133.1:2220685..2220743:-
MLU_203_27384 1.0e+3 2014 2011 0 3 yes blast aggccagcagucggacaucccc gauguucaacugcuggcuuagg gauguucaacugcuggcuuaggccugcuccccacggcuaaggccagcagucggacaucccc NW_005871254.1:175790..175851:-
MLU_310_31272 1.0e+3 2017 1720 0 297 no blast ggcuccccagcgcugccucucu aggggccacacucgggugacc aggggccacacucgggugaccuuggguauuuaguacgaaggcuccccagcgcugccucucu NW_005871384.1:413647..413708:-
MLU_277_30207 9.9e+2 1956 1654 0 302 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugauggugcccuccccaggggcuggcuuuccucuggu NW_005871324.1:1646254..1646310:+
MLU_1237_41188 9.9e+2 1956 1654 0 302 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu NW_005872250.1:82741..82797:-
MLU_31_11925 9.7e+2 1905 1893 0 12 yes blast aggccagcagucggacaucccc gauguccgacugccaguuuaggc gauguccgacugccaguuuaggcccaguccccacaggccaggccagcagucggacaucccc NW_005871080.1:2444678..2444739:+
MLU_198_27144 9.6e+2 1894 1827 0 67 yes blast cuuggcaccuaguaagcacuca agugccugcuaugugccagg cuuggcaccuaguaagcacucaguaaauacuuguugagugccugcuaugugccagg NW_005871256.1:1386185..1386241:+
MLU_829_39107 8.9e+2 1772 1767 0 5 no blast acuuuagcuucugcguucucuuu aagagggucaggagucagca acuuuagcuucugcguucucuuuugccaauaaacugcccuaauccauaaaagagggucaggagucagca NW_005871872.1:188190..188259:-
MLU_36_12830 8.8e+2 1729 1710 1 18 yes blast ccucaggggcgaucagggccga ugccccgauugccccucaggag ugccccgauugccccucaggagcagggggagguagagaagcccucaggggcgaucagggccga NW_005871083.1:2173426..2173489:-
MLU_83_18804 8.7e+2 1715 1707 1 7 yes blast ccucaggggcgaucagggccga ugcccugaucaccccucaggag ugcccugaucaccccucaggagcgggggagguggagaagcccucaggggcgaucagggccga NW_005871131.1:3411206..3411268:-
MLU_1_257 8.6e+2 1710 1705 0 5 no blast aagguuauagaaauuucagacaguc cgguuugaggccuugcccug cgguuugaggccuugcccugcugcauccaaagcaagguuauagaaauuucagacaguc NW_005871048.1:21560540..21560598:+
MLU_4_3495 8.3e+2 1632 1631 0 1 yes blast ucgugcacugggccucuag agaggcccgaugcacagaauucg ucgugcacugggccucuagcguaaguuauaagaaacuagaggcccgaugcacagaauucg NW_005871051.1:3478777..3478837:-
MLU_10_6034 8.0e+2 1576 1574 0 2 yes blast uggccccaauugccccucaggac ccugaggggagauaagggcuggua uggccccaauugccccucaggacuuuucuaccuccccugcuccugaggggagauaagggcuggua NW_005871057.1:9916073..9916138:+
MLU_106_20880 8.0e+2 1575 1573 0 2 yes blast uggccccaauugccccucaggac ccugaggggcgaucagggc uggccccaauugccccucaggacuucucuaccucccccugcuccugaggggcgaucagggc NW_005871153.1:983945..984006:+
MLU_126_22542 7.8e+2 1544 1464 0 80 yes blast ucaggggaugucugacugccaga acuggcagucggacaucccucu ucaggggaugucugacugccagacagggaucgagccuaaacuggcagucggacaucccucu NW_005871183.1:2441238..2441299:+
MLU_253_29397 7.5e+2 1479 1058 4 417 yes blast cacuggggugccuggccagccu ucuggccaagccccccagcagg cacuggggugccuggccagccugggugaggggcugauggcuguuugcagucuggccaagccccccagcagg NW_005871312.1:1804121..1804192:+
MLU_517_35806 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu NW_005871552.1:170174..170233:-
MLU_49_14930 6.9e+2 1372 1365 1 6 yes blast ucgugcacugggccucuaaa agggcucccagacugcaagaagg agggcucccagacugcaagaaggcacaggcugggcugggugacacccccuccccccaagugcauaaauuucgugcacugggccucuaaa NW_005871099.1:6948928..6949017:-
MLU_963_39864 6.5e+2 1276 1030 11 235 yes blast cacuggggugccuggccagccu cuggccaagccccccagcgga cacuggggugccuggccagccuaggugaggggcugauggcuguuugcaggcuggccaagccccccagcgga NW_005872001.1:141970..142041:-
MLU_580_36565 6.4e+2 1259 1258 0 1 yes blast cucggcgcugucagcgggugu caccugcugccagcgcccugu caccugcugccagcgcccugugcuaguuccgaucgcucggcgcugucagcgggugu NW_005871621.1:344698..344754:+
MLU_17_8602 6.4e+2 1254 1133 0 121 yes blast ccuaaggggcaaucggggcca ugccccaaucgccccucaggag ugccccaaucgccccucaggagcagggggagauggaaaagcccuaaggggcaaucggggcca NW_005871063.1:5981451..5981513:-
MLU_225_28321 6.2e+2 1226 1216 0 10 yes blast ccuaaggggcaaucggggcca agcccugaucgccccucaag agcccugaucgccccucaagguuucuccacaucccccugcuccuaaggggcaaucggggcca NW_005871272.1:1858306..1858368:+
MLU_36_12805 6.2e+2 1224 1058 9 157 yes blast cacuggggugccuggccagccu cuggccaggccccccagcgggg cacuggggugccuggccagccugggugaggggaugauggcuguuugcaggcuggccaggccccccagcgggg NW_005871083.1:8435662..8435734:+
MLU_249_29246 6.2e+2 1215 1058 0 157 yes blast cacuggggugccuggccagccu cuggccaggccccccagcgggg cacuggggugccuggccagccugggugaggggcugauugcuguuugcaggcuggccaggccccccagcgggg NW_005871288.1:1789672..1789744:-
MLU_663_37433 6.0e+2 1179 1058 0 121 yes blast cacuggggugccuggccagccu gcuggccaagccccccagcagga cacuggggugccuggccagccugggugaggggcugaaugucugucugcaugcuggccaagccccccagcagga NW_005871698.1:221106..221179:+
MLU_15_7953 6.0e+2 1178 1166 0 12 yes blast aagcuggcagucggacauccuc gauguccgacugccaguuuaggc gauguccgacugccaguuuaggcccgcuccccacugagcaggccuaagcuggcagucggacauccuc NW_005871062.1:1916669..1916736:+
MLU_252_29345 5.8e+2 1148 1088 1 59 yes blast uaacagucuacagccauggucg accguggcuuucgauuguuacu accguggcuuucgauuguuacugugggaaccggagguaacagucuacagccauggucg NW_005871310.1:705131..705189:+
MLU_416_33940 5.8e+2 1139 1058 13 68 yes blast cacuggggugccuggccagccu gcuggccaagccccccagcgggaa cacuggggugccuggccagccugggugagggacugauggcuguuugcaggcuggccaagccccccagcgggaa NW_005871452.1:518046..518119:-
MLU_108_21166 5.5e+2 1084 1058 0 26 yes blast cacuggggugccuggccagccu cuggccaagccccccaguggag cacuggggugccuggccagccugggugaggggcugauagcuguuugcaggcuggccaagccccccaguggag NW_005871152.1:357143..357215:-
MLU_63_16640 5.5e+2 1084 1058 0 26 yes blast cacuggggugccuggccagccu cuggccaagccccccaguggag cacuggggugccuggccagccugggugaggggcucauggcuguucgcaggcuggccaagccccccaguggag NW_005871110.1:3750789..3750861:-
MLU_17_8658 5.5e+2 1082 1058 2 22 yes blast cacuggggugccuggccagccu gcuggccaagccccccagu cacuggggugccuggccagccugggugaggggcugauggcuguuucaggcuggccaagccccccagu NW_005871063.1:11665170..11665237:-
MLU_135_23221 5.5e+2 1080 1078 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucuggaagguacaguacugugauaacugaa NW_005871178.1:2915675..2915732:+
MLU_1_1046 5.5e+2 1077 1058 1 18 yes blast cacuggggugccuggccagccu cuggccaagucccccagcaggg cacuggggugccuggccagccugggugaggggcucauggcuguuugcaggcuggccaagucccccagcaggg NW_005871048.1:29107102..29107174:-
MLU_1136_40783 5.5e+2 1077 1071 0 6 yes blast cacuggggugccuggccagccu agcuggucacacacccuucaggguggggguc cacuggggugccuggccagccuggaagaggggaugauggcuauuugcagcuggucacacacccuucaggguggggguc NW_005872203.1:7472..7550:-
MLU_64_16758 5.4e+2 1066 1065 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa NW_005871111.1:3880691..3880748:-
MLU_65_16898 5.4e+2 1058 1049 0 9 yes blast ugugcaaauccaugcaaaacuga aguuuugcagguuugcauccagc aguuuugcagguuugcauccagcugugugauauucugcugugcaaauccaugcaaaacuga NW_005871112.1:4656070..4656131:-
MLU_23_10293 5.4e+2 1057 1029 10 18 yes blast auugcacugaucaccaaggggc cccccugguggucagug auugcacugaucaccaaggggcagcuccugcauugagcaucugcccccugguggucagug NW_005871069.1:5357465..5357525:-
MLU_77_18153 5.3e+2 1040 954 0 86 yes blast uugaucagcauugccucucucu agagaggcagggucugauc agagaggcagggucugaucugcagccucaguggcagcuguugaucagcauugccucucucu NW_005871124.1:4678590..4678651:+
MLU_106_20940 5.0e+2 985 946 0 39 yes blast ucaggcuuggacaggggacc ccuugcccaggccugacgccu ccuugcccaggccugacgccuccgccagaggugucaggcuuggacaggggacc NW_005871153.1:317953..318006:-
MLU_128_22682 4.9e+2 973 972 0 1 yes blast uguaacagcaacuccaugugga ccaguggagaugcuguuacuu uguaacagcaacuccauguggacugcguaccaauuuccaguggagaugcuguuacuu NW_005871181.1:118335..118392:+
MLU_15_8179 4.9e+2 957 951 1 5 yes blast uggccccaauugccccucaggag cugaggggcaauuggggccagc uggccccaauugccccucaggagcagggggaaguggagaagcccugaggggcaauuggggccagc NW_005871062.1:9748167..9748232:-
MLU_52_15407 4.8e+2 954 951 0 3 yes blast uggccccaauugccccucaggag ccugaggggugaucugggcc uggccccaauugccccucaggagcagagggagguggagaagcccugaggggugaucugggcc NW_005871097.1:4988827..4988889:-
MLU_719_38087 4.8e+2 952 951 0 1 yes blast uggccccaauugccccucaggag ccugaggggcaauugggg uggccccaauugccccucaggagcaggggcaaguggagaagcccugaggggcaauugggg NW_005871741.1:164039..164099:-
MLU_1239_41192 4.8e+2 953 952 0 1 yes blast uucccuuugucauccuuugccuc gcagggacggcaaaggggugc uucccuuugucauccuuugccucgggcucggagcggggcagggacggcaaaggggugc NW_005872262.1:15008..15066:+
MLU_13_7052 4.3e+2 846 636 0 210 yes blast ucugcugcagccagagcgga ucgcugcggcuggagcggaga ucugcugcagccagagcggaggagccaagccucgcugcggcuggagcggaga NW_005871061.1:1276157..1276209:+
MLU_568_36379 4.1e+2 819 767 0 52 yes blast uguaacagcaacuccaugugga ccaguggggcugcuguuaucugg uguaacagcaacuccauguggaagugcccacucguuccaguggggcugcuguuaucugg NW_005871610.1:136772..136831:-
MLU_802_38877 4.1e+2 808 478 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg NW_005871871.1:113331..113395:-
MLU_3268_43401 3.9e+2 776 749 0 27 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuaua uugggcuuacuccucacagguggcagaauacuauggccguccugugacauuacgcccuaua NW_005874255.1:12536..12597:-
MLU_13_7181 3.9e+2 772 749 0 23 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuauau uugggcuuacuccucacagguggcaggauaccaugaccuuccugugacauuacgcccuauau NW_005871061.1:10373694..10373756:+
MLU_3_2439 3.8e+2 768 749 0 19 yes blast uugggcuuacuccucacaggugg uccugugacauuacgcccuauau uugggcuuacuccucacagguggcaggauaccaugaccuuccugugacauuacgcccuauau NW_005871050.1:17008833..17008895:+
MLU_2_1990 3.8e+2 754 729 0 25 yes blast ucugcccccugguugucaaugc cacacugaccaccaggggg cacacugaccaccagggggaagcuccugcauugagcaucugcccccugguugucaaugc NW_005871049.1:19081218..19081277:-
MLU_84_18849 3.8e+2 751 750 0 1 yes blast uaagccagcagucggacaucc gaugucugauugccagcuuaggc gaugucugauugccagcuuaggcccucuccccuaggggagcgggucuaagccagcagucggacaucc NW_005871130.1:4309509..4309576:+
MLU_237_28779 3.8e+2 744 723 0 21 yes blast ucugcccccugguugucaaugc gcacugaccaccaggggacagu gcacugaccaccaggggacaguuccugcauugagcaucugcccccugguugucaaugc NW_005871279.1:923977..924035:+
MLU_569_36401 3.6e+2 717 589 0 128 yes blast cuaagcuggcagguggacaucc aaugucugccugccggcuuagg aaugucugccugccggcuuaggcccgauccccuaagcuggcagguggacaucc NW_005871602.1:111124..111177:-
MLU_128_22702 3.5e+2 688 683 0 5 yes blast ucaccaaccuuucggcccucacg ggaccacugguuggcgaccgc ucaccaaccuuucggcccucacggaccacuagggguccguggaccacugguuggcgaccgc NW_005871181.1:2055274..2055335:+
MLU_746_38361 3.4e+2 675 468 0 207 no blast ccccgguccgacggagcacuuc aagggcuguuuugguaccggaaa ccccgguccgacggagcacuucaguuaaugggaauagaagggcuguuuugguaccggaaa NW_005871774.1:229263..229323:-
MLU_102_20527 3.4e+2 665 661 0 4 yes blast cuaggcuggcagguggacaucc auguccgacugcagcuuagg auguccgacugcagcuuaggcccaaucuccuggggagcuggccuaggcuggcagguggacaucc NW_005871149.1:3599945..3600009:+
MLU_28_11406 3.3e+2 662 661 0 1 yes blast cuaggcuggcagguggacaucc uguccaacugcagcuuagg uguccaacugcagcuuaggcccaaucuccuggggagcaggccuaggcuggcagguggacaucc NW_005871075.1:9041264..9041327:-
MLU_182_26245 3.3e+2 656 417 1 238 yes blast ucuggccaagccccccagcag ugcuggggugccuggccagccu ugcuggggugccuggccagccugggugcagggcugauggcuguuugcagucuggccaagccccccagcag NW_005871230.1:837716..837786:+
MLU_80_18471 3.3e+2 655 390 0 265 yes blast cgcuggggggcuuggccagucu acuggccaggcaccccagcagg cgcuggggggcuuggccagucugcaaacugccaucagccacucacccagacuggccaggcaccccagcagg NW_005871127.1:4615136..4615207:-
MLU_360_32606 3.3e+2 651 417 1 233 yes blast ucuggccaagccccccagcag ugcuggggugccuggccagccu ugcuggggugccuggccagccugagugaggggcugauggcuguuuacagucuggccaagccccccagcag NW_005871405.1:442544..442614:-
MLU_195_27009 3.1e+2 622 609 0 13 yes blast agagaggcagggucugaucca ugaucagcuguugccucucucu agagaggcagggucugauccacagucuccauggcagcuguugaucagcuguugccucucucu NW_005871240.1:966555..966617:-
MLU_195_26976 3.1e+2 622 609 0 13 yes blast agagaggcagggucugaucca ugaucagcuguugccucucucu agagaggcagggucugauccacagucuccauggcagcuguugaucagcuguugccucucucu NW_005871240.1:964184..964246:+
MLU_25_10673 3.1e+2 616 571 0 45 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagaag augcugacauauuuacuagaagggugaaauuaauagccuucuaguaagaguggcaguugaag NW_005871071.1:2975744..2975806:+
MLU_176_25861 2.9e+2 580 574 1 5 yes blast auuuccggaggaugaggccc ccucauccucuggaaauucugu ccucauccucuggaaauucuguuucuuuuuuaggggguggggccacaacguuaguaacaaagaaacugaauuuccggaggaugaggccc NW_005871224.1:570884..570973:+
MLU_581_36577 2.8e+2 553 534 0 19 yes blast uguggccucuggguguguacccu aguguacuuccuggggcuucu aguguacuuccuggggcuucugggcauauaauuccuguggccucuggguguguacccu NW_005871634.1:125502..125560:+
MLU_193_26876 2.8e+2 549 538 0 11 yes blast uacccauugcauaucggaguug accuccugugugcauggauuaca uacccauugcauaucggaguugugaauucucaaagcaccuccugugugcauggauuaca NW_005871244.1:1441569..1441628:+
MLU_82_18699 2.7e+2 541 522 0 19 yes blast gagagggaugucugacugccaga ccgacagucagacaucccccaaggggucc gagagggaugucugacugccagagaucgggccuaaaccgacagucagacaucccccaaggggucc NW_005871128.1:1108926..1108991:-
MLU_1_518 2.7e+2 536 528 0 8 yes blast gagagggauguccgacugccaga uggcaguuggacaucccccg gagagggauguccgacugccagauguuugacuacagggauugggccuaaaguggcaguuggacaucccccg NW_005871048.1:45057284..45057355:+
MLU_3_2906 2.6e+2 514 245 0 269 yes blast uggcaguuggacauccccugagu gagagggauguccgacugcca gagagggauguccgacugccaggaucaggccuuaacuggcaguuggacauccccugagu NW_005871050.1:16450604..16450663:-
MLU_654_37361 2.6e+2 522 341 0 181 no blast augcacacugaccaccagggac ugugugugugugugugugugu uguguguguguguguguguguaugacuaagcaaucguuacgaugaaaugaccggucgcuaugaugcacacugaccaccagggac NW_005871702.1:46432..46516:+
MLU_16_8428 2.6e+2 512 511 0 1 yes blast aagcuggcagucggacauccu aauguccaacugauggcuuagg aauguccaacugauggcuuaggcccucucccugcagccuaagcuggcagucggacauccu NW_005871064.1:12709238..12709298:-
MLU_90_19327 2.5e+2 506 505 0 1 yes blast cugcccggccccucccacugug gugguggacacaggggc gugguggacacaggggcgggucucagcccauccucugcgccccugcccggccccucccacugug NW_005871136.1:1656553..1656617:+
MLU_60_16257 2.5e+2 505 240 0 265 yes blast uggcaguuggacauccccugagu gagagggaugucugacugccagu gagagggaugucugacugccaguuuaggccugaucuggcaguuggacauccccugagu NW_005871106.1:4513857..4513915:+
MLU_89_19294 2.5e+2 499 483 0 16 yes blast uaagccagcagucggacaucc augucugacugauggcuuagg augucugacugauggcuuaggccugcucccugcaggugagccuaagccagcagucggacaucc NW_005871135.1:1280918..1280981:-
MLU_96_19993 2.5e+2 493 487 0 6 yes blast uuggacugccaguuucagcca cugaaaccagcaguccgacauc uuggacugccaguuucagccagaucccugcagaucaggcugaaaccagcaguccgacauc NW_005871143.1:3575302..3575362:-
MLU_24_10529 2.5e+2 492 488 0 4 yes blast aggccagcagucggacaucc augucugacuuccggcuuaggc augucugacuuccggcuuaggcccgcuucccaugggccuaggccagcagucggacaucc NW_005871072.1:10738677..10738736:+
MLU_59_16178 2.5e+2 489 348 0 141 yes blast ugcccccugguggucagugcgu cacacugaccaccagggggc cacacugaccaccagggggcaaaugcucaaugaaggagcugcccccugguggucagugcgu NW_005871108.1:3338206..3338267:-
MLU_275_30141 2.5e+2 496 386 0 110 no blast uccacacccggcuggcugcga gacagacagcaggugugugggcu gacagacagcaggugugugggcugcaaguauauuugguccacacccggcuggcugcga NW_005871317.1:493341..493399:+
MLU_39_13347 2.4e+2 485 238 12 235 yes blast ugcuggggugccuggccagccu cuggccaagccccccagcgga ugcuggggugccuggccagccugggugaggggcugauggcuguuugcaggcuggccaagccccccagcgga NW_005871084.1:7851641..7851712:+
MLU_14_7826 2.4e+2 475 238 2 235 yes blast ugcuggggugccuggccagccu cuggccaagccccccagcgga ugcuggggugccuggccagccugggugaguggcugauggcuguuugcaggcuggccaagccccccagcgga NW_005871060.1:8753622..8753693:-
MLU_3_2654 2.4e+2 491 485 0 6 no blast agaaacagaauuuccggaggau ucccaggugauucuaaugugcag agaaacagaauuuccggaggauuaggcccagaaaucaggauuuuaaaaagauucccaggugauucuaaugugcag NW_005871050.1:31265564..31265639:+
MLU_247_29150 2.4e+2 476 473 0 3 no blast gacuccaggguccgcggcugcu uggccgcugccccggggaugcc uggccgcugccccggggaugcccccugcaguuugggacuccaggguccgcggcugcu NW_005871297.1:1632828..1632885:-
MLU_1_420 2.3e+2 491 485 0 6 no blast agaaacagaauuuccggaggau ucccaggugauucuaaugugcag agaaacagaauuuccggaggauuaggcccagaaaucaggauuuuaaaaagauucccaggugauucuaaugugcag NW_005871048.1:35785690..35785765:+
MLU_4769_43896 2.3e+2 469 463 0 6 no blast uuggacugccaguuucagccg caggagcagcaggcaggag caggagcagcaggcaggaguggcaggcaguguuggacugccaguuucagccg NW_005875823.1:7462..7514:-
MLU_261_29708 2.3e+2 466 460 0 6 no blast uacggccaagcacccgcagggc cggcggguuuguuggcuuugcgu cggcggguuuguuggcuuugcguuuucaaccuuuugcguacggccaagcacccgcagggc NW_005871298.1:1746540..1746600:-
MLU_159_24900 2.3e+2 457 447 0 10 yes blast gagagggauguccgacugcca gcaguuggacauccccugu gagagggauguccgacugccaguuuagguccgaucccugggaucgggccuaaacugcaguuggacauccccugu NW_005871206.1:2277138..2277212:-
MLU_2_1653 2.3e+2 457 431 0 26 yes blast uguccaccugccggcuuaggcc ucuaagccagcagucagacauc uguccaccugccggcuuaggccaauuccuccggggaucgggucuaagccagcagucagacauc NW_005871049.1:27148022..27148085:+
MLU_46_14404 2.2e+2 441 381 4 56 yes blast gcugguuucauauggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu NW_005871094.1:5882111..5882175:+
MLU_152_24464 2.2e+2 440 420 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca NW_005871195.1:2009293..2009355:+
MLU_665_37463 2.2e+2 435 296 0 139 yes blast uaagcuggcagucggacaucc augucugacugcuggcuuagga augucugacugcuggcuuaggaggccuaagcuggcagucggacaucc NW_005871715.1:3353..3400:-
MLU_112_21535 2.1e+2 424 415 0 9 yes blast agggaugucugacugcuggcu uagcagucagacaucccccaag agggaugucugacugcuggcuuaguccugauggggauugggccuaagcuagcagucagacaucccccaag NW_005871158.1:2885408..2885478:-
MLU_38_13176 2.1e+2 423 262 0 161 yes blast gccgacaggcgggcaggaccagg uggccugcccgccagucggg uggccugcccgccagucgggcucugcugucuguuguuugggccgacaggcgggcaggaccagg NW_005871085.1:334662..334725:-
MLU_17_8645 2.1e+2 418 294 0 124 yes blast ugcccccugguggucagugcgu cacacugaccaccagggggc cacacugaccaccagggggcaccuccugcauuaagcaucugcccccugguggucagugcgu NW_005871063.1:10653012..10653073:-
MLU_145_23951 2.1e+2 423 318 0 105 no blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua NW_005871193.1:3222365..3222423:-
MLU_42_13818 2.1e+2 408 274 0 134 yes blast cgguggaugucugacugccagc ucggcagucggacaucccccgu cgguggaugucugacugccagcuuaggccuacucccugucggcagucggacaucccccgu NW_005871089.1:3929042..3929102:+
MLU_193_26866 2.0e+2 407 382 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca NW_005871244.1:1432310..1432370:+
MLU_226_28360 2.0e+2 404 395 1 8 yes blast cgcuggggggcuuggccagucu cuggccaggcaccccagcgggg cgcuggggggcuuggccagucugaaaacagccaucagccccucacccgggcuggccaggcaccccagcgggg NW_005871269.1:1296340..1296412:+
MLU_1335_41427 2.0e+2 402 300 1 101 yes blast ugcccccugguggucagugcgu cacacugaccaccagggggc cacacugaccaccagggggcggacgcucaacgcaggcgcugcccccugguggucagugcgu NW_005872509.1:54694..54755:+
MLU_139_23468 2.0e+2 401 372 0 29 yes blast ucuacagugcacgugucuccagu ggagacgcggcccuguuggagu ucuacagugcacgugucuccaguguggcucggaggcuggagacgcggcccuguuggagu NW_005871186.1:592039..592098:+
MLU_35_12646 2.0e+2 398 395 0 3 yes blast ugggggauguccuacugccggc uggcaggcggacauccuucaag ugggggauguccuacugccggcuuaggcccacucccuguucccuaagcuggcaggcggacauccuucaag NW_005871082.1:5487716..5487786:+
MLU_1050_40406 2.0e+2 398 362 0 36 yes blast gaugcucagaucggcgaccacu ugguggcagaccugagugcugg gaugcucagaucggcgaccacugucagggugagcaagugguggcagaccugagugcugg NW_005872073.1:51382..51441:+
MLU_739_38327 2.0e+2 389 217 11 161 yes blast ugcuggggugccuggccagccu cuggccaagccccccagcggu ugcuggggugccuggccagccuaggugaggggcugauggcuguuugcaggcuggccaagccccccagcggu NW_005871763.1:66432..66503:+
MLU_3_3103 1.9e+2 387 381 0 6 yes blast caggggaugucugacugccag uggcagucagacauccu caggggaugucugacugccaguauaggccugauccugccuaaacuggcagucagacauccu NW_005871050.1:30512635..30512696:-
MLU_169_25522 1.9e+2 391 238 0 153 yes blast caggcuaggggagaugaccggau uucacuuaccucccagccuaca caggcuaggggagaugaccggauagaaaacguuguucuauucacuuaccucccagccuaca NW_005871217.1:2713766..2713827:-
MLU_40_13465 1.9e+2 385 287 0 98 yes blast cuggccaagccccccagcgggu cgcuggggugccuggccagccu cgcuggggugccuggccagccuaggugagaagcugauggcuguuuucaggcuggccaagccccccagcgggu NW_005871088.1:5988712..5988784:+
MLU_4146_43719 1.9e+2 385 363 1 21 yes blast ugcacugaccaccaggcggcagu cugcccucugguggucagug ugcacugaccaccaggcggcagucuccuguguugagcgucugcccucugguggucagug NW_005875152.1:4866..4925:-
MLU_55_15740 1.9e+2 381 380 0 1 yes blast cuaagcuggcagguggacauc ugucgaacugcggcuuagg ugucgaacugcggcuuaggcccgcucccgcggagcaggccuaagcuggcagguggacauc NW_005871103.1:2020980..2021040:-
MLU_718_38079 1.9e+2 380 379 0 1 yes blast cuaagcuggcagguggacauc uguccaacuguggcuuagg uguccaacuguggcuuaggcccacacugcaggggagcgggccuaagcuggcagguggacauc NW_005871754.1:49150..49212:+
MLU_474_35157 1.9e+2 378 372 0 6 yes blast cuaagcuggcagguggacauc augucucacugccagcuuagg augucucacugccagcuuaggauugaucccccagggagcaggccuaagcuggcagguggacauc NW_005871514.1:519590..519654:+
MLU_360_32602 1.9e+2 378 356 0 22 yes blast ugggggaugucccacugccggg uggcaguuggacaucccucucac ugggggaugucccacugccggguuaggccuaaccuggcaguuggacaucccucucac NW_005871405.1:988427..988484:+
MLU_27_11226 1.9e+2 375 232 0 143 yes blast caggaaucgaaccugcaacccu guuugcagguucgauucugguc caggaaucgaaccugcaacccuuuggugagugggcagguuugcagguucgauucugguc NW_005871076.1:9618161..9618220:-
MLU_4_3314 1.9e+2 373 277 0 96 yes blast uaagccagcagucggacaucc augucugacugcuggcuuagg augucugacugcuggcuuaggcccucugcagggagugggccuaagccagcagucggacaucc NW_005871051.1:16634103..16634165:+
MLU_271_29987 1.9e+2 374 371 0 3 yes blast ugggggaugucccacugccggu cagcagugggacaucccucucau ugggggaugucccacugccgguuuaaaccagcagugggacaucccucucau NW_005871307.1:1352683..1352734:-
MLU_253_29393 1.9e+2 372 371 0 1 yes blast aagccagcagucggacaucccc gauguccaacugcuggcguagg gauguccaacugcuggcguaggcccgauccugaguaggccaaagccagcagucggacaucccc NW_005871312.1:1601096..1601159:+
MLU_3_2349 1.8e+2 361 238 13 110 yes blast ugcuggggugccuggccagccu acuggccaagucccccagcggg ugcuggggugccuggccagccugggugaggggcugagggcuuuuugcagacuggccaagucccccagcggg NW_005871050.1:11000324..11000395:+
MLU_4_3531 1.8e+2 371 313 0 58 yes blast uugggcuuacuccucacgggugg cuuccugugacauuacgcccuauacau uugggcuuacuccucacggguggcagaauacuauggccuuccugugacauuacgcccuauacau NW_005871051.1:8820580..8820644:-
MLU_925_39637 1.8e+2 358 349 8 1 yes blast cacuggggugccuggucagccu cuggcuaagccccccagcgggg cacuggggugccuggucagccuuaugaggggcugagggcuguuuacaggcuggcuaagccccccagcgggg NW_005871945.1:143219..143290:-
MLU_26_11026 1.8e+2 358 278 0 80 yes blast cagcagucagacaucccucucaaa ucgggggaugucugacugcc ucgggggaugucugacugccgguuuaggcucgaucccaccagcagucagacaucccucucaaa NW_005871073.1:3775328..3775391:-
MLU_1540_41826 1.8e+2 357 348 5 4 yes blast ugcccccugguggucagugcgu ucacugaccaccaggggu ucacugaccaccaggggucagcuccugcauugagugucugcccccugguggucagugcgu NW_005872518.1:32460..32520:-
MLU_123_22327 1.8e+2 354 235 5 114 yes blast cuggccaagccccccagcggag cgcuggggugccuggccagccu cgcuggggugccuggccagccugggugaggggcugagggucguuuucaggcuggccaagccccccagcggag NW_005871176.1:1368843..1368915:+
MLU_255_29474 1.8e+2 352 347 0 5 yes blast agggaugucugacugcuggcu gccggcacguggacauccc agggaugucugacugcuggcuuagaccugcuccccaugggaagcaggccuaugccggcacguggacauccc NW_005871294.1:667989..668060:+
MLU_19_8892 1.7e+2 350 348 0 2 yes blast cuaauaugcuaauggucggga cagaccauuagcauauuagcu cuaauaugcuaauggucgggacaccguaauggguaacaaccagaccauuagcauauuagcu NW_005871066.1:588251..588312:+
MLU_43_14091 1.7e+2 350 348 0 2 yes blast cuaauaugcuaauggucggga cagaccauuagcauauuagcu cuaauaugcuaauggucgggacacuguaacggguaacgaccagaccauuagcauauuagcu NW_005871090.1:779459..779520:-
MLU_155_24601 1.7e+2 346 330 0 16 yes blast cauaggucagggcaugugcagga cugcacaugcccugaccagga cugcacaugcccugaccaggaaucgaaccaugaccucauaggucagggcaugugcagga NW_005871204.1:949931..949990:+
MLU_253_29402 1.7e+2 343 137 0 206 yes blast ugcccccuguuggucagugagc cacacugaccaccagggggc cacacugaccaccagggggcagcuccugcauuuaguaucugcccccuguuggucagugagc NW_005871312.1:43678..43739:-
MLU_906_39543 1.7e+2 332 331 0 1 yes blast cuuggcgccgucagcgggug accugcugcuggcacccgg accugcugcuggcacccggcacuggcccaauugcuuggcgccgucagcgggug NW_005871918.1:97705..97758:+
MLU_5_3714 1.6e+2 336 330 0 6 no blast acucgcacccacugacggcacc gcugucagcaggugugagu acucgcacccacugacggcaccggcccugcucgcacccgcugcuugugccggccccaaucgcuccacgcugucagcaggugugagu NW_005871052.1:117826..117912:+
MLU_11_6593 1.6e+2 329 326 0 3 yes blast aggggacuacgagaagaggcaa ccucuucucuuccuccccagg aggggacuacgagaagaggcaagguccugauuaccucuucucuuccuccccagg NW_005871058.1:8374966..8375020:-
MLU_102_20523 1.6e+2 321 320 0 1 yes blast cuuggcgccgucagcgggug acccacugcuggugccuggcg acccacugcuggugccuggcgcuggucccaaucacuuggcgccgucagcgggug NW_005871149.1:3404818..3404872:+
MLU_276_30165 1.6e+2 319 315 0 4 yes blast ugcccccugguggucagugcgu cgcacuaaccaccagggggcau cgcacuaaccaccagggggcaucuucugcagugagcauuugcccccugguggucagugcgu NW_005871314.1:855137..855198:+
MLU_110_21356 1.6e+2 318 209 0 109 yes blast ucccccuggugaucagugcgcu cgcacugaccaccagggggc cgcacugaccaccagggggcagacguucaacacaggagcuucccccuggugaucagugcgcu NW_005871156.1:2187547..2187609:-
MLU_19_8893 1.6e+2 317 305 0 12 yes blast ugcccccugguggucagugcgu ugcacugaccaccagggagc ugcacugaccaccagggagcagcuccugcauugggugucugcccccugguggucagugcgu NW_005871066.1:656277..656338:+
MLU_30_11830 1.6e+2 313 297 0 16 yes blast agagaggcagggucugaucca ugaucagaacuugucucucuuu agagaggcagggucugauccaaacacuccgugcagccguugaucagaacuugucucucuuu NW_005871077.1:5363139..5363200:-
MLU_3_2816 1.5e+2 306 245 5 56 yes blast acuggccaggcaccccagcaga ugcuggggggcuuggccagccu ugcuggggggcuuggccagccugaacacagccaucagccccucacccagacuggacuggccaggcaccccagcaga NW_005871050.1:10393672..10393748:-
MLU_251_29322 1.5e+2 301 287 13 1 yes blast cuggccaagccccccagcgggu cacuggagugccuggccu cacuggagugccuggccugccugggugaggggcugauggcuguuugcaggcuggccaagccccccagcgggu NW_005871291.1:327526..327598:-
MLU_786_38773 1.5e+2 295 200 0 95 yes blast ugcccccuggucgucagugca ucacugaccaccagggggcag ucacugaccaccagggggcagacacaacacaggagcugcccccuggucgucagugca NW_005871823.1:101007..101064:+
MLU_24_10555 1.5e+2 293 289 0 4 yes blast ucggacugccgguuucagccu cugaaacuggcaguccgacauc ucggacugccgguuucagccugaucccccacaggcuggccuccaggagaucaggcugaaacuggcaguccgacauc NW_005871072.1:623105..623181:-
MLU_516_35782 1.4e+2 287 277 0 10 yes blast aucucagguucgucagcccaug aggacugaccaaccugagaaug aggacugaccaaccugagaauggugucuccaggucaaucucagguucgucagcccaug NW_005871603.1:311124..311182:-
MLU_33_12386 1.4e+2 287 282 0 5 yes blast cuuggcgccgucagcgggug accugcugccagcgcccag accugcugccagcgcccagcacugguccugaucacuuggcgccgucagcgggug NW_005871079.1:3287502..3287556:-
MLU_5830_44146 1.4e+2 283 235 10 38 yes blast cuggccaagccccccagcggag ugcuggggugccuggccag ugcuggggugccuggccaguuugggugaggggcugauggcuguuugcaggcuggccaagccccccagcggag NW_005877033.1:4886..4958:-
MLU_3_3102 1.4e+2 282 224 0 58 yes blast gaucgggccuaaaccagcagu ugcugguuuaggccugaucccg ugcugguuuaggccugaucccgcagggaucaggaucgggccuaaaccagcagu NW_005871050.1:30338512..30338565:-
MLU_37_12906 1.4e+2 282 277 0 5 yes blast augcacacugaccaccagggaa cccacugguggucagugugcu augcacacugaccaccagggaacaaaugcucaaugcaggagcuccccacugguggucagugugcu NW_005871086.1:1921233..1921298:+
MLU_23_10374 1.4e+2 277 263 0 14 yes blast gguuccggggugcgucaccug gaugacacaccccggaaucgg gaugacacaccccggaaucgggcucccucuucucugguuccggggugcgucaccug NW_005871069.1:9647798..9647854:-
MLU_10_6250 1.4e+2 275 161 0 114 yes blast cuggccaagccccccagcggu cgcuggggugccuggccagccu cgcuggggugccuggccagccuggguaggggcugauggcuguuuucaggcuggccaagccccccagcggu NW_005871057.1:11616382..11616452:-
MLU_195_26992 1.4e+2 276 275 0 1 yes blast cacuggggugccuggccagccg cuggucaaaccccccagcagu cacuggggugccuggccagccggagugaguggcugauggcuguuuguagacuggucaaaccccccagcagu NW_005871240.1:2061541..2061612:+
MLU_15_8128 1.4e+2 271 238 11 22 yes blast ugcuggggugccuggccagccu gcuggccaagccccccagu ugcuggggugccuggccagccugggugaggggcugagggcaguuugaaggcuggccaagccccccagu NW_005871062.1:5971568..5971636:-
MLU_56_15854 1.3e+2 269 121 3 145 yes blast gcuggccaagccccccagcagga ugcuggggugccuggccag ugcuggggugccuggccagucugggugaggggcugauggcuguuuauaggcuggccaagccccccagcagga NW_005871102.1:1419949..1420021:-
MLU_25_10684 1.3e+2 264 161 0 103 yes blast ugggggaugucugacugcugga cggcagucggacaucccucu ugggggaugucugacugcuggauguagaagcuuaaguccucagaugaacugaaaccugaaaccggcagucggacaucccucu NW_005871071.1:3518161..3518243:+
MLU_149_24159 1.3e+2 262 200 0 62 yes blast ugcccccuggucgucagugca ugaccaccagggggcagacacu ugaccaccagggggcagacacucaaugaaggagcugcccccuggucgucagugca NW_005871196.1:1268187..1268242:+
MLU_87_19160 1.3e+2 259 238 3 18 yes blast ugcuggggugccuggccagccu cuggccaagucccccagcaggg ugcuggggugccuggccagccugggugaggugcugauggcuguuugcaggcuggccaagucccccagcaggg NW_005871132.1:1516045..1516117:-
MLU_4_3239 1.3e+2 258 238 0 20 yes blast ccgggugccagcaguggguguga cacccgcugauggcgccgagu cacccgcugauggcgccgagugaucgggacuggcgccgggugccagcaguggguguga NW_005871051.1:9967943..9968001:+
MLU_5_3802 1.3e+2 261 201 59 1 no blast gaucgggccuaaaccagcagu cugggcugagaggaccc gaucgggccuaaaccagcagucugacaucccccgaggggucccggauuggagaguugcaggcugggcugagaggaccc NW_005871052.1:6632278..6632356:+
MLU_744_38348 1.3e+2 252 250 0 2 yes blast cgggggaugucugacugccagga cugguagucggacaucccucucaca cgggggaugucugacugccaggaccgagccuaaacugguagucggacaucccucucaca NW_005871810.1:198254..198313:+
MLU_56_15859 1.3e+2 256 213 0 43 yes blast cauggaggucucugucuggcu uuugaucguuccccuccauaca cauggaggucucugucuggcuuagcacagcuggcuaaguuugaucguuccccuccauaca NW_005871102.1:2319542..2319602:-
MLU_92_19527 1.2e+2 250 245 0 5 yes blast caccagcagcaggugcgagcagu cugugggugcgagcagggcuggugc caccagcagcaggugcgagcaguggcucccgggccagcugugggugcgagcagggcuggugc NW_005871137.1:2250711..2250773:-
MLU_104_20689 1.2e+2 250 245 0 5 yes blast acuggccaggcaccccagcaga cgcuggggggcuuagccagccu cgcuggggggcuuagccagccugaaaacugcccucagccccucacacagacuggccaggcaccccagcaga NW_005871150.1:2517197..2517268:+
MLU_30_11743 1.2e+2 249 185 13 51 yes blast ugcuggggugccuggccaguc cuggccaagccccccagugggu ugcuggggugccuggccagucugugugaguggcugauggcuguuugcaggcuggccaagccccccagugggu NW_005871077.1:9848119..9848191:+
MLU_507_35677 1.2e+2 250 245 0 5 yes blast acuggccaggcaccccagcaga cgcuggggggcuuagccagccu cgcuggggggcuuagccagccugaaaauggcccucagucgcucauccagacuggccaggcaccccagcaga NW_005871540.1:445386..445457:+
MLU_81_18488 1.2e+2 247 200 0 47 yes blast uugggggauguccaacugcugu cagcagucagacaucccucuca uugggggauguccaacugcuguuuuaggcccgauccugcaaccagcagucagacaucccucuca NW_005871129.1:1247984..1248048:+
MLU_616_36990 1.2e+2 244 227 0 17 yes blast ugucaggccugggcaggggac ccccuugcccaggccugaugccuccg ccccuugcccaggccugaugccuccgccagaggugucaggccugggcaggggac NW_005871651.1:290510..290564:-
MLU_512_35748 1.2e+2 240 239 0 1 yes blast gcuggccacgccccccagcag ccauggggguguggcuggcu gcuggccacgccccccagcagggacccucaccccauggggguguggcuggcu NW_005871566.1:348201..348253:+
MLU_14_7825 1.2e+2 239 235 0 4 yes blast cuggccaagccccccagcggag uccugggugaggggcug cuggccaagccccccagcggagacccucaccccaugaggguguggccauccugggugaggggcug NW_005871060.1:8753578..8753643:-
MLU_280_30295 1.2e+2 237 113 0 124 yes blast cuuguacccgcugauggcaca ugccagcagcaggugcaagugg cuuguacccgcugauggcacagagcgauugggacccgugccagcagcaggugcaagugg NW_005871326.1:1031506..1031565:-
MLU_10_6269 1.2e+2 234 211 1 22 yes blast gccccgaucgccccucaggagu ccucaggggcgaucaggg gccccgaucgccccucaggaguagggggagauggagaagcccucaggggcgaucaggg NW_005871057.1:14226915..14226973:-
MLU_74_17829 1.2e+2 233 224 0 9 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguuccucucaaccguagucaggaagcccuuaccccaaaaagca NW_005871121.1:83423..83488:-
MLU_1_83 1.2e+2 232 175 13 44 yes blast cuggccaagccccccagcggu cgcuggggugccugaccagccu cgcuggggugccugaccagccugggugaggggcugauggcuguuugcaggcuggccaagccccccagcggu NW_005871048.1:5523394..5523465:+
MLU_215_27893 1.1e+2 231 222 0 9 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagca cuuuuugcggucugggcuugcuguacauaacucaauagccggaagcccuuaccccaaaaagca NW_005871261.1:1119673..1119736:-
MLU_29_11577 1.1e+2 229 161 0 68 yes blast ugggggaugucugacugcugga cuggcagucggacaucccucuc ugggggaugucugacugcuggaugacugacuaucuggcagucggacaucccucuc NW_005871074.1:7752854..7752909:-
MLU_22_9871 1.1e+2 227 191 0 36 yes blast cacacugaccaccagggggc ugccccuggugguccgugugcu cacacugaccaccagggggcagaugcccaaugcaagagcugccccuggugguccgugugcu NW_005871068.1:4475301..4475362:+
MLU_303_31040 1.1e+2 229 185 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua NW_005871343.1:1131680..1131744:+
MLU_22_9883 1.1e+2 225 218 0 7 yes blast gaucgggccuaaaccagcagu ucugccaguuuaggccugaucc ucugccaguuuaggccugauccccacagggcagaccuggggaucgggccuaaaccagcagu NW_005871068.1:5858799..5858860:+
MLU_1520_41803 1.1e+2 223 188 0 35 yes blast aggggauguccgacugccgguu cggcagucggacaucccucu aggggauguccgacugccgguuauaccugaucccgagggcaggaucgggccuagaucggcagucggacaucccucu NW_005872505.1:40802..40878:-
MLU_252_29344 1.1e+2 228 157 0 71 no blast accuuggcugcagacugcuuacu uaacagucuccagucacggcc accuuggcugcagacugcuuacugcccggcgccccgaguaacagucuccagucacggcc NW_005871310.1:704778..704837:+
MLU_25_10704 1.1e+2 217 211 1 5 yes blast gccccgaucgccccucaggagu cccucaggggugaucggggcug gccccgaucgccccucaggaguagggggagauggagaagcccucaggggugaucggggcug NW_005871071.1:5092943..5093004:+
MLU_616_36986 1.1e+2 218 106 0 112 yes blast ugccccuuggugaucagugugc cacacugaccaccagggggc cacacugaccaccagggggcaacuccugcguugagaucugccccuuggugaucagugugc NW_005871651.1:127060..127120:-
MLU_97_20040 1.1e+2 213 152 0 61 yes blast ccuggccugcucuccccacaga aaggggagagaaggccagagca aaggggagagaaggccagagcaucgcccugaccugccuggccugcucuccccacaga NW_005871142.1:920328..920385:-
MLU_305_31123 1.0e+2 212 161 0 51 yes blast ugggggaugucugacugcugga cggcagucggacaucccucu ugggggaugucugacugcuggaugucccggggaugagaccuaaaucggcagucggacaucccucu NW_005871349.1:1102872..1102937:-
MLU_71_17515 1.0e+2 212 207 0 5 yes blast uugggggaugucugccugccggu ccagcaguuggacaucccucucg uugggggaugucugccugccgguuuaccuuaagccagcaguuggacaucccucucg NW_005871118.1:4393790..4393846:-
MLU_324_31689 1.0e+2 211 210 0 1 yes blast cgccaucagcaggugcgagugg cucacacucacugcugg cucacacucacugcuggugcgggccccaaucacuccacgccaucagcaggugcgagugg NW_005871368.1:7213..7272:+
MLU_94_19734 1.0e+2 210 208 0 2 yes blast cuaauaugcuaauggucggga cagaccauuagcauauuagcu cuaauaugcuaauggucgggauaccguaacguguaacgaccagaccauuagcauauuagcu NW_005871146.1:3291353..3291414:+
MLU_5_4102 1.0e+2 208 205 0 3 yes blast ccagcagucggacauccccugaga ugggggaugucuaacugcuggcg ugggggaugucuaacugcuggcguaggcccacucuccuaacccagcagucggacauccccugaga NW_005871052.1:7498388..7498453:-
MLU_900_39523 1.0e+2 216 184 0 32 no blast uggaagacuagugauuuuguuguu caacaagucccagucugccgca uggaagacuagugauuuuguuguugucucgcugcaucagcaacaagucccagucugccgca NW_005871939.1:102650..102711:-
MLU_148_24095 1.0e+2 207 206 0 1 yes blast cgccaucagcaggugcgagugg gcuugcaccugcugcug gcuugcaccugcugcuggugccuggcaccagucccagucacucggcgccaucagcaggugcgagugg NW_005871197.1:2511800..2511867:+
MLU_1_556 1.0e+2 207 186 0 21 yes blast uaaccgguugaacaacugaacc uuacaguuguucaaccaguuacu uuacaguuguucaaccaguuacuaaucuaacuaauuguaaccgguugaacaacugaacc NW_005871048.1:48166224..48166283:+
MLU_216_27918 1.0e+2 204 202 0 2 yes blast uuggacugcugauuugggccc cccaaaccagcaguccgacauc uuggacugcugauuugggccccauccccgcagauugggcccaaaccagcaguccgacauc NW_005871260.1:890607..890667:+
MLU_212_27794 1.0e+2 204 202 0 2 yes blast uagugcacugaccaccagggga ucuggcugaguggcacu ucuggcugaguggcacucccucuagugcacugaccaccagggga NW_005871257.1:2168316..2168360:-
MLU_789_38782 1.0e+2 208 207 0 1 no blast ccucgagccgcuucccuucgcc ggaggggaggcugcuccu ccucgagccgcuucccuucgcccggcugccuugugcgcggaggggaggcugcuccu NW_005871816.1:14272..14328:+
MLU_305_31112 1.0e+2 200 188 0 12 yes blast acucgcacccgcugcuggcg ucagcaggugcaagcggggcu acucgcacccgcugcuggcgcuggccccaauugcuccauguugucagcaggugcaagcggggcu NW_005871349.1:959233..959297:+
MLU_20_9387 1.0e+2 198 68 116 14 yes blast uauuuuguggaagagccacacu uguggcucuuccacaaaauacc uguggcucuuccacaaaauaccgacuucggcgcaugggccacgaaguuucaaucgcacuguacacgcccgcccgcaggugguauuuuguggaagagccacacu NW_005871067.1:4058354..4058457:-
MLU_1949_42431 1.0e+2 198 110 8 80 yes blast gcuggccaagucccccagcggg cacuggggugccuggccag cacuggggugccuggccagcauuggugaggggcugauggcuguuugcaggcuggccaagucccccagcggg NW_005872899.1:23186..23257:+
MLU_2_1836 1.0e+2 195 193 0 2 yes blast ccggcugugaguuugacaugcu gcaugucaaacucgcggc gcaugucaaacucgcggccagcgggcaugcagcccaccggcugugaguuugacaugcu NW_005871049.1:2458492..2458550:-
MLU_228_28509 1.0e+2 195 125 0 70 yes blast ucgccaaccuuucggaccu ggaccaucgguuggcgacu ucgccaaccuuucggaccuaacagaccaccagugguuuguggaccaucgguuggcgacu NW_005871275.1:557223..557282:-
MLU_112_21484 1.0e+2 193 165 1 27 yes blast acuggccaggcaccccagcggg cgcuggggggcuuggccag cgcuggggggcuuggccagccugaaaacggcucucagccccucaaccagacuggccaggcaccccagcggg NW_005871158.1:93705..93776:-
MLU_26_10938 1.0e+2 193 153 0 40 yes blast cccccugguggucagugugcu cgcacuaaccaccaggggcaga cgcacuaaccaccaggggcagaugcucaaugcaggaccugcccccugguggucagugugcu NW_005871073.1:4312745..4312806:+
MLU_228_28521 9.9e+1 190 150 0 40 yes blast cugugcaccaggccucuaguu uagaggccuggugcacaaaau cugugcaccaggccucuaguugaauuauaaugugacuagaggccuggugcacaaaau NW_005871275.1:1733721..1733778:-
MLU_51_15240 9.8e+1 189 144 5 40 yes blast ugcuggggugccuggccaguc cuggccaagccccccagcaggu ugcuggggugccuggccagucugggugaggggcuguuggcuguuuguaggcuggccaagccccccagcaggu NW_005871098.1:3981704..3981776:-
MLU_178_26010 9.8e+1 197 165 0 32 yes blast ucucuucugcaugcauggucuaga uuagaccauugucaauugagaug uuagaccauugucaauugagauggaguaaccauuucaucucuucugcaugcauggucuaga NW_005871225.1:736379..736440:+
MLU_257_29575 9.6e+1 184 144 0 40 yes blast ugcuggggugccuggccaguc cuggccaagccccccagcaggu ugcuggggugccuggccagucugggugaggggcuaauggcuguugcaggcuggccaagccccccagcaggu NW_005871299.1:887394..887465:+
MLU_37_13082 9.4e+1 182 176 1 5 yes blast cuggccaggccccccagcggga ccccacccugaagggggugugaccagccugc ccccacccugaagggggugugaccagccugcaaacacccaucagccccucacccaggcuggccaggccccccagcggga NW_005871086.1:8636783..8636862:-
MLU_311_31297 9.4e+1 182 154 0 28 yes blast ugagcccacccgucugcccuaca cuggguaguugggguucugacuggca cuggguaguugggguucugacuggcaucuuguuccuuugaugugagcccacccgucugcccuaca NW_005871359.1:1045932..1045997:+
MLU_24_10472 9.3e+1 179 100 0 79 yes blast gaugucugacugcccgcuuagg uaagcuggcaggcagacauccc gaugucugacugcccgcuuaggccagggggaaucaggccuaagcuggcaggcagacauccc NW_005871072.1:5070682..5070743:+
MLU_406_33715 9.3e+1 180 179 0 1 yes blast acgauggagagaggcacuggg cagggacccucccuccagcgau acgauggagagaggcacuggggugaugauggagccagggacccucccuccagcgau NW_005871441.1:596161..596217:-
MLU_191_26772 9.1e+1 174 150 1 23 yes blast gccccgaucgccccucaggag ccugaggggcgaucggggccaa gccccgaucgccccucaggagcugggggagguggagaagcccugaggggcgaucggggccaa NW_005871239.1:2215724..2215786:+
MLU_28_11248 9.0e+1 173 157 0 16 yes blast acuuguacccacugcuggcac ugccaucagcaggugcgagcggg acuuguacccacugcuggcaccagcuccaauugcucugugccaucagcaggugcgagcggg NW_005871075.1:1390014..1390075:+
MLU_31_12059 8.9e+1 173 118 0 55 yes blast acugguuuaggccugauccca gaucgggccuaaacuggcagu acugguuuaggccugaucccacagggaucucugcggaucgggccuaaacuggcagu NW_005871080.1:6538609..6538665:-
MLU_117_21860 8.9e+1 172 168 0 4 yes blast uccugaggggugaucggggcugc uggccccgaucgccccugagg uggccccgaucgccccugaggacuuuuccaccucccccugcuccugaggggugaucggggcugc NW_005871162.1:606722..606786:-
MLU_418_33966 8.9e+1 172 160 0 12 yes blast aggugacgcaccccggaaucagg ugguuccaggugcgucaccc aggugacgcaccccggaaucaggcucccuccucucugguuccaggugcgucaccc NW_005871449.1:62071..62126:+
MLU_72_17535 8.9e+1 171 125 1 45 yes blast gccccgaucgccccucaggag ccugaggggcgaucggggccagu gccccgaucgccccucaggagcagggggagguggagaagcccugaggggcgaucggggccagu NW_005871119.1:2106654..2106717:+
MLU_11112_45104 8.9e+1 175 94 0 81 yes blast cacccagguguuuguuggaaucu acucugcagacaccugugucu cacccagguguuuguuggaaucuuuaugcuuaaaggacucugcagacaccugugucu NW_005882138.1:1631..1688:+
MLU_359_32567 8.8e+1 170 133 3 34 yes blast gaugucugacugccagcuuagg cuaagcuggcagguggaaa gaugucugacugccagcuuaggucuguucccccccggggagcggaccuaagcuggcagguggaaa NW_005871401.1:52109..52174:+
MLU_158_24849 8.7e+1 168 153 0 15 yes blast ucggggaugucugacugccagu uggcaguuggacaucccucucac ucggggaugucugacugccaguuuaggcccgauaaucaggauuggcaguuggacaucccucucac NW_005871202.1:1066192..1066257:-
MLU_175_25839 8.6e+1 166 143 1 22 yes blast ugcucugaucgccccucaggag ccucaggggcgaucaggg ugcucugaucgccccucaggagcagggggagguggagaagcccucaggggcgaucaggg NW_005871220.1:1502759..1502818:-
MLU_39_13378 8.6e+1 166 161 0 5 yes blast cuggccaagccccccagcggu cgcuggguugccuggucagcc cgcuggguugccuggucagccuggaugagggguugauggcuguuugcaggcuggccaagccccccagcggu NW_005871084.1:3655951..3656022:-
MLU_7_4758 8.6e+1 167 134 0 33 yes blast ucgagggaugucugacugcugu ccggcagucagacaucccucu ucgagggaugucugacugcuguuuuagacaucugucagacauccggcagucagacaucccucu NW_005871054.1:10880470..10880533:+
MLU_67_17068 8.6e+1 165 138 0 27 yes blast cagcagucugacaucccucuca cucgggggaugucagacugcu cucgggggaugucagacugcugguuuaggcccgauccuacagggaucggccuaaaccagcagucugacaucccucuca NW_005871114.1:1559846..1559924:-
MLU_2_1583 8.6e+1 166 161 0 5 yes blast cuuggcgccgucagugggug accugcugccagcgcccag accugcugccagcgcccagugcugguccugaucgcuuggcgccgucagugggug NW_005871049.1:20577432..20577486:+
MLU_23_10248 8.6e+1 164 146 11 7 yes blast gcuggccaagucccccagcggg ugcuggggugcuuggccagccu ugcuggggugcuuggccagccuuggugaggggcugauggcuguuugcaggcuggccaagucccccagcggg NW_005871069.1:1887879..1887950:-
MLU_3_2284 8.6e+1 167 162 0 5 yes blast caaagugcucauagugcagguag acuguagugugagcacuucuag caaagugcucauagugcagguaguuuugccauuauucuacuguagugugagcacuucuag NW_005871050.1:5437312..5437372:+
MLU_139_23470 8.5e+1 175 94 0 81 no blast cacccagguguuuguuggaaucu acucugcagacaccugugucu cacccagguguuuguuggaaucuuuaugcuuaaaggacucugcagacaccugugucu NW_005871186.1:989971..990028:+
MLU_41_13678 8.4e+1 163 160 0 3 yes blast aggugacgcaccccggaaucagg gguuccagguacgucaccug aggugacgcaccccggaaucaggcuuccuccucucugguuccagguacgucaccug NW_005871087.1:8084831..8084887:+
MLU_449_34710 8.4e+1 161 160 0 1 yes blast uccugaggggugaucggggcugg agccccagucaccccucagggc agccccagucaccccucagggcuuuuccaccucccccugcuccugaggggugaucggggcugg NW_005871491.1:29899..29962:-
MLU_112_21425 8.4e+1 162 94 0 68 yes blast cgcuggggugccuggccaguc gcuggccaagccccccagcgggaa cgcuggggugccuggccagucugguugaggggcugagagccguuuucaggcuggccaagccccccagcgggaa NW_005871158.1:93707..93780:+
MLU_597_36784 8.4e+1 162 131 0 31 yes blast ccuaggccggcagucagacauc uguccaacugccagcuuaggcc uguccaacugccagcuuaggcccgcucaccacagggagugggccuaggccggcagucagacauc NW_005871632.1:184367..184431:-
MLU_30_11887 8.3e+1 161 159 0 2 yes blast ucgggggauguccaacugccaga caggcaguuggacauuccucu ucgggggauguccaacugccagauuagaccugaucuuugugggaucgggccuaaacaggcaguuggacauuccucu NW_005871077.1:9046842..9046918:-
MLU_168_25438 8.2e+1 160 143 0 17 yes blast uuugcagguucgauucugguc uuggccugcagacugaagg uuggccugcagacugaagguuugcagguucgauucugguc NW_005871215.1:2613103..2613143:-
MLU_145_23954 8.1e+1 157 101 0 56 yes blast cugguuucacaugguggcuuagau uagcaccauuugaaaucaguguu cugguuucacaugguggcuuagauuuuuccaucuuuguaucuagcaccauuugaaaucaguguu NW_005871193.1:3222875..3222939:-
MLU_48_14709 8.1e+1 155 150 0 5 yes blast aaguccgacugcugguuuaggc uaaaccggcagucagac aaguccgacugcugguuuaggcccgauuccuggagaucgggcuuaaaccggcagucagac NW_005871095.1:562158..562218:-
MLU_52_15433 7.9e+1 152 126 0 26 yes blast ccagcagucggacauccccuga ugggggauguccgacugccaggu ugggggauguccgacugccagguuaggcccacuaccagcagucggacauccccuga NW_005871097.1:6590441..6590497:-
MLU_75_17926 7.8e+1 151 140 0 11 yes blast cacacugaccaccagggggc uccccugguggucagugugcau cacacugaccaccagggggcaccuccugcauugaguaucuguccccugguggucagugugcau NW_005871122.1:2071268..2071331:+
MLU_1351_41460 7.8e+1 150 128 0 22 yes blast ugccccaaucgccccucaggag ccucaggggcgaucaggg ugccccaaucgccccucaggaguagagggagguggagaagcccucaggggcgaucaggg NW_005872334.1:53831..53890:+
MLU_28_11334 7.7e+1 148 102 1 45 yes blast gccccgaucgccccucaggag ccugaggggcgaucggggccagu gccccgaucgccccucaggagcagggggagguggagaagcccugaggggcgaucggggccagu NW_005871075.1:1317199..1317262:-
MLU_11_6640 7.7e+1 149 143 0 6 yes blast ccagcaguuggacauccccugu gagagggauguccgacug gagagggauguccgacugugggauugggccuaaaccagcaguuggacauccccugu NW_005871058.1:12813730..12813786:-
MLU_383_33141 7.6e+1 146 135 3 8 yes blast ugcccugaucgccccucag aggggcgaucagggccggcagu ugcccugaucgccccucagaagcagggggagguggagaagcccugaggggcgaucagggccggcagu NW_005871424.1:1015800..1015867:-
MLU_13_7011 7.6e+1 145 142 1 2 yes blast ucugaggggcgaucggggcca agccccaauugucccucagg agccccaauugucccucaggagcagggggagguggagaagcucugaggggcgaucggggcca NW_005871061.1:74672..74734:+
MLU_79_18367 7.6e+1 145 143 0 2 yes blast ugcucugaucgccccucaggag ccugaggggcgaucagggc ugcucugaucgccccucaggagcagggguaggaggagaagcccugaggggcgaucagggc NW_005871125.1:816837..816897:-
MLU_20_9386 7.5e+1 153 152 0 1 no blast ugggggaugucugacugcugga cagccugcagccucucca cagccugcagccucuccaaucggggaccccuugggggaugucugacugcugga NW_005871067.1:4054065..4054118:-
MLU_386_33244 7.5e+1 145 144 0 1 yes blast ugcccccuguuggucagugagc cacugacuaccagggggcagacc cacugacuaccagggggcagacccucaaugcaagagcugcccccuguuggucagugagc NW_005871437.1:517707..517766:-
MLU_124_22424 7.5e+1 144 80 0 64 yes blast cauuuggggaguggggcuagcc ccagcaccgccccccaaucacc cauuuggggaguggggcuagccagugaacgggccagcaccgccccccaaucacc NW_005871173.1:2658105..2658159:+
MLU_177_25990 7.5e+1 143 139 0 4 yes blast ugcaggcaaggcggcuccuggg ccagggugccgccuugccug ccagggugccgccuugccugcggcccggcuuucugaucacgaucacaaucacgggcugcaggcaaggcggcuccuggg NW_005871223.1:1318035..1318113:-
MLU_73_17724 7.5e+1 143 142 0 1 yes blast ucugaggggcgaucggggcca ggccccaauugacccucaggagu ggccccaauugacccucaggaguagggggcauggagaagcucugaggggcgaucggggcca NW_005871123.1:409238..409299:-
MLU_393_33384 7.5e+1 143 139 0 4 yes blast ugcaggcaaggcggcuccuggg ccggggugccaccuugccug ugcaggcaaggcggcuccugggucccggggugccaccuugccug NW_005871478.1:472688..472732:+
MLU_1_1317 7.4e+1 143 97 0 46 yes blast cgggggaugucugacugccagc ccggcaguuggacaucccucuc cgggggaugucugacugccagcagagggaagucugacugccggcaguuggacaucccucuc NW_005871048.1:57863018..57863079:-
MLU_393_33383 7.4e+1 142 139 0 3 yes blast ugcaggcaaggcggcuccuggg ccgggguggcgccuugccug ccgggguggcgccuugccugcgccuggcuuuccgaucaugaucacgaucacgggcugcaggcaaggcggcuccuggg NW_005871478.1:472633..472710:+
MLU_43_14129 7.4e+1 142 120 0 22 yes blast gccccgaucgccccucaggacu cuccugaggggcaauuggggc gccccgaucgccccucaggacuucucuaccucccccugcuccugaggggcaauuggggc NW_005871090.1:4772519..4772578:-
MLU_62_16527 7.4e+1 143 141 0 2 yes blast ugaugucuggccucauucucagg uggguggagcccaggcauugguga ugaugucuggccucauucucagggauuccaaauuagucuggguggagcccaggcauugguga NW_005871109.1:1845974..1846036:-
MLU_89_19259 7.4e+1 142 132 0 10 yes blast uaagccagcagucggacaucu gaugucugacuucuggcuuagg gaugucugacuucuggcuuaggccugcuccccuaagccagcagucggacaucu NW_005871135.1:240274..240327:+
MLU_247_29155 7.4e+1 142 139 0 3 yes blast ugcaggcaaggcggcuccuggg ccggggugcugccuugccug ugcaggcaaggcggcuccuggguccggggugcugccuugccug NW_005871297.1:1848111..1848154:-
MLU_532_35955 7.2e+1 139 120 0 19 yes blast cugccuagaccccugcucacc uggggcggggguucugggcugg uggggcggggguucugggcugggcuggguguacucccugccuagaccccugcucacc NW_005871587.1:142646..142703:+
MLU_131_22916 7.2e+1 139 133 0 6 yes blast ugccaucagcaggugugagugg gcuugcaccugcugcuggc gcuugcaccugcugcuggcgucuggcgcugguccugaucacucugugccaucagcaggugugagugg NW_005871177.1:1215272..1215339:-
MLU_191_26753 7.2e+1 139 114 0 25 yes blast cagcagucggacaucccuugag aagagggauguccgacugcc aagagggauguccgacugccuguggacaucccuaaagcagcagucggacaucccuugag NW_005871239.1:1464126..1464185:+
MLU_487_35391 7.2e+1 145 144 0 1 no blast cuuggucuguguccuggggag uccuggaacgccgccgggccaag uccuggaacgccgccgggccaagcuuggucuguguccuggggag NW_005871569.1:215279..215323:+
MLU_25_10852 7.2e+1 136 123 0 13 yes blast cugggcgcugucagcaggugc caccugcugccagugcccagcguu caccugcugccagugcccagcguuggucccaguugcugggcgcugucagcaggugc NW_005871071.1:6519733..6519789:-
MLU_35_12721 7.1e+1 136 123 2 11 yes blast gccccgaucgccccucaggacu ccugaggggcgaucggggccgg gccccgaucgccccucaggacuucuccaccucccccugcuccugaggggcgaucggggccgg NW_005871082.1:5888588..5888650:-
MLU_13_7095 7.1e+1 136 129 0 7 yes blast gaugucugacugccagcuuagg uaagccggcaguuggauauccccu gaugucugacugccagcuuaggccugcuucccguggggaacaggccuaagccggcaguuggauauccccu NW_005871061.1:4778723..4778793:+
MLU_380_33060 7.1e+1 135 123 0 12 yes blast gccccgaucgccccucaggacu ccugaggggcgaucggggcuggc gccccgaucgccccucaggacuucucuaugucccccggcuccugaggggcgaucggggcuggc NW_005871429.1:321254..321317:+
MLU_3_2554 7.1e+1 135 128 0 7 yes blast aaugucugccugccggcuuagg uaagccggcaggcagacaucccu aaugucugccugccggcuuaggccugcucccccugggcaucagaccuaagccggcaggcagacaucccu NW_005871050.1:24462854..24462923:+
MLU_30_11805 7.1e+1 136 65 0 71 yes blast gauguccgacugccagcuuagg cuaagcuggcagguggac cuaagcuggcagguggacuaccccguaggauucuuggacugcuagaagggauguccgacugccagcuuagg NW_005871077.1:3805305..3805376:-
MLU_38_13249 7.0e+1 133 120 2 11 yes blast gccccgaucgccccucaggacu ccugaggggcgaucggggccgg gccccgaucgccccucaggacuucuccaccucccccugcuccugaggggcgaucggggccgg NW_005871085.1:6622919..6622981:-
MLU_68_17166 6.9e+1 133 124 0 9 yes blast cgcacugaccaccagggggc cuccugguggucagugugug cgcacugaccaccagggggcaauuccugcauugagugucuugcuccugguggucagugugug NW_005871115.1:5102401..5102463:+
MLU_118_22011 6.9e+1 141 138 1 2 no blast ugccaucagcaggugugagugg gcagacggggcugggggc ugccaucagcaggugugaguggcagcggugggaggagggcugacggcagacggggcugggggc NW_005871174.1:2589328..2589391:-
MLU_532_35968 6.9e+1 141 139 0 2 no blast uccggaauggggcuucagcgcug cggggagccccaguccugguuc uccggaauggggcuucagcgcuggagaucucguacaacggggagccccaguccugguuc NW_005871587.1:305746..305805:+
MLU_119_22073 6.9e+1 133 92 0 41 yes blast gagacugacgaguucccggga ugcaggaacuugugagucuccu ugcaggaacuugugagucuccuauugacaauaaacaggagacugacgaguucccggga NW_005871166.1:3306911..3306969:+
MLU_38_13236 6.8e+1 131 126 0 5 yes blast ggaccaucgguuggcgacc ucgccaaccuuucgaaccucaugg ucgccaaccuuucgaaccucauggaccaccaguggcccauggaccaucgguuggcgacc NW_005871085.1:4584397..4584456:-
MLU_118_21987 6.8e+1 130 70 0 60 yes blast acugaucaccagggggcaagu ucugcccccugguagucagug acugaucaccagggggcaaguccugugcugagugucugcccccugguagucagug NW_005871174.1:841447..841502:-
MLU_134_23176 6.8e+1 129 114 3 12 yes blast cgcuggggugccuggccagccu ccggccaagccccccagcagg cgcuggggugccuggccagccugggugaggugcugauggccguuugcaggccggccaagccccccagcagg NW_005871179.1:935000..935071:-
MLU_27_11229 6.6e+1 137 135 0 2 no blast ugaccuggggcucggagagcug gcugcucgauccacuggucc ugaccuggggcucggagagcugcuugcacucguucagcugcucgauccacuggucc NW_005871076.1:9924519..9924575:-
MLU_702_37781 6.6e+1 126 104 0 22 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacaggguguaugugaugggguuggcgu NW_005871747.1:188766..188822:+
MLU_42_14012 6.6e+1 126 104 0 22 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacuggguguaugugaugggguuggcgu NW_005871089.1:7469669..7469725:-
MLU_402_33626 6.6e+1 126 104 0 22 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguaugggguguaugugaugggguuggcgu NW_005871466.1:908482..908538:-
MLU_179_26071 6.5e+1 126 125 0 1 yes blast ugauugggcugccuccagagga acucugaggcugaccaauuggg acucugaggcugaccaauugggcaaaaucuuugaccugauugggcugccuccagagga NW_005871235.1:436834..436892:+
MLU_32_12258 6.5e+1 126 125 0 1 yes blast ugauugggcugccuccagagga acucugaggcugaccaauuggg acucugaggcugaccaauugggcaaaaucuuugaccugauugggcugccuccagagga NW_005871078.1:8876891..8876949:-
MLU_4151_43724 6.5e+1 124 113 0 11 yes blast acggaucagacccugccucucu agaggcaaguucugaucagugg agaggcaaguucugaucaguggcugccacagaggcuacggaucagacccugccucucu NW_005875157.1:6373..6431:+
MLU_13_7076 6.5e+1 124 113 0 11 yes blast acggaucagacccugccucucu agaggcaaguucugaucagugg agaggcaaguucugaucaguggcugccacagagguuacggaucagacccugccucucu NW_005871061.1:3445530..3445588:+
MLU_46_14484 6.4e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaccguuuuucauuauugcuccugacc NW_005871094.1:6255865..6255923:-
MLU_13_7014 6.3e+1 120 99 0 21 yes blast caggggaugucugacuggcagcu cuggcagucagacaucccucucg caggggaugucugacuggcagcucacguccgauccccugggaagugggccuaggcuggcagucagacaucccucucg NW_005871061.1:241078..241155:+
MLU_500_35587 6.3e+1 121 101 0 20 yes blast aucugccucucuguccccaga auggggauaguguugaggugguu auggggauaguguugaggugguucaagagccuucugaucugccucucuguccccaga NW_005871541.1:314531..314588:+
MLU_251_29308 6.2e+1 118 113 0 5 yes blast cuuguacccgcugauggcaca caccagcagugggugcaagcagg cuuguacccgcugauggcacagagcgauuagggcuggcaccagcagugggugcaagcagg NW_005871291.1:777372..777432:+
MLU_12_6778 6.2e+1 126 110 0 16 no blast cacccgcugcuggcgcccagc cucggcgccgucagcaggugc cacccgcugcuggcgcccagcucuggccccgaucacucggcgccgucagcaggugc NW_005871059.1:9239319..9239375:+
MLU_2608_43057 6.1e+1 117 110 0 7 yes blast ccggcagucggacaucccucucga uggaggauguccgacugccgga uggaggauguccgacugccggauuaggccugaucaggauugggccuaauccggcagucggacaucccucucga NW_005873598.1:7581..7654:+
MLU_4345_43794 6.1e+1 117 95 0 22 yes blast uggcagucagacaucccucucgaa ccuugggggauguccaacugcu ccuugggggauguccaacugcugguuuaggcccgaucuggcagucagacaucccucucgaa NW_005875344.1:8735..8796:-
MLU_296_30814 5.9e+1 113 110 0 3 yes blast gcuggccaagucccccagcggg cacugggaugccuggccagccug cacugggaugccuggccagccugggugagggguugauggcugcuugcaggcuggccaagucccccagcggg NW_005871337.1:1314543..1314614:-
MLU_1_1238 5.9e+1 120 119 0 1 no blast cgcgcuugcugcugcccucggc cagggccgcgggggcggcg cagggccgcgggggcggcggccacgcucuggccgcgcuugcugcugcccucggc NW_005871048.1:49280808..49280862:-
MLU_10_6047 5.9e+1 112 104 0 8 yes blast cggcagucggacaucccucu gagggauguccgacugcc gagggauguccgacugcccauuuaguccugauccuggugagaucaggcuaaacggcagucggacaucccucu NW_005871057.1:10958793..10958865:+
MLU_40_13619 5.8e+1 112 109 0 3 yes blast gagggggcugcggauuaggcc ucugaucuguagccucag gagggggcugcggauuaggccuggagaggccuguagagagagagucagggucugaucuguagccucag NW_005871088.1:7619369..7619437:-
MLU_240_28873 5.8e+1 111 109 0 2 yes blast cuaagcuggcagguggac ugacugccggcuuaggu ugacugccggcuuagguccgaucccuggccgguaucggaccuaagcuggcagguggac NW_005871296.1:65344..65402:+
MLU_13_7412 5.8e+1 110 102 5 3 yes blast acuggccaggccccccagcagga ugcuggggggcuuagccagccu ugcuggggggcuuagccagccugaaaacggcccugagccccucacccaaacuggccaggccccccagcagga NW_005871061.1:8125523..8125595:-
MLU_330_31842 5.8e+1 114 108 0 6 yes blast aaugcaguggaccugggccagau uuggccugggcacacgcauca aaugcaguggaccugggccagaugagcagcuucuacauuggccugggcacacgcauca NW_005871390.1:1179992..1180050:+
MLU_13_7401 5.8e+1 111 73 0 38 yes blast cugcagcugcuggcaggggccg cccccagcccccagccgcagcc cugcagcugcuggcaggggccgccacccaagggggcccccagcccccagccgcagcc NW_005871061.1:7885789..7885846:-
MLU_23_10090 5.8e+1 111 73 0 38 yes blast cugcagcugcuggcaggggccg cccccagcccccagccgcagcc cugcagcugcuggcaggggccgccacccagggggcgcccccagcccccagccgcagcc NW_005871069.1:2439545..2439603:+
MLU_385_33208 5.7e+1 109 107 0 2 yes blast cacccgcugcuggcgcccagc cucggcaccaucagugggug cacccgcugcuggcgcccagcgcuggcccgauugcucggcaccaucagugggug NW_005871431.1:857299..857353:+
MLU_42_13795 5.6e+1 114 48 0 66 no blast cgcugucagcgggugugagcag cucgcaccugcugcuggcacug cucgcaccugcugcuggcacugggugccagcacugaucgcucagcgcugucagcgggugugagcag NW_005871089.1:2650721..2650787:+
MLU_799_38860 5.4e+1 103 101 1 1 yes blast caggggaugucugacuggcagcu ccaucagucagacauccuuagc caggggaugucugacuggcagcuuaggccccccuugcggggagcgggccuaagccaucagucagacauccuuagc NW_005871829.1:149186..149261:+
MLU_8_5275 5.4e+1 102 50 0 52 yes blast agccccaaucaccccucaggagc ccugaggggugauuggggcugu agccccaaucaccccucaggagcaaggggaggaggagaagcccugaggggugauuggggcugu NW_005871055.1:18205519..18205582:+
MLU_298_30861 5.4e+1 103 72 2 29 yes blast ugggggaugucugacugccaga cagcagucagauaucccucuug ugggggaugucugacugccagaggcccaaccccacagggaucccugugggaucaggccuaaaccagcagucagauaucccucuug NW_005871341.1:661981..662066:+
MLU_273_30073 5.4e+1 103 89 0 14 yes blast guggaucagacccugccucucu agaggcagguacugaucaacaa agaggcagguacugaucaacaacugccacugaggcuguggaucagacccugccucucu NW_005871323.1:1205186..1205244:-
MLU_641_37229 5.4e+1 111 100 0 11 no blast cuuggcaggcgggcccuugcagc ccaggggccaugccagccagagcuaa ccaggggccaugccagccagagcuaacuucucucugcgaggcuuggcaggcgggcccuugcagc NW_005871668.1:315299..315363:+
MLU_154_24578 5.3e+1 100 75 0 25 yes blast gagagggauguccgacugcc gcagucggacaucccucgaggu gagagggauguccgacugcccuguuuuaggcuggggaucgggccuuaaacgggcagucggacaucccucgaggu NW_005871201.1:644938..645012:-
MLU_1795_42258 5.3e+1 101 41 0 60 yes blast acggaucagaccuugccucucu agaggcaaguacugaucaacagc agaggcaaguacugaucaacagcugccacugaggccacggaucagaccuugccucucu NW_005872765.1:12624..12682:-
MLU_1_468 5.2e+1 109 107 1 1 no blast ucucacucgcggcccggaag gccgggccgacagucaaa ucucacucgcggcccggaagcuggagggacgaggugugcggacaauggucagggccgggccgacagucaaa NW_005871048.1:41161286..41161357:+
MLU_45_14256 5.1e+1 97 95 0 2 yes blast ucgggggauguccaacugcc agacagacaucccccuag ucgggggauguccaacugccagguuaggggagaaagccuaucaugacagacagacaucccccuag NW_005871091.1:237099..237164:+
MLU_2_1655 5.1e+1 97 95 0 2 yes blast gcugcccccuggucgucagug ugacaacaagggggcaga ugacaacaagggggcagacguucaaugcuagagcugcccccuggucgucagug NW_005871049.1:27671428..27671481:+
MLU_33_12300 4.8e+1 91 89 0 2 yes blast cacccgcugacggcgccaagu cugggcgcuggcagcaggugu cacccgcugacggcgccaagugaucaggaccagugcugggcgcuggcagcaggugu NW_005871079.1:3287502..3287558:+
MLU_102_20571 4.8e+1 91 86 0 5 yes blast cacccgcugacggcgccaagu caggcaccagcagugggugcgag cacccgcugacggcgccaagugauugggaccagcgccaggcaccagcagugggugcgag NW_005871149.1:3404813..3404872:-
MLU_135_23246 4.8e+1 90 85 0 5 yes blast uggcagucggacauccucugag aggggauguccgucugccgu aggggauguccgucugccguaaccuggcagucggacauccucugag NW_005871178.1:3100789..3100835:-
MLU_102_20521 4.7e+1 90 88 0 2 yes blast cucggcgcugucagcaggugc cccugcugccggcgccug cccugcugccggcgccuggcgucagcccccaucgcucggcgcugucagcaggugc NW_005871149.1:3404644..3404699:+
MLU_505_35649 4.6e+1 88 82 0 6 yes blast gagagggaugucugacuacuggu uggcagucagacaucccccgag gagagggaugucugacuacugguugaugcccgauacugcagggaucccugagggauugggccuaaacuggcagucagacaucccccgag NW_005871547.1:51741..51830:-
MLU_322_31650 4.6e+1 87 71 0 16 yes blast ugcugucagcaggugcgagcgg cgcucacacccgcugcuggcg cgcucacacccgcugcuggcgccaaccccaaucgcucagugcugucagcaggugcgagcgg NW_005871385.1:463903..463964:-
MLU_18_8876 4.6e+1 88 83 0 5 yes blast caggcaucaggccugggcagggg cccgcccagaccuaacgccucu cccgcccagaccuaacgccucuggcccaggcaucaggccugggcagggg NW_005871065.1:12313329..12313378:-
MLU_150_24277 4.5e+1 88 69 0 19 yes blast cuaugcuguccugggcuucucc agagauccggggcugccuggauu agagauccggggcugccuggauuuccuccgcucugucuaugcuguccugggcuucucc NW_005871199.1:1505032..1505090:+
MLU_8_5115 4.5e+1 97 96 0 1 no blast gagagggaugucugacuacuggu ucaggcaggcaggcaggc ucaggcaggcaggcaggcgagcaguugggaaccagcagacccggauugugagagggaugucugacuacuggu NW_005871055.1:7466298..7466370:+
MLU_1447_41624 4.4e+1 84 82 1 1 yes blast uccagcucccggcgcugcccacu caggcagcgcaggcggcugagc caggcagcgcaggcggcugagccccgcagcagcggccccgcaccggccgcucgguccagcucccggcgcugcccacu NW_005872619.1:5022..5099:-
MLU_145_23911 4.4e+1 91 86 2 3 no blast uccccggccugcugcagaagcug ggcucgaguucgccgcgggcu uccccggccugcugcagaagcugcugguguggagccagcuccucggcggccugguuccggcccgguggcucgaguucgccgcgggcu NW_005871193.1:75609..75696:-
MLU_656_37388 4.4e+1 82 62 0 20 yes blast caggccagcuggcaaccccgg aggguugccgccuggccugc caggccagcuggcaaccccggcccaaguggggaccaggguugccgccuggccugc NW_005871685.1:280227..280282:+
MLU_61_16341 4.3e+1 83 76 1 6 yes blast uaagccagcagucggacauc gagucccucagccuggacugu gagucccucagccuggacugugcccucucgcaguccgggaccccucgaggggucccuggggagcgggccuaagccagcagucggacauc NW_005871107.1:1711132..1711221:+
MLU_695_37720 4.3e+1 89 88 0 1 no blast ccucugcccucugucugccucagg ucaggccccacagaagag ccucugcccucugucugccucaggccaggcggcaggaagccucgaagcagccaccagggucaggccccacagaagag NW_005871726.1:153110..153187:+
MLU_39_13375 4.2e+1 80 52 0 28 yes blast ucaaguguucuaguucagaca gucugaaccagagcacuuuu gucugaaccagagcacuuuugagaguggugcugaaugcucucaaguguucuaguucagaca NW_005871084.1:3395680..3395741:-
MLU_207_27522 4.2e+1 78 62 0 16 yes blast caggccagcuggcaaccccgg cgggguugcugccuggccug caggccagcuggcaaccccggccccagugggguccgggguugcugccuggccug NW_005871252.1:436889..436943:+
MLU_656_37387 4.1e+1 77 62 0 15 yes blast caggccagcuggcaaccccgg cgggguugccaccuggccug cgggguugccaccuggccugcgccugggcccucccgcccuccgaugccauggcgauccugggcgcaggccagcuggcaaccccgg NW_005871685.1:280163..280248:+
MLU_1248_41214 4.1e+1 87 86 0 1 no blast uugggggauguccgacugaug cucagucagggaguccc cucagucagggagucccuuagcccggccugcgccuucucgcaaucugucggaguccuugggggauguccgacugaug NW_005872324.1:54528..54605:-
MLU_10597_45012 4.1e+1 87 86 0 1 no blast uugggggauguccgacugaug cucagucagggaguccc cucagucagggagucccuuagcccggccugcgccuucucgcaaucugucggaguccuugggggauguccgacugaug NW_005881625.1:6..83:-
MLU_947_39745 4.0e+1 84 77 0 7 no blast ccacugccuccccucuccacag auggggcaggggggcgggggcagu auggggcaggggggcgggggcaguccuuccaggggcucugugcccacugccuccccucuccacag NW_005871961.1:95859..95924:+
MLU_459_34914 4.0e+1 76 48 0 28 yes blast cccugcucuccccacugcccag cagcaguggauagggccuggug cagcaguggauagggccugguggugaaagaggcagucccugaccacccugcucuccccacugcccag NW_005871528.1:581404..581471:-
MLU_100_20336 3.9e+1 75 74 0 1 yes blast ucaggccugggcaggggacu ccccucccaggccugau ucaggccugggcaggggacucccaucuccccccaaucaucggcucugccccccucccaggccugau NW_005871145.1:2294618..2294684:+
MLU_54_15624 3.9e+1 75 48 0 27 yes blast cacguugggaaacuguggcauc ugccacagcaccggacucugcc ugccacagcaccggacucugccuugcaugugaugacagacacguugggaaacuguggcauc NW_005871100.1:1677732..1677793:-
MLU_15_8183 3.9e+1 73 70 1 2 yes blast gccccgaucgccccucaggac ccugaggggcgaucagggc gccccgaucgccccucaggaccagggggagguggagaagcccugaggggcgaucagggc NW_005871062.1:9949066..9949125:-
MLU_203_27382 3.9e+1 73 64 0 9 yes blast gcucgcaacugcugcuggcgc caccagcagcgggugcgagcgc gcucgcaacugcugcuggcgcugagcgaucagggccggugcugggcaccagcagcgggugcgagcgc NW_005871254.1:1790528..1790595:+
MLU_55_15667 3.9e+1 73 52 0 21 yes blast cacugaccaccagggggcagcu ugcccucugguggucagugugg cacugaccaccagggggcagcuccugcauuuagggucugcccucugguggucagugugg NW_005871103.1:975515..975574:+
MLU_1038_40309 3.9e+1 83 81 0 2 no blast agcaggaagaggucugaucgcaga uggaucaggauucuucugcccccu agcaggaagaggucugaucgcagauuucuuggcuucuggaucaggauucuucugcccccu NW_005872068.1:90883..90943:-
MLU_3_2785 3.8e+1 71 67 0 4 yes blast cccugcccaggccugacaccu ugucaggccugggcggggg ugucaggccugggcggggggggcggagccggugaucaggggaagauggggguucccugcccaggccugacaccu NW_005871050.1:8445152..8445226:-
MLU_4_3659 3.8e+1 72 70 0 2 yes blast augcgcacugaccaccagggaa ccccugguggucagugcacuc augcgcacugaccaccagggaaaagaugcucaacacaugagcugccccugguggucagugcacuc NW_005871051.1:24750972..24751037:-
MLU_17_8534 3.8e+1 71 70 0 1 yes blast ccgcucgcacccgcugaaggca gccagcagugggugugag ccgcucgcacccgcugaaggcaccgagcaauucgaacuggugcccggcgccagcagugggugugag NW_005871063.1:11280090..11280156:+
MLU_20_9211 3.7e+1 71 70 0 1 yes blast ggaccaucgguuggcgacu ucgccaaccuuucgggccuca ucgccaaccuuucgggccucaugaaccaccaguggacugcggaccaucgguuggcgacu NW_005871067.1:4487872..4487931:+
MLU_9_5729 3.7e+1 78 73 0 5 no blast uggccaccgagggcucgccc agugggcucgcgggcggccagc agugggcucgcgggcggccagcaaguccucccgcuggccaccgagggcucgccc NW_005871056.1:15334027..15334081:+
MLU_189_26628 3.7e+1 70 69 0 1 yes blast cccccggcgccggcucugcggcu ccgcagggaggauccggggaaa cccccggcgccggcucugcggcugcugaaucggaagccgcagggaggauccggggaaa NW_005871232.1:717068..717126:+
MLU_1_569 3.7e+1 69 68 0 1 yes blast ccuggcugugcguccugcucacg agagaggacacgcagccuugggc agagaggacacgcagccuugggccugcacggagccugccgcugugcccuggcugugcguccugcucacg NW_005871048.1:48984318..48984387:+
MLU_38_13177 3.6e+1 68 62 0 6 yes blast ucagagcggccuggguccugagg cccaggacccaggcugcuu ucagagcggccuggguccugaggacacccauccccaggacccaggcugcuu NW_005871085.1:424768..424819:-
MLU_80_18450 3.6e+1 67 43 0 24 yes blast gcugccuccugguggucggugca uacugaccaccagggggcagaag uacugaccaccagggggcagaagcucaaaucaggagcugccuccugguggucggugca NW_005871127.1:1581011..1581069:-
MLU_114_21623 3.5e+1 74 69 0 5 no blast aagcuggcagucggccauccu ugagggcucccagacug aagcuggcagucggccauccucugagggcucccagacug NW_005871160.1:1389680..1389719:-
MLU_82_18726 3.5e+1 66 55 0 11 yes blast ucggugcugucagcgggugc accugcugcuggcacug accugcugcuggcacugacccugcuugcaaccacugcucgauccauugcucggugcugucagcgggugc NW_005871128.1:3922204..3922273:-
MLU_27_11131 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucauuuccugcccuggcccgagggaccgacu NW_005871076.1:7309236..7309297:+
MLU_416_33945 3.4e+1 73 32 0 41 no blast accucugacccaaaugaaccag guucaugugcguccgagggcu accucugacccaaaugaaccagcccuucccccucugguucaugugcguccgagggcu NW_005871452.1:810068..810125:-
MLU_146_23973 3.4e+1 72 69 0 3 no blast agagggaugucugacugcugu ggcgaucaggcaggcagg ggcgaucaggcaggcaggcgagugguuaggagccagcguuccuggauugcgagagggaugucugacugcugu NW_005871192.1:2219349..2219421:+
MLU_1_249 3.3e+1 62 58 2 2 yes blast gcuccggcugcagcagagaa ucuccgcuguggcugcaguga ucuccgcuguggcugcagugaggcuuggcuucucugcuccggcugcagcagagaa NW_005871048.1:21215431..21215486:+
MLU_14_7760 3.3e+1 62 45 1 16 yes blast agccccaauugccccucaggag cugaggggcgauugggacc agccccaauugccccucaggagcagggggaaguggagaagcccugaggggcgauugggacc NW_005871060.1:3520681..3520742:-
MLU_601_36821 3.2e+1 61 54 2 5 yes blast gcuccucucagcucugugcug agcuacagagcugggacuggaa agcuacagagcugggacuggaacccagauguccugcuguguauacguggcuccucucagcucugugcug NW_005871653.1:302826..302895:+
MLU_432_34346 3.2e+1 60 58 1 1 yes blast ccccaauugccccucaggacu uuccugaggggcgauugggccu ccccaauugccccucaggacuucuccaccucccccuauuccugaggggcgauugggccu NW_005871472.1:165233..165292:+
MLU_35_12713 3.2e+1 60 55 4 1 yes blast aaugcacugaccaccagggggu ccccuugauggucagugca aaugcacugaccaccaggggguagcuccuguguugagcgucugccccuugauggucagugca NW_005871082.1:4606063..4606125:-
MLU_474_35159 3.2e+1 60 55 0 5 yes blast cuggcaguuggacauccccuga gagagggaugucugacugc gagagggaugucugacugcaggaugucugacugcagggaucgcgccuaaccuggcaguuggacauccccuga NW_005871514.1:530368..530440:+
MLU_80_18436 3.1e+1 58 57 0 1 yes blast augucugacugcuggcuuagg uaagccagcagucggac augucugacugcuggcuuagguccgauccccagggcgaucgggcauaagccagcagucggac NW_005871127.1:3869872..3869934:+
MLU_11_6623 3.1e+1 67 48 18 1 no blast uccgacugcagguuuaggccu gcugggcugaggggauc uccgacugcagguuuaggccugauccucagcagucagacaucccccaaggggucccggauuggagggggugcaggcugggcugaggggauc NW_005871058.1:9694567..9694658:-
MLU_69_17344 3.1e+1 57 40 0 17 yes blast ucuugaggggcaauuggggccgg ugccccaaucgccccucagg ugccccaaucgccccucagggcuucuccaucucccccuguucuugaggggcaauuggggccgg NW_005871116.1:2771635..2771698:-
MLU_723_38111 3.1e+1 57 54 0 3 yes blast cccugcccaggccugaugccuu aggcauuaggccugggcaggggc cccugcccaggccugaugccuuggccacaggcauuaggccugggcaggggc NW_005871749.1:205786..205837:-
MLU_42_13922 3.1e+1 66 62 2 2 no blast ugccagcagcgggugugaga ccccugucugccugcagc ccccugucugccugcagccccacuucugccacugccacucccacacacugauggggccguugccagcagcgggugugaga NW_005871089.1:352369..352449:-
MLU_11_6356 3.0e+1 56 45 0 11 yes blast agccccaauugccccucaggag ccucaggggcgaucggggccgc agccccaauugccccucaggagcagggggaguuggagaaacccucaggggcgaucggggccgc NW_005871058.1:5795169..5795232:+
MLU_51_15193 3.0e+1 55 29 23 3 yes blast cacuggggugccuggccaag cuggccaaaccccccagugg cacuggggugccuggccaagccugggugaggggcugauggcuguuugcaggcuggccaaaccccccagugg NW_005871098.1:901403..901474:-
MLU_291_30651 3.0e+1 55 49 0 6 yes blast uggcaguuggacaucccucucaaa cucgagggaugucugacug cucgagggaugucugacugccuauuuaggccuggucccaguggggucgggccuaaccuggcaguuggacaucccucucaaa NW_005871350.1:1273114..1273195:+
MLU_316_31448 2.9e+1 64 61 0 3 no blast ccuugggggauggccgacu guaggacaucccucucacaaucc ccuugggggauggccgacugccggcaguaggacaucccucucacaaucc NW_005871356.1:542611..542660:+
MLU_789_38794 2.9e+1 54 26 0 28 yes blast ccuccaugucuuugugcuugcug cagcacgaggcuguggggggugc ccuccaugucuuugugcuugcuguggaguugccagagcagcacgaggcuguggggggugc NW_005871816.1:61073..61133:-
MLU_51_15284 2.9e+1 53 29 2 22 yes blast ccugaggggcaauuggggucgg ggccccgauugccccucaggac ggccccgauugccccucaggacuucuccaccucccccugcuccugaggggcaauuggggucgg NW_005871098.1:6732766..6732829:-
MLU_318_31537 2.9e+1 54 28 0 26 yes blast guuucggggugcaucaccugag aggugacacacccuggaaucgga aggugacacacccuggaaucggacucccuccucucugguuucggggugcaucaccugag NW_005871375.1:980835..980894:-
MLU_392_33371 2.8e+1 64 42 1 21 no blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucgugugucgugugugggauccgucucaguuacuuuauagcc NW_005871465.1:557284..557349:-
MLU_5_4036 2.8e+1 52 50 1 1 yes blast uccugaggggugaucggggccaac uggcccugauugccccucagggc uggcccugauugccccucagggcuucuccaccucccccuguuccugaggggugaucggggccaac NW_005871052.1:3233791..3233856:-
MLU_205_27470 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu NW_005871250.1:326957..327011:-
MLU_295_30739 2.7e+1 51 34 1 16 yes blast ucaggggugaucagggacagc gccccaaucaccccucaggagc gccccaaucaccccucaggagcagggggagguggagaagcccucaggggugaucagggacagc NW_005871354.1:77104..77167:+
MLU_299_30901 2.7e+1 50 28 0 22 yes blast uguaugugaugggguuggug ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguaugggguguaugugaugggguuggug NW_005871347.1:763543..763598:+
MLU_12_6745 2.6e+1 48 34 0 14 yes blast agcagucggacaucccucucaaa ccuugggggauguccaacugcu ccuugggggauguccaacugcuggguuaggcccaaucucgcagggauugggccuaaccuagcagucggacaucccucucaaa NW_005871059.1:6286349..6286431:+
MLU_59_16187 2.6e+1 49 38 0 11 yes blast auggaucagacccugccucucu agaggcaaguucugaucagugg agaggcaaguucugaucaguggcugccacagaggcuauggaucagacccugccucucu NW_005871108.1:4104907..4104965:-
MLU_155_24618 2.6e+1 49 46 1 2 yes blast ugcccagaucgcaccucaggagc ccucaggggugaucagggccga ugcccagaucgcaccucaggagcagggggagguggagaagcccucaggggugaucagggccga NW_005871204.1:1834296..1834359:+
MLU_349_32324 2.6e+1 48 42 0 6 yes blast gaucgggccuaaacccgcagu ugccaguuuaggccugaucc ugccaguuuaggccugaucccagggagacuugaccgcauucacauggggagaucgggccucagggaucgggccuaaacccgcagu NW_005871387.1:460453..460538:-
MLU_1721_42162 2.6e+1 47 45 1 1 yes blast ucugacccugccccucccgcagg cgugggaggugcaggcu cgugggaggugcaggcuggugcggcugggccggggcgggcccagugggcucugacccugccccucccgcagg NW_005872694.1:25150..25222:-
MLU_4_3600 2.5e+1 55 41 0 14 no blast acccucugcugucccugugcggu ugccuggggagcagaugcuagucc ugccuggggagcagaugcuaguccgcuuuaagaaggcaaggggacccucugcugucccugugcggu NW_005871051.1:17766302..17766368:-
MLU_6_4410 2.5e+1 47 27 0 20 yes blast cucugcuggugcccggca cucggcaccgucagcgggugu cucugcuggugcccggcaucagcccugaucacucggcaccgucagcgggugu NW_005871053.1:10980842..10980894:+
MLU_8_5554 2.5e+1 45 44 0 1 yes blast uccugaggggugauuggggcuga agccccaaucaccccuca agccccaaucaccccucagggcuucuccuccuccccuugcuccugaggggugauuggggcuga NW_005871055.1:18205517..18205580:-
MLU_143_23812 2.5e+1 53 52 0 1 yes blast aaugggcaguuugggaauuuaga aaauuuccaaacuguaauccuaga aaauuuccaaacuguaauccuagaagaaaugggcaguuugggaauuuaga NW_005871189.1:1074127..1074177:-
MLU_33_12345 2.5e+1 45 44 0 1 yes blast ugaggggagaucagggcuggcag ugcuggcccugaucaccucuca ugcuggcccugaucaccucucagggcuucuccacuuuccccugcuccugaggggagaucagggcuggcag NW_005871079.1:7392806..7392876:+
MLU_115_21728 2.5e+1 53 42 0 11 no blast gccggcgcagacgcucccgccu agggagggcuguggcgaccgagu agggagggcuguggcgaccgaguggagcucggccggcgcagacgcucccgccu NW_005871163.1:286211..286264:-
MLU_59_16108 2.5e+1 45 37 0 8 yes blast cuuguaccugcugauggcac ugccgucagcaggugugaguggc cuuguaccugcugauggcacagagcgaucggggcuggugccgucagcaggugugaguggc NW_005871108.1:3909707..3909767:+
MLU_139_23528 2.5e+1 46 39 0 7 yes blast accugcccucugguggucagugcgc acacugaccaccaggggc acacugaccaccaggggcagaugcucaaugcaggaccugcccucugguggucagugcgc NW_005871186.1:3376466..3376525:-
MLU_1721_42164 2.4e+1 45 43 0 2 yes blast caccagggccgcgcucacaccu gugagggccggcuccuguggcua gugagggccggcuccuguggcuacggagcucgcaccagggccgcgcucacaccu NW_005872694.1:32017..32071:-
MLU_3_2571 2.4e+1 44 20 0 24 yes blast ugccccugccuagaccuaacg uuaggccugggcaggggacc uuaggccugggcaggggacccccagcuccccgagaucucccgcucugccccugccuagaccuaacg NW_005871050.1:25720811..25720877:+
MLU_10_6079 2.4e+1 44 20 0 24 yes blast ugccccugccuagaccuaacg uuaggccugggcaggggacc uuaggccugggcaggggacccccagcuccccgugaucucccgcucugccccugccuagaccuaacg NW_005871057.1:12755328..12755394:+
MLU_127_22595 2.4e+1 43 42 0 1 yes blast cucggcaccaucagugggugug acacucacugcuggcgcuu acacucacugcuggcgcuuggcacuggcccugauugcucggcaccaucagugggugug NW_005871168.1:517046..517104:+
MLU_87_19186 2.3e+1 42 40 0 2 yes blast uccugaggggugaugggggcagc ucguccccaauagccccugagg ucguccccaauagccccugagggcuuuccaccucccccugcuccugaggggugaugggggcagc NW_005871132.1:3189785..3189849:-
MLU_412_33834 2.3e+1 49 32 15 2 no blast auguccgccugccagcuuaga guggggggguggggggc guggggggguggggggcaucccucagcccggucugugcccucuugcaguccaggaucccucgggggauguccgccugccagcuuaga NW_005871448.1:646603..646690:-
MLU_320_31574 2.2e+1 51 12 38 1 no blast cgguaaggggugugcaggagg cucuaucccucacccuuccucu cgguaaggggugugcaggagggcaggaagcagcugauggauguuucucucucauugauguuucuaucucucuaucccucacccuuccucu NW_005871361.1:954810..954900:+
MLU_45_14289 2.2e+1 40 26 0 14 yes blast cgggccuaagucaucagucaga cgacugaugacuuaggcccgcu cgacugaugacuuaggcccgcucccuaggggaagcgggccuaagucaucagucaga NW_005871091.1:4574671..4574727:+
MLU_738_38315 2.2e+1 41 39 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucagggggcucugaauguguacaguagucugcacauugguu NW_005871767.1:38011..38073:+
MLU_56_15820 2.2e+1 41 39 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucaggacaaugccguuguacaguagucugcacauugguu NW_005871102.1:232588..232648:-
MLU_3_2572 2.2e+1 40 20 0 20 yes blast ugccccugccuagaccuaacg uuaggccugggcaggggacc ugccccugccuagaccuaacgccucugaccgaggccuuaggccugggcaggggacc NW_005871050.1:25720856..25720912:+
MLU_25_10688 2.1e+1 39 33 0 6 yes blast acucacacccacugauggcacg ugccagcagcgggugcgaguggc acucacacccacugauggcacggagcaauuggggcuggugccagcagcgggugcgaguggc NW_005871071.1:3631887..3631948:+
MLU_438_34458 2.1e+1 40 26 0 14 yes blast cacggaggccuggguugggaca ucucaccccagcccuccguccga cacggaggccuggguugggacauugggaauaaaaugcaauucuucuugcaaucucaccccagcccuccguccga NW_005871483.1:566031..566105:+
MLU_3909_43663 2.1e+1 37 34 1 2 yes blast ugcacccacugacagcaccgagu ccgggugcuggcagcgggugu ugcacccacugacagcaccgagugaucggggcuggcaccgggugcuggcagcgggugu NW_005874908.1:11259..11317:-
MLU_34_12541 2.0e+1 37 34 1 2 yes blast ugcacccacugacagcaccgagu ccgggugcuggcagcgggugu ugcacccacugacagcaccgagugaucggggcuggcaccgggugcuggcagcgggugu NW_005871081.1:3128371..3128429:-
MLU_10600_45013 2.0e+1 36 32 1 3 yes blast ggcccugaucaccccugaggac cugaggggugaucagggcag ggcccugaucaccccugaggacuucuccaccucccccuacuccugaggggugaucagggcag NW_005881628.1:3472..3534:-
MLU_140_23535 2.0e+1 36 33 0 3 yes blast caccaacagugggugugagugg gcuugcacccacugauggcgcu gcuugcacccacugauggcgcugagcaauugggaccggcacugggcaccaacagugggugugagugg NW_005871190.1:568574..568641:+
MLU_513_35751 2.0e+1 37 34 0 3 yes blast uucccuccuagccucccugggu cucuuggaggcccugaggguaagucug cucuuggaggcccugaggguaagucuguuccaugcuucccuccuagccucccugggu NW_005871550.1:611236..611293:+
MLU_1_571 2.0e+1 36 31 0 5 yes blast cugcccuguguucucuccagu cuggagaggacagcagcagagc cuggagaggacagcagcagagccgggacauggcugcccuguguucucuccagu NW_005871048.1:49193707..49193760:+
MLU_258_29635 1.9e+1 40 39 0 1 yes blast uggcagucagacaucccucuuac uccgggacugcuggcucc uggcagucagacaucccucuuacaauuccgggacugcuggcucc NW_005871309.1:1765398..1765442:-
MLU_194_26916 1.9e+1 35 31 1 3 yes blast agccccgauugccccucaggac uccugaggggcgaucagggcagc agccccgauugccccucaggacuucuccaccucccucugcuccugaggggcgaucagggcagc NW_005871236.1:720688..720751:+
MLU_3_2435 1.9e+1 35 32 0 3 yes blast ucaggggugaucagggaca ugccccaaucaccccucagu ugccccaaucaccccucaguagaaggggaagguggagaagcccucaggggugaucagggaca NW_005871050.1:16857622..16857684:+
MLU_902_39532 1.9e+1 42 37 0 5 no blast accugggggugacgucaccugc gggugacgucaccugcuggucu gggugacgucaccugcuggucugugaccccguccucaccugggggugacgucaccugc NW_005871923.1:78449..78507:-
MLU_77_18167 1.8e+1 33 16 0 17 yes blast cgggcaggucugcugagccaga cuggcuggccaggcaggcucuggc cgggcaggucugcugagccagaccguguuuuccaaacagucuggcuggccaggcaggcucuggc NW_005871124.1:1381454..1381518:-
MLU_466_35016 1.8e+1 34 33 0 1 yes blast cuccaaucugagcucugccacu aggcagagcuuggcuuuggagccca aggcagagcuuggcuuuggagcccaacccacccagucuccaaucugagcucugccacu NW_005871561.1:21044..21102:-
MLU_1_1017 1.8e+1 31 28 1 2 yes blast cggccccaauugccccucaggag ccugaggggaaauuggggccag cggccccaauugccccucaggagcagggggagguggagaagcccugaggggaaauuggggccag NW_005871048.1:27495027..27495091:-
MLU_46_14382 1.7e+1 31 19 4 8 yes blast cgagcggggcagggaagagg cucuucccugcccugcccgg cgagcggggcagggaagaggcggcugcuggcgucugccucuucccugcccugcccgg NW_005871094.1:3041966..3042023:+
MLU_42_13889 1.7e+1 31 15 0 16 yes blast cugaggggcgauugggacc gccccaaucaccccucaggagc gccccaaucaccccucaggagcaggagguggagaagcccugaggggcgauugggacc NW_005871089.1:6694867..6694924:+
MLU_37_12952 1.7e+1 37 12 16 9 no blast ggcgggcaguuaggggcaaccaggc agggauguccgacugccaguu ggcgggcaguuaggggcaaccaggcagguaggcaggugagcgauuaggagccagugguccaggauugugaaagggauguccgacugccaguu NW_005871086.1:7417189..7417281:+
MLU_397_33513 1.7e+1 31 28 0 3 yes blast ugggggauguccgacugccaggu cagcaguuggacauccccug ugggggauguccgacugccagguagugggucuaagccagcaguuggacauccccug NW_005871453.1:493267..493323:-
MLU_50_15008 1.7e+1 <