miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mly/mly_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mly.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mly/mly_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mly/mly_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/mly.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/mly/mly_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
1012.72
912.42
812.32
712.12
611.72
511.22
410.92
310.72
212.42
16.82
01.52
-11.12
-21.12
-31.22
-412
-50.92
-60.82
-70.92
-80.92
-912
-1012





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
MLY_83314_24880 8.2e+6 16231660 16225353 0 6307 yes blast uauugcacuugucccggccugu agguugggaucgguugcaaugcu agguugggaucgguugcaaugcuguguuucuguaugguauugcacuugucccggccugu KI067869.1:22767..22826:-
MLY_44_38 7.5e+6 14779683 14779602 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguauuauauauaaaguauugcacuugucccggccugu KI000043.1:4160..4221:-
MLY_85285_25370 2.9e+6 5783008 5468800 0 314208 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaauaaaaaccaccgaccguugacuguacc AWHB01292029.1:7308..7370:+
MLY_62047_18861 1.1e+6 2307143 2307041 1 101 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc KI050735.1:10937..11010:-
MLY_92496_27334 1.1e+6 2250256 2225535 26 24695 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuucccacuagauugugagcuccugga KI075100.1:38037..38099:-
MLY_80859_24178 6.2e+5 1231582 1205396 0 26186 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugcagc KI065923.1:16253..16316:+
MLY_113964_33035 6.1e+5 1206888 769718 0 437170 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu AWHB01374222.1:6007..6066:+
MLY_109705_31861 5.6e+5 1114184 1107945 0 6239 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugagcacauccagggucacaggugagguucuugggagc KI088218.1:8615..8674:-
MLY_2667_869 4.6e+5 915537 915439 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuacacccugggaguuaacuguacaaccuucuagcuuucc KI002232.1:20487..20554:-
MLY_82726_24697 3.9e+5 774977 774186 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu KI067389.1:1473..1533:+
MLY_11215_3724 3.5e+5 695779 695350 46 383 yes blast uucacaguggcuaaguuccg agggcuuagcugcuugugagca agggcuuagcugcuugugagcaggaucugcaccaagucauguucacaguggcuaaguuccg KI009163.1:1861..1922:-
MLY_42340_13036 3.2e+5 631621 629434 0 2187 yes blast caacggaaucccaaaagcagcug cugcgcuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc KI034643.1:594..658:+
MLY_39041_12053 3.0e+5 601946 600186 113 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaaggaauuuuguggucacaaauucguaucuaggggaau KI031981.1:939..1001:-
MLY_82181_24544 2.6e+5 514596 514590 0 6 yes blast uucaaguaauccaggauaggcu ccuauucuugauuacuuguuuc uucaaguaauccaggauaggcuguuuccaucugugaggccuauucuugauuacuuguuuc KI066990.1:14903..14963:+
MLY_12047_3982 2.6e+5 514571 514441 4 126 yes blast uucaaguaauccaggauaggcu ccuauucucgguuacuugcacg uucaaguaauccaggauaggcugugcaggucccgaugggccuauucucgguuacuugcacg KI009839.1:19195..19256:+
MLY_32814_10273 2.1e+5 413793 413593 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacaaagucacagauucgauucuaggggaaua KI026849.1:1474..1536:-
MLY_132525_37997 2.0e+5 410736 410472 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagcugggcacagugaagagccucggggcagcucaguacaggau KI105010.1:37759..37822:-
MLY_132525_37994 2.0e+5 403218 402720 1 497 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgaggcucuucacugugcccagcucggggcagcucaguacaggau KI105010.1:37760..37823:+
MLY_147466_41772 1.6e+5 332004 328518 0 3486 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcugc uguaaacauccccgacuggaagcuguaagauacagccaagcuuucagucagauguuugcugc KI114490.1:12566..12628:+
MLY_126965_36571 1.5e+5 306458 286183 0 20275 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaucucauggcaacagcagucgaugggcugu KI100922.1:16283..16342:-
MLY_102994_30094 1.5e+5 303577 281203 0 22374 yes blast uguaaacauccuacacucucagcu cugggagaaggcuguuuacucu uguaaacauccuacacucucagcuguggaaaguaagaaagcugggagaaggcuguuuacucu KI083194.1:4946..5008:+
MLY_109705_31867 1.1e+5 227698 216275 0 11423 no blast cacccguagaaccgaccuugcg caagcucgugucuguggguccg cacccguagaaccgaccuugcggggccuucgccacacacaagcucgugucuguggguccg KI088218.1:9333..9393:-
MLY_19173_6292 1.0e+5 205288 205269 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc KI015724.1:5884..5956:+
MLY_62047_18859 1.0e+5 202828 202771 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguagugauuuuacccuguucaggagauaacuauacaaucuauugccuuccc KI050735.1:10597..10675:-
MLY_63951_19453 8.6e+4 169770 169676 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaauauuaaacaccaauauuauugugcugcuuu KI052240.1:32108..32172:-
MLY_171962_47159 8.6e+4 169524 169516 0 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaacugugcugcugaa AWHB01496937.1:12206..12271:-
MLY_37200_11525 6.9e+4 137249 73714 0 63535 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucucauccccuacuagacugaagcuccuugagga KI030486.1:9055..9113:-
MLY_32779_10265 6.6e+4 130749 130733 0 16 yes blast ggaauaccuggugcuguaggcuuu aagcucagcaggguugggccug aagcucagcaggguugggccugguuaguauuuggaugagagacuucuugggaauaccuggugcuguaggcuuu KI026821.1:29095..29168:+
MLY_6617_2166 6.6e+4 129592 129545 0 47 yes blast agcuacaucuggcuacugggucuc ggcucaguagccaguguagauc ggcucaguagccaguguagauccuguguuuuguaaucaguagcuacaucuggcuacugggucuc KI005377.1:3689..3753:-
MLY_125966_36318 6.3e+4 124146 124097 0 49 yes blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucucacugaagguuucccggaaaccacgcacaugcuguugccacuaaccucaaccu KI100176.1:12804..12883:+
MLY_172924_47424 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga AWHB01498285.1:4353..4413:-
MLY_124286_35868 4.7e+4 93473 93417 0 56 yes blast uagguaguuuccuguuguuggg caacaacauuaaaccacccga uagguaguuuccuguuguugggccuggguuucugaacacaacaacauuaaaccacccga KI098934.1:502..561:+
MLY_104330_30446 4.3e+4 84583 45301 0 39282 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuuugguaacaucacaagucaggcucuugggaccu KI084169.1:1621..1682:+
MLY_103101_30117 4.3e+4 84386 78787 0 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucacaggagcuuucagucggauguuuacagc KI083283.1:25247..25311:-
MLY_74431_22359 3.9e+4 76730 76678 7 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuacgauaccacccgguacaggagauaacuguacaggccacugccuugcc KI060748.1:7945..8024:-
MLY_70680_21265 3.5e+4 69064 68993 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuuaaacucggcaacaagaaacugccuga KI057704.1:431..489:-
MLY_79616_23832 2.9e+4 58309 58293 0 16 no blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugaggacagaggccagacccaccgagggaugaaugucac KI064905.1:1106..1170:+
MLY_63951_19455 2.7e+4 53187 52223 1 963 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauacuacagucaagaugcgaaucauuauuugcugcucu KI052240.1:32260..32319:-
MLY_172170_47209 2.5e+4 50689 45511 0 5178 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggag AWHB01497222.1:23133..23193:-
MLY_172924_47425 2.4e+4 48904 48224 0 680 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuucccga caaagugcuguucgugcagguagugugauuaccugaccuacugcugagcuagcacuucccga AWHB01498285.1:4558..4620:-
MLY_62047_18858 2.4e+4 48739 31420 15 17304 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuagggcagggauuuugcccacaaggagguaacuauacgaccugcugccuuucu KI050735.1:8546..8622:-
MLY_6617_2164 2.4e+4 47153 45507 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuugauaggcaacagcuacauugucugcuggguuu KI005377.1:2970..3032:-
MLY_2544_819 2.0e+4 40535 40373 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc KI002123.1:587..647:+
MLY_90004_26641 1.7e+4 35066 33634 0 1432 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa KI073152.1:2320..2377:+
MLY_9197_3045 1.4e+4 29088 28951 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac KI007524.1:6997..7059:+
MLY_90198_26699 1.2e+4 24403 24333 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca KI073307.1:1002..1063:+
MLY_172924_47428 1.0e+4 21038 19048 0 1990 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccucuccgugcuaccgcacuguggguacuugcu AWHB01498285.1:4783..4843:-
MLY_79616_23830 1.0e+4 21010 18901 0 2109 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc KI064905.1:928..989:+
MLY_59418_18090 9.7e+3 19044 19039 0 5 yes blast uuagggcccuggcuccaucuccu aguggggcuuugacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuuugacccuaacc KI048569.1:124890..124955:+
MLY_96656_28401 9.6e+3 18829 12036 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu KI078331.1:10323..10379:+
MLY_11215_3726 9.1e+3 18037 17780 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccugucacaaaucacauugccagggauuucca KI009163.1:2064..2122:-
MLY_111600_32334 7.2e+3 14259 14228 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauacaauuuucuagcaccaucugaaaucgguua KI089632.1:1199..1259:-
MLY_117203_33872 6.1e+3 rRNA 12010 3069 8730 211 no blast gucuacggccauaccacccugaac guuaguacuuggaugggag gucuacggccauaccacccugaacaugcccgaucucgucugaucucggaagcuaagcagggucgggcccgguuaguacuuggaugggag AWHB01382759.1:20555..20644:-
MLY_83314_24889 4.9e+3 9722 8490 0 1232 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua KI067869.1:23473..23531:-
MLY_143736_40916 4.9e+3 9678 9659 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucaugaucacaucuagcaaaucauuuuuuacucucca KI112509.1:2038..2101:+
MLY_16072_5335 4.8e+3 9566 7337 0 2229 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcaaauggaauugucucacacagaaaucgcacccguc KI013185.1:10357..10422:+
MLY_8028_2626 3.8e+3 7571 6733 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau KI006566.1:4930..4990:+
MLY_19173_6294 3.7e+3 7442 7432 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugggguagggauuuuaggccccaauuagaugauaacuauacaacuuacuacuuuccc KI015724.1:6758..6838:+
MLY_147466_41774 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaguacauggauuggcugggagguggauguuuacuuc KI114490.1:16632..16692:+
MLY_155390_43497 3.3e+3 6642 6092 0 550 yes blast gugcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcuuucugaaugcagugcaccugggcaaggauucuga AWHB01469953.1:143..205:+
MLY_82114_24534 3.3e+3 6543 6534 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagugcauccucuuacccggcuauuucacgacaccaggguu KI066929.1:10591..10660:+
MLY_69364_20934 3.2e+3 6401 5864 0 537 yes blast ucagugcacuacagaacuuugu aaaguucugagacacucugacu aaaguucugagacacucugacucugaguaugauagaagucagugcacuacagaacuuugu KI056660.1:4544..4604:-
MLY_70984_21352 3.2e+3 6328 4484 0 1844 yes blast ucccccaggugugauucugauuug uuaucagaaucuccagggguac uuaucagaaucuccagggguacuuaacauuugaaaaagucccccaggugugauucugauuug KI057956.1:8710..8772:-
MLY_142853_40673 3.1e+3 6198 6195 0 3 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu KI112012.1:32381..32441:+
MLY_2667_871 2.9e+3 5874 5061 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu KI002232.1:21212..21272:-
MLY_46507_14189 2.8e+3 5686 5582 0 104 no blast ugagaacugaauuccauaggcugu ugcccuagggacucaguucug ugagaacugaauuccauaggcuguaagcuauagcaaaugcccuagggacucaguucug KI038026.1:6085..6143:-
MLY_58420_17771 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucagucagugaauuaccgaagggccauaaa KI047756.1:333..395:-
MLY_152538_42907 2.6e+3 5235 5117 0 118 yes blast cagugcaaugaugaaagggca ucuuucgcuguugcacuacu ucuuucgcuguugcacuacugucggccgcugggaggcagugcaaugaugaaagggca AWHB01465037.1:601..658:+
MLY_26649_8382 2.5e+3 4985 4976 0 9 no blast gaagugcacgcgcuuugggac uucacaaagcccauacacuuu gaagugcacgcgcuuugggacagugaagaaaauaauguucacaaagcccauacacuuu KI021821.1:7779..7837:+
MLY_83314_24888 2.3e+3 4710 4487 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug KI067869.1:23329..23392:-
MLY_29854_9317 2.3e+3 4564 4100 0 464 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaacgu caugccuugaguguaggaacguuggcaucuuaauuauccucccacacccaaggcuugca KI024417.1:3093..3152:+
MLY_15946_5278 2.2e+3 4371 4370 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc KI013087.1:30882..30941:+
MLY_32334_10070 2.1e+3 4143 2985 0 1158 yes blast uaaugccccuaaaaauccuuau agggacuuucaggggcagcugug agggacuuucaggggcagcuguguuuuaugacucagucucauaaugccccuaaaaauccuuau KI026418.1:14872..14935:-
MLY_32334_10071 1.9e+3 3783 3263 0 520 yes blast ugggucuuugcgggcgagauga aacuggccuacaaagucccagu ugggucuuugcgggcgagaugaggguguccguucaacuggccuacaaagucccagu KI026418.1:27164..27220:-
MLY_23_31 1.7e+3 3501 3173 23 305 yes blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauuggugugaagcnnnnnnnnnnnnnnnnnnnnnugugaagcuggagacccacugccccaggugcugcug KI000023.1:9891..9976:+
MLY_83314_24883 1.1e+3 2249 2240 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu KI067869.1:23019..23078:-
MLY_134389_38481 8.9e+2 1748 1682 0 66 yes blast cuuggcaccuaggaagcacuca agugccugcuaugugccagg cuuggcaccuaggaagcacucaguaaauacuuguugagugccugcuaugugccagg KI106365.1:2671..2727:+
MLY_66440_20130 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu KI054291.1:3767..3826:-
MLY_39832_12257 5.5e+2 1085 921 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu KI032628.1:6250..6306:+
MLY_83314_24882 5.5e+2 1082 1073 0 9 yes blast ugugcaaauccaugcaaaacuga aguuuugcagguuugcauccagc aguuuugcagguuugcauccagcugugugauacucugcugugcaaauccaugcaaaacuga KI067869.1:22882..22943:-
MLY_145574_41309 5.5e+2 1080 1078 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucugaaagguacaguacugugauaacugaa KI113493.1:4394..4451:+
MLY_50632_15383 5.4e+2 1066 1065 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa KI041422.1:7762..7819:+
MLY_49183_14951 5.1e+2 1011 761 0 250 yes blast aaggagcuuacaaucuagcuggg caacuagacugugagcuucuaga aaggagcuuacaaucuagcugggggugaaugacuugcacaugaacgcaacuagacugugagcuucuaga KI040209.1:4771..4840:-
MLY_10895_3591 4.1e+2 802 472 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg KI008874.1:974..1038:-
MLY_143194_40770 3.6e+2 709 708 0 1 yes blast uguaacagcaacuccaugugga ccaguggagauguuguuacuu uguaacagcaacuccauguggacuguguaucaauuuccaguggagauguuguuacuu KI112211.1:23139..23196:+
MLY_57295_17391 3.1e+2 615 571 0 44 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagagg augcugacauauuuacuagaggguaaaauuaagaaccuucuaguaagaguggcaguugaag KI046831.1:14344..14405:+
MLY_143194_40772 3.1e+2 610 551 0 59 yes blast ugaccuaugaauugacagaca ucugucauuucuguaggccaau ugaccuaugaauugacagacaauacaauuaagugugucugucauuucuguaggccaau KI112211.1:23846..23904:+
MLY_14886_4946 3.0e+2 596 532 0 64 yes blast uugcagcugccugggagugauuuc cagucacucuaggcaccgcagc cagucacucuaggcaccgcagcacugugcuggggauguugcagcugccugggagugauuuc KI012192.1:3878..3939:-
MLY_155390_43500 2.8e+2 549 538 0 11 yes blast uacccauugcauaucggaguug accuccugugugcauggauuaca uacccauugcauaucggaguugugaauucuaaagcaccuccugugugcauggauuaca AWHB01469953.1:2253..2311:+
MLY_111600_32335 2.2e+2 442 381 4 57 yes blast gcugguuucauauggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu KI089632.1:1582..1646:-
MLY_72159_21707 2.1e+2 rRNA/tRNA 427 424 0 3 yes blast ggguucgauucccggucaggga cugcggccuggguucgauu cugcggccuggguucgauucccggucagggcugcggccgggguucgauucccggucaggga KI058939.1:78257..78318:-
MLY_100850_29543 2.1e+2 423 318 0 105 yes blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua KI081567.1:4138..4196:-
MLY_169536_46617 2.1e+2 rRNA 435 375 59 1 no blast cugguuaguacuuggaug ucuacggccauaccauccugaac ucuacggccauaccauccugaacacgcccaaucucgucugaucccagaagcuaagcagggucggggucugguuaguacuuggaug KI125010.1:10864..10949:+
MLY_29854_9320 2.0e+2 402 382 18 2 yes blast caucccuugcaugguggagggu cucccacaugcaugguuugca caucccuugcaugguggagggugcgcuugcuaaaaaccccucccacaugcaugguuugca KI024417.1:3429..3489:+
MLY_70593_21238 1.9e+2 374 135 1 238 yes blast agguucugugauacacuccgacu ucagugcaugacagaacuugggc agguucugugauacacuccgacucgggcucuggagcagucagugcaugacagaacuugggc KI057644.1:15..76:+
MLY_14540_4836 1.7e+2 341 340 0 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugaguaauagucaaggaagcaaucagcaaguauacugcccu KI011904.1:1485..1550:+
MLY_124775_35996 1.3e+2 263 243 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca KI099281.1:8693..8755:+
MLY_24147_7645 9.2e+1 179 135 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacugaaucgacaacaaaucacagucugccaua KI019749.1:16862..16926:-
MLY_127861_36821 8.7e+1 170 164 0 6 yes blast ucggggaucaucaugucacgag ugugacagauugauaacugaaag ucggggaucaucaugucacgagagaccacugugcacuugugacagauugauaacugaaag KI101582.1:459..519:+
MLY_174226_47589 7.7e+1 159 157 1 1 no blast ugcccacccagguuuua ggccagggggggggggg ggccagggggggggggggggggggggggggucuguucaguucuucugcccacccagguuuua AWHB01499681.1:24..86:+
MLY_73883_22210 6.8e+1 154 153 0 1 no blast gggggguaaaaaaaaaaaa uuuuuuuuaaaaaaaac gggggguaaaaaaaaaaaaagcaugacaggcagagggaggaugacguagcuauuuuuuuuaaaaaaaac KI060327.1:6662..6731:+
MLY_24476_7749 6.4e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaccguuuuucauuauugcuccugacc KI020050.1:3962..4020:+
MLY_43694_13426 6.3e+1 121 101 0 20 yes blast uguaugugaugggguuggcgu ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacaggguguaugugaugggguuggcgu KI035721.1:1163..1219:-
MLY_53059_16133 6.1e+1 117 113 0 4 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagua cuuuuugcggucugggcuugcuguuccucucaacaguagucaggaagcccuuaccccaaaaagua KI043410.1:24..89:-
MLY_86870_25793 5.7e+1 108 104 0 4 yes blast ccugugcccccgcccccccccccc agggggcugggcggggg agggggcugggcgggggcugcaggcccagaggggcugcgugugguggccugugcccccgcccccccccccc KI070690.1:187..258:+
MLY_99329_29128 4.2e+1 81 80 0 1 yes blast uacacacacacacacacacaug auguauguauguauguaug uacacacacacacacacacauguauguauguauguaugcaugcaugcauguauguauguauguaug KI080369.1:10115..10181:+
MLY_18584_6094 3.7e+1 84 82 0 2 no blast ugcaagcaacacucuguggcaga gacacaauuugagcuugcuaua ugcaagcaacacucuguggcagaugaucaaaacugucugacacaauuugagcuugcuaua KI015195.1:2345..2405:+
MLY_84810_25269 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucacuuccugcccuggcccgagggaccgacu KI069077.1:12861..12922:+
MLY_80243_24013 3.2e+1 63 41 1 21 yes blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucaugugucgugugugggauccgucucaguuacuuuauagcc KI065424.1:3209..3274:-
MLY_22263_7139 2.9e+1 55 34 0 21 yes blast uguaugugaugggguuggug ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguacugggguguaugugaugggguuggug KI018224.1:14786..14842:+
MLY_100520_29446 2.9e+1 54 34 0 20 yes blast uguaugugaugggguuggug ccaacccugucacauacaccug ccaacccugucacauacaccuguauuuguaagggguguaugugaugggguuggug KI081312.1:13208..13263:-
MLY_27753_8730 2.4e+1 rRNA 66 64 0 2 yes blast aaaaaaaaaaaaaaaaa uuuuuuuuuuuuuuuuuuu uuuuuuuuuuuuuuuuuuuaaggggaaaaaaaaaaaaaaaaaa KI022716.1:40851..40894:+
MLY_124222_35848 2.1e+1 40 39 0 1 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucaggacaaugccguuguacaguagucugcacauugguu KI098882.1:17303..17363:-
MLY_42340_13037 2.1e+1 39 37 0 2 yes blast gaacgaaauccaagcgcagcug gcugcuuuugggauuccguugcc gaacgaaauccaagcgcagcuggaaugcucuggagacaacagcugcuuuugggauuccguugcc KI034643.1:592..656:-
MLY_113964_33037 1.1e+1 19 10 0 9 yes blast ugaggggccucagaccgagcuu gucucgcucucugccccucagc ugaggggccucagaccgagcuuuuggaaaauagaaaagucucgcucucugccccucagc AWHB01374222.1:6005..6064:-
MLY_95341_28100 1.0e+1 17 12 0 5 yes blast uaaaaugcucagacuccuguggu ccacggauguuugagcaugugcua uaaaaugcucagacuccugugguggcugcucaugcaccacggauguuugagcaugugcua KI077329.1:4669..4729:-
MLY_192458_49086 8.4 17 11 0 6 yes blast uaauuuuauguauaagcuagu gagcuuauucauaaaaguacag gagcuuauucauaaaaguacaguauaauccaguaaaccuguaauuuuauguauaagcuagu AWHB01517913.1:1744..1805:-
MLY_29411_9202 7.0 23 16 0 7 no blast gaggaggaggaggagga cccucugccucccccaag cccucugccucccccaaggaggaggaggaggagga KI024031.1:4889..4924:+
MLY_30043_9398 4.3 6 5 0 1 yes blast gacccacagguugagaacggcugcc gcagugguucucaaccuu gcagugguucucaaccuucccccccccacaacccuuuaauacaguuccaaggggucacgacccacagguugagaacggcugcc KI024546.1:1359..1442:-
MLY_159934_44480 4.1 4 3 0 1 yes blast ugcccccuucuccccuccucc agggggccgggaggggg agggggccgggagggggcagggaaagggccuugcccccuucuccccuccucc KI120594.1:13111..13163:-
MLY_50565_15371 3.9 4 3 0 1 yes blast gcgggcucagggccaagc uaccaggacccaggccg gcgggcucagggccaagcggguagguugggaaggacacuucccccgaccuguuuaccaggacccaggccg KI041363.1:1522..1592:-
MLY_5206_1679 3.1 13063 13063 0 0 yes blast guucgcgcucuccccug ggggggggggggagcca guucgcgcucuccccugggggggggggggccaagcccccccccccgggggggggggggagcca KI004306.1:2441..2504:-
MLY_118808_34309 3.1 3 2 0 1 yes blast ucugugccucagcuuuccug aggaaggcuggugcaagaga aggaaggcuggugcaagagaauggaaccacgugucccagcucuugcagcaaggcuggucagcugccaucucugugccucagcuuuccug KI094933.1:17059..17148:+
MLY_27607_8673 3.0 35 35 0 0 yes blast cggggcggggcggggcggg ggucacugcccagccccgca cggggcggggcggggcgggccuccacguccaggcuggucacugcccagccccgca KI022581.1:657..712:-
MLY_137568_39306 3.0 3855 3855 0 0 yes blast ggguucguuucccggucaggga ccugauggggggggggcuuaa ccugauggggggggggcuuaaggcuucggcgcuggcauugucagugcugcggccuggguucguuucccggucaggga AWHB01435426.1:13442..13519:-
MLY_85705_25484 3.0 76 57 0 19 yes blast uaugugacaggguuggcgcca ccaacccugucacauacaccug ccaacccugucacauacaccuguauucguacgggguguaugugacaggguuggcgcca KI069776.1:31548..31606:-
MLY_9350_3088 2.9 3977 3977 0 0 yes blast uguguauguguguguauauaug uauauacacacacauacacaca uguguauguguguguauauaugugcacaugugugugugcacauacacgcauauacacacacgcacauauauacacacacauacacaca KI007667.1:7702..7790:+
MLY_9350_3089 2.9 3977 3977 0 0 yes blast uguguauguguguguauauaug uauauacacacacauacacaca uguguauguguguguauauaugugcguguguguauaugcguguaugugcacacacacaugugcacauauauacacacacauacacaca KI007667.1:7700..7788:-
MLY_34840_10807 2.8 142 142 0 0 yes blast ggguucgauucccagacggggagc ucccuggugguguaguggcuuag ucccuggugguguaguggcuuagggcuucggcgcuggcgcugucagcgcugcagcccuggguucgauucccagacggggagc KI028482.1:4699..4781:+
MLY_80776_24160 2.8 3977 3977 0 0 yes blast uguguauguguguguauauaug uaaauuuacauauauauacaca uguguauguguguguauauauguguguguauguauguguguauauauauguaaauuuacauauauauacaca KI065852.1:12304..12376:+
MLY_58079_17670 2.8 112 111 0 1 yes blast uguaugugaugggguuggcgu aacccugucacauacac aacccugucacauacacuuguauuuguaugggguguaugugaugggguuggcgu KI047505.1:3884..3938:-
MLY_85705_25482 2.8 22 19 0 3 yes blast ccaacccugucacauacaccc agguguaugugacaggguuggc ccaacccugucacauacaccccguacgaauacagguguaugugacaggguuggc KI069776.1:31553..31607:+
MLY_150849_42528 2.8 44 44 0 0 yes blast ggguucgauucccggucgggga ccugaugguguaguggcuuggg ccugaugguguaguggcuuggggcuucggcgcuggugcugucggcgcugcggccuggguucgauucccggucgggga KI116210.1:9981..10058:-
MLY_160172_44548 2.8 120 120 0 0 yes blast cugccuagaccccugcucacc ggggcagggguccugggcugggg ggggcagggguccugggcuggggcugggcgaacucccugccuagaccccugcucacc KI120711.1:11099..11156:-
MLY_19634_6437 2.7 111 111 0 0 yes blast uguaugugaugggguuggcgu gccaaccccgucacauacauc gccaaccccgucacauacaucuguauuuguaugggguguaugugaugggguuggcgu KI016088.1:2803..2860:+
MLY_7979_2606 2.7 104 104 0 0 yes blast uguaugugaugggguuggcgu gccaaccccgucacacacacc gccaaccccgucacacacaccuguauuuguaugggguguaugugaugggguuggcgu AWHB01029662.1:6711..6768:-
MLY_170538_46821 2.7 380 380 0 0 yes blast gguucgauucccggucaggaa ccugauggggggguggcuua ccugauggggggguggcuuagggcuucggcgcugacacugucagcgcugccaccuggguucgauucccggucaggaa AWHB01494864.1:3910..3987:+
MLY_100498_29431 2.7 72 62 0 10 yes blast uaugugacaggguuggcgcca ccaacccugucacauacaccc ccaacccugucacauacacccuguacaaauauagguguaugugacaggguuggcgcca KI081294.1:13656..13714:-
MLY_111590_32330 2.7 39 39 0 0 yes blast ggguucgauucccggucgggga ccugguggugcaguggcuuuag ccugguggugcaguggcuuuaggcuucggcgcuggcgcugucagcgcugcggccuggguucgauucccggucgggga KI089623.1:326..403:-
MLY_71411_21448 2.7 18 18 0 0 yes blast cagccccagccccagccccag ggagcuggggguggggcucuuggg ggagcuggggguggggcucuugggcgcagacuguccagccccagccccagccccag KI058306.1:15697..15753:-
MLY_170211_46772 2.7 3 2 0 1 yes blast acgguuccucuccccagac aggggcuggggggacaca acgguuccucuccccagacugggaguccgacuccucauuguccaccucccaaggggcuggggggacaca KI125288.1:17412..17481:+
MLY_18293_6005 2.7 13 13 0 0 yes blast uguaugugaugggguuggcacg cgccaacccugucacaugcacc cgccaacccugucacaugcaccuguauuuguagggguguaugugaugggguuggcacg KI014955.1:19136..19194:+
MLY_152389_42872 2.7 53 53 0 0 yes blast ccgggcuggggcgggggg cccugcucugcgucgggg cccugcucugcgucgggggcuuucccgggcuggggcgggggg AWHB01464771.1:97..139:-
MLY_5041_1602 2.7 34 21 0 13 yes blast ccaacccugucacauacaccug uguaugugaugggguuggcacg ccaacccugucacauacaccuguauuuguacgggguguaugugaugggguuggcacg AWHB01018934.1:16218..16275:-
MLY_57800_17567 2.7 69 69 0 0 yes blast ggguucgauucccgggcgg ggugggggaguggcuuggg ggugggggaguggcuuggggcuucggcgcugccucugucagcgcugcggccuggguucgauucccgggcgg KI047265.1:2973..3044:+
MLY_121555_35027 2.6 33 20 0 13 yes blast ccaacccugucacauacaccug uguaugugaugggguuggcacg ccaacccugucacauacaccuguauuuguacaggguguaugugaugggguuggcacg KI096943.1:2771..2828:+
MLY_55236_16803 2.6 175 174 0 1 yes blast ucaacccugucacauacaccug uguaugugaugggguug ucaacccugucacauacaccuguauuuguaugagguguaugugaugggguug KI045166.1:2597..2649:-
MLY_139698_39863 2.6 12 12 0 0 yes blast ggguucgauuccccgccgggga ccugguggugggguggcuuaa ccugguggugggguggcuuaaggcuucagcgcugccagugcugcagccuggguucgauuccccgccgggga KI110049.1:3822..3893:+
MLY_49072_14901 2.6 669 669 0 0 yes blast agucgggccgucgggcc cccggcggcuggugaac cccggcggcuggugaacagucaggugggugagcgcuucucacuaccugcugagucgggccgucgggcc KI040105.1:15435..15503:-
MLY_24735_7812 2.6 rRNA/tRNA 99 99 0 0 yes blast ucguuucccggucagggaa cccuggugguguaguggcu cccuggugguguaguggcuuaaggcuucggcguuggcacugucagcgcugcggccuggggucguuucccggucagggaa KI020277.1:3017..3096:-
MLY_125750_36260 2.6 3855 3855 0 0 yes blast ggguucguuucccggucaggga ccugaugguguaguggcuuaa ccugaugguguaguggcuuaaggcuucggcgcuggugcugucagcgcugcggccuggguucguuucccggucaggga KI100015.1:13769..13846:-
MLY_133165_38173 2.6 18 18 0 0 yes blast gauucccagucagggaagc ucccugaugggggggggg ucccugauggggggggggcuuaaggcuucggcgcugucgcugucagcgcugcggcccggguucgauucccagucagggaagc KI105477.1:1991..2073:+
MLY_123959_35750 2.6 44 44 0 0 yes blast ggguucgauucccggucgggga ccugguggugugggggcuua ccugguggugugggggcuuagggcuucagcgcuggcgcugucagcgcugcggccuggguucgauucccggucgggga KI098687.1:7324..7401:-
MLY_92369_27274 2.6 179 179 0 0 yes blast ggguucgauucccggucaggg cugauggucuagcggcuuag cugauggucuagcggcuuagggcuucagcgcuggcgcugucagugcugcggccuggguucgauucccggucaggg KI075009.1:18471..18546:-
MLY_55422_16844 2.6 44 44 0 0 yes blast ggguucgauucccggucgggga ccugaugguguaauggcuuaa ccugaugguguaauggcuuaaggcuucagcguuggcgcugucagcgcugcggccuggguucgauucccggucgggga KI045332.1:1855..1932:-
MLY_177622_47763 2.6 17 17 0 0 yes blast uucccggucagggaacc cucccugguggagua cucccugguggaguaguggcugggcuucggugcucucaccacugaggcccgggcucaguucccggucagggaacc AWHB01503077.1:869..944:+
MLY_147345_41754 2.6 355 322 33 0 yes blast uguguaugugugugucuauaua uguauacacacacacacacacg uguauacacacacacacacacgcauauauauacauauaugcguguguuuguguguguguguguguguaugugugugucuauaua AWHB01455645.1:1678..1762:-
MLY_17028_5657 2.6 254 249 5 0 yes blast cagcagcacacugugguuugua caaaccacacugugguguuagagcgag cagcagcacacugugguuuguacggcacuguggccacguccaaaccacacugugguguuagagcgag KI013977.1:111..178:-
MLY_102735_30027 2.5 99 99 0 0 yes blast ucguuucccggucagggaa cccugaugguguaguagcu cccugaugguguaguagcuuaaggcuuuggcgcuggcacugucagcgcugcggccuggggucguuucccggucagggaa KI082996.1:6705..6784:+
MLY_123758_35660 2.5 18 18 0 0 yes blast gauucccagucagggaagc ucccugaugguguaucgg ucccugaugguguaucggcuuaaggcuucggcauuggcacugucagcgcugcggccugaguucgauucccagucagggaagc AWHB01399985.1:332..414:-
MLY_11278_3749 2.5 22 22 0 0 yes blast ucucccaacccuuguaccagug cugguacagguauggggggca ucucccaacccuuguaccagugaugugcugcagucccugguacagguauggggggca KI009221.1:7495..7552:-
MLY_7895_2569 2.5 22 22 0 0 yes blast ggguucgguucccggucaggg cugauggcccccccccccccc cugauggccccccccccccccgcuucggcgcuggugcugucggcgcuguggccuggguucgguucccggucaggg KI006476.1:11583..11658:+
MLY_86317_25647 2.5 3855 3855 0 0 yes blast ggguucguuucccggucaggga ccuguugguguagggggggggg ccuguugguguagggggggggggcuucggcacuggugcugccagcgcugcggccuggguucguuucccggucaggga KI070274.1:23260..23337:+
MLY_137084_39166 2.5 44 44 0 0 yes blast ggguucgauucccggucgggga ccuggugguguagcggcuuggg ccuggugguguagcggcuuggggcuuuggcgcuggcgcugucagcgcugcggccuggguucgauucccggucgggga KI108300.1:31149..31226:-
MLY_65549_19907 2.5 65 65 0 0 yes blast cgccgcggcccggguucgauu gggggggggggcuucagcgcu gggggggggggcuucagcgcuggugcugucagcgccgcggcccggguucgauu KI053552.1:8712..8765:+
MLY_3665_1161 2.5 33 20 0 13 yes blast ccaacccugucacauacaccug uguaugugaugggguuggcacg ccaacccugucacauacaccuguauuuguaugggguguaugugaugggguuggcacg KI003049.1:752..809:+
MLY_146426_41492 2.5 22 22 0 0 yes blast ggguucgguucccggucaggg cuggugguccccccccuu cuggugguccccccccuuaaggcuucggcacuggcgccgucagcgcuacggccuggguucgguucccggucaggg KI113938.1:1994..2069:-
MLY_81169_24256 2.5 294 294 0 0 yes blast ucccugguggucuaguggcu cuucgauuccccccccgggaac ucccugguggucuaguggcuaggcuucggcgcuguuggcgcugcagccuggcuucgauuccccccccgggaac KI066152.1:9885..9958:+
MLY_11751_3884 2.5 18 18 0 0 yes blast ccaacccugucacauacaccccc aggugcaugugacgggguuggcg ccaacccugucacauacacccccuacaaauacaggugcaugugacgggguuggcg KI009639.1:6090..6145:+
MLY_52191_15842 2.5 44 44 0 0 yes blast ggguucgauucccggucgggga ccugaugguguaguggcuuaa ccugaugguguaguggcuuaaggcuucagcguuggcgcugucagcgcugcggccuggguucgauucccggucgggga KI042715.1:1670..1747:-
MLY_18354_6032 2.5 179 179 0 0 yes blast ggguucgauucccggucaggg cuggugguguagcggcuuaa cuggugguguagcggcuuaaggcuuuggcgcuggcgcugucagcgcugcggccuggguucgauucccggucaggg KI015008.1:7892..7967:-
MLY_25956_8192 2.5 70 69 1 0 yes blast augugcaugugcgugugcgug uguauaugugugugcgugc augugcaugugcgugugcgugcgugugcaugugugugagugcaugugugugcguguauaugugugugcgugc KI021252.1:2180..2252:+
MLY_147875_41855 2.5 18 18 0 0 yes blast aauggggugccuggucagccu gcugaccagacacaccguucg gcugaccagacacaccguucgaaacgggacagaaccguuguuuucuguccuguuuaaaauggggugccuggucagccu KI114706.1:4..82:+
MLY_14143_4718 2.5 34 34 0 0 yes blast uguguguguacguguguauau auacacacguguguaugcaua uguguguguacguguguauauauguauacaugugugugcgcgcauguguguauauguguauacacacguguguaugcaua KI011582.1:13344..13424:+
MLY_95435_28125 2.5 122 122 0 0 yes blast uugguccccuucaaccagc uggucaaacggaaccaagu uggucaaacggaaccaaguccgucuuccugagagguuugguccccuucaaccagc KI077410.1:10754..10809:+
MLY_24596_7783 2.4 16 16 0 0 yes blast uccuucauuccaccggagucugu agauuucaguggagugaagcuca uccuucauuccaccggagucugucucguacccaaccagauuucaguggagugaagcuca KI020155.1:836..895:-
MLY_9784_3210 2.4 131810 131810 0 0 yes blast uuaaugcuaaucgugauagggguu cuccuacacauuagcauuaaca uuaaugcuaaucgugauagggguuuuaccuccaaccaacuccuacacauuagcauuaaca KI008050.1:10137..10197:+
MLY_81688_24392 2.4 456 456 0 0 yes blast ggguucgauucccggucaggga ccugaugguguaguggcuugag ccugaugguguaguggcuugaggcuuuggcgcuggcgcugucggcgcugcagccuggguucgauucccggucaggga KI066599.1:9705..9782:-
MLY_182634_48107 2.4 204 204 0 0 yes blast ucccgcagcuccugcucugg ggggcagggggaugcgggcuc ucccgcagcuccugcucugguuguccucagccaagacgaggccauagccccucucggcuucugcucccggggcagggggaugcgggcuc AWHB01508089.1:15..104:-
MLY_68943_20816 2.4 16 16 0 0 yes blast guaguggcuaggcuucggcgcua acgcugcggccuggguuugauuc guaguggcuaggcuucggcgcuaucaacgcugcggccuggguuugauuc KI056297.1:11401..11450:+
MLY_155390_43501 2.4 6898 6898 0 0 yes blast augcaccugggcaaggauucaga uaauccuugcuaucugggugcuagu uaauccuugcuaucugggugcuagugcugucucaaugcaaugcaccugggcaaggauucaga AWHB01469953.1:3167..3229:+
MLY_49438_15026 2.4 32 32 0 0 yes blast cacuagacugugagcuccuuga acgggcuggcacgucugccgcc acgggcuggcacgucugccgcccccacuagacugugagcuccuuga KI040445.1:26406..26452:-
MLY_48526_14716 2.4 599 581 0 18 yes blast aauggcgccacuaggguug caacccuaggaaagugugccauuc caacccuaggaaagugugccauucacauagacuaaaauugaauggcgccacuaggguug KI039683.1:2092..2151:-
MLY_136355_39012 2.4 50 50 0 0 yes blast ugcccaccagguccucacugc aggcuagcaggugggcaga aggcuagcaggugggcagaggcuggggugugcccaccagguccucacugc KI107801.1:957..1007:-
MLY_50041_15227 2.4 25 25 0 0 yes blast uguaugugaugggguuggug ccaacacugucacauacacc ccaacacugucacauacaccugaaucuguacgggguguaugugaugggguuggug KI040933.1:151..206:+
MLY_46515_14192 2.4 3855 3855 0 0 yes blast ggguucguuucccggucaggga ccugaugguguagcagcuuaa ccugaugguguagcagcuuaaggcuucggcauuggcacugucagcgcugcggcuuggguucguuucccggucaggga KI038033.1:8..85:-
MLY_126683_36507 2.4 970 970 0 0 yes blast agcagggucgggccuggu cacggcccuaccacccugg cacggcccuaccacccugggcaugcccgaucuccucugaucccggcagcucagcagggucgggccuggu KI100719.1:1836..1905:+
MLY_128930_37099 2.4 159 159 0 0 yes blast aggaguucugggcuguagug cuguagucccagcugcucugga cuguagucccagcugcucuggagguugaggcaggcggaucgccuugagcucaggaguucugggcuguagug KI102402.1:9819..9890:+
MLY_15347_5079 2.4 32 20 0 12 yes blast ccaacccugucacauacaccug uguaugugaugggguuggcacg ccaacccugucacauacaccuguauuuguaugggcuguaugugaugggguuggcacg KI012620.1:756..813:+
MLY_61119_18613 2.3 136 136 0 0 yes blast uggaagacuagugauuuuguuguu caacaagucacagcuuccuca uggaagacuagugauuuuguuguucugauguaugaugacaacaagucacagcuuccuca KI049984.1:7962..8021:-
MLY_51045_15525 2.3 1161 1161 0 0 yes blast ucaccccucuccucccgucu gcgaaaggaggaagauggggugauc ucaccccucuccucccgucugugagaaaugggcgaaaggaggaagauggggugauc KI041754.1:3806..3862:-
MLY_77787_23356 2.3 rRNA 173 168 0 5 yes blast ugugugugugugugugugugu acacacacacacacacac uguguguguguguguguguguaugaauauauauacacacacacacacacac KI063437.1:4939..4990:+
MLY_77013_23146 2.3 25 25 0 0 yes blast uggagugugacaaugguguuu acgccauuaucacacuaaaua uggagugugacaaugguguuuguguccaaacuaucaaacgccauuaucacacuaaaua KI062812.1:2928..2986:+
MLY_121232_34928 2.3 22 22 0 0 yes blast ccuggcccuggcugagacacug guguucagccugcgccaggcu ccuggcccuggcugagacacugcagugcugugcugaguguucagccugcgccaggcu AWHB01393428.1:374..431:+
MLY_43760_13435 2.3 380 380 0 0 yes blast gguucgauucccggucaggaa ccugaugguguaguggcuua ccugaugguguaguggcuuaaggcuucggcgcuggcacugucagcgcugcggccuggguucgauucccggucaggaa AWHB01156523.1:1219..1296:+
MLY_157104_43859 2.3 426 425 0 1 yes blast ggguucgauucccggucaggga cgcugcggccuggauucg ggguucgauucccggucagggagcgcugcggccuggauucg KI119249.1:3375..3416:+
MLY_41408_12729 2.3 34 34 0 0 yes blast uguaugugaugggguuggug ucaacucugucacauacacc ucaacucugucacauacaccugauuuguaccaguuguaugugaugggguuggug KI033907.1:16692..16746:+
MLY_171779_47089 2.3 69 69 0 0 yes blast ggguucgauucccgggcgg gaugguguaguggcuuaa gaugguguaguggcuuaaggcuucagcguuggcgcugucagcgcugcagccuggguucgauucccgggcgg AWHB01496668.1:2750..2821:+
MLY_100009_29316 2.3 13 12 1 0 yes blast cccccugcccugcccugccc gcaggauagcaucuauguggggug cccccugcccugcccugcccuuugugcucagucccugagccuggagcaggauagcaucuauguggggug KI080914.1:3822..3891:+
MLY_14311_4762 2.3 3855 3855 0 0 yes blast ggguucguuucccggucaggga ccugaugguguaguggcuuaa ccugaugguguaguggcuuaaggcuuugacgcuggcgcugucagugcugcggccuggguucguuucccggucaggga KI011707.1:765..842:-
MLY_120326_34704 2.3 54 54 0 0 yes blast ucugagcccagcucugcccucu aaggcagcgcuaggggugccccagagu aaggcagcgcuaggggugccccagagucucucaguaguuggaugucauuuccaagcugucucugagcccagcucugcccucu AWHB01391037.1:514..596:-
MLY_132525_37993 2.3 402720 402720 0 0 yes blast uccuguacugagcugccccgag cagcagccagcucugacc cagcagccagcucugaccucauccucccugagggauccuguacugagcugccccgag KI105010.1:37725..37782:+
MLY_21513_6948 2.3 3855 3855 0 0 yes blast ggguucguuucccggucaggga ccuaaugguguaauggcuuaa ccuaaugguguaauggcuuaaggcuuuagcgcugccgcugucagcgcugcagucuggguucguuucccggucaggga KI017633.1:18400..18477:-
MLY_49881_15178 2.3 37 37 0 0 yes blast cgcggcggcgucggcggc uacccacccgcugcaga cgcggcggcgucggcggcggcaacuuuccgauacccacccgcugcaga KI040828.1:5177..5225:+
MLY_94224_27779 2.3 483 483 0 0 yes blast ugagaacugaauuccauggguug accugugaaguucaguucuucag ugagaacugaauuccauggguugugucaacgucagaccugugaaguucaguucuucag KI076462.1:4201..4259:-
MLY_100009_29317 2.3 31 31 0 0 yes blast cagggcgggaggggcggc ccuguccccaucucggucuggc cagggcgggaggggcggcugcccugcugacauguggagucagcagaaggaaaguagggguggcccuguccccaucucggucuggc KI080914.1:2880..2965:-
MLY_100157_29364 2.2 1059 1059 0 0 yes blast ucuuugguuaucuagcuguauga auaaagcuagauaaccgaaagua ucuuugguuaucuagcuguaugaguguauuggucuucauaaagcuagauaaccgaaagua KI081021.1:6214..6274:+
MLY_65317_19838 2.2 14 14 0 0 yes blast gcgggcagggcagggcaggg gugcgcuagagaccugcaggcuu gcgggcagggcagggcagggcaggugcacagcaaggacaggaaacagggccgugcgcuagagaccugcaggcuu KI053368.1:558..632:+
MLY_74022_22245 2.2 49366 49366 0 0 yes blast agcagcauuguacagggcu cuucuuuacagugcugccuug cuucuuuacagugcugccuuguugcauauggaucaagcagcauuguacagggcu KI060437.1:17332..17386:+
MLY_41080_12651 2.2 453 453 0 0 yes blast ccaccaccuuccugugg acauggaagugggggg acauggaagugggggggccacaggauaucugagcuucccccaccaccuuccugugg KI033608.1:7557..7613:+
MLY_146002_41409 2.2 12 10 2 0 yes blast auauauguauguguguaugugu guguauauauguauguguaugu auauauguauguguguauguguguuuguguguguguauguguauauauaugcauguguguauauauguauguguaugu KI113716.1:17677..17755:-
MLY_14044_4681 2.2 13 13 0 0 yes blast uggaggagcucacagccuagu caggugugagauuccggg caggugugagauuccggggagacagaggcugggccccugcccuggaggagcucacagccuagu KI011505.1:5685..5748:+
MLY_80708_24145 2.2 264 264 0 0 yes blast guagguuugguccuggccuua aggucaggccccuccucug guagguuugguccuggccuuaccaaggggcuaggucaggccccuccucug KI065793.1:5878..5928:-
MLY_152068_42774 2.2 18 18 0 0 yes blast augugugugugugugugugagg uccaaauacagauaaaauuucaguc augugugugugugugugugagggagggggguuuacuucauccuccaaauacagauaaaauuucaguc AWHB01464199.1:45..112:+
MLY_143531_40846 2.2 21 20 1 0 yes blast augggccgggcagggacca gcagugcucugcccggau gcagugcucugcccggaugggaccuccgaccaccaagugaugguggcggcagugaagaugggccgggcagggacca KI112407.1:5942..6018:-
MLY_20161_6581 2.2 163 163 0 0 yes blast ucaacccugucacauacaccug gggaguaugugauggggguggca ucaacccugucacauacaccugcauuuguacagggaguaugugauggggguggca KI016457.1:13173..13228:-
MLY_24448_7738 2.2 59 58 1 0 yes blast augugcaugugcgugugcgug uguacaugugcgagagugugugc uguacaugugcgagagugugugcaagugugugugugugcauguguaugugcaugugcgugugcgug KI020022.1:23459..23525:-
MLY_44_40 2.2 1090 1089 0 1 yes blast ugugcaaauccaugcaaaacuga uuaguuuugcagguuug uuaguuuugcagguuugcauuucagcguauauauguauauauggcugugcaaauccaugcaaaacuga KI000043.1:4307..4375:-
MLY_132679_38040 2.1 18 18 0 0 yes blast gauucccagucagggaagcu uucccugaugguguagugg uucccugaugguguaguggcuuaaggcuucgucauuggugcugucauugcugcggccuggggucgauucccagucagggaagcu KI105127.1:1768..1852:-
MLY_4094_1290 2.1 30 30 0 0 yes blast ugagcccuggguucgauuccc guguaguggcuaggcuucggu guguaguggcuaggcuucggugcucucaacacugagcccuggguucgauuccc KI003342.1:8663..8716:-
MLY_5888_1932 2.1 265 265 0 0 yes blast accucuuuccuccugugcagu ugcccaggucagaaagagcugg accucuuuccuccugugcagugagauuacccuggcucugcccaggucagaaagagcugg KI004840.1:991..1050:+
MLY_25121_7914 2.1 26007 26007 0 0 yes blast ucccuguucgggcgcca gcgcaugugaacgggugaacc ucccuguucgggcgccacuugccgcgaccugcgcaugugaacgggugaacc AWHB01091506.1:739..790:+
MLY_55219_16797 2.1 18 18 0 0 yes blast acucaaacugugggggcacuu gugccgccaucuuuugaguuu acucaaacugugggggcacuuucuguuucugucgaggaaagugccgccaucuuuugaguuu KI045152.1:14283..14344:-
MLY_172486_47291 2.1 1110 1110 0 0 yes blast ggguucgauucccggucagggaaa ucccuggugguguaguggcuag ucccuggugguguaguggcuaggcuucggcgcucucaacgcuguggccuggguucgauucccggucagggaaa AWHB01497666.1:3309..3382:+
MLY_102176_29907 2.1 73782 73780 0 2 yes blast caaagaauucuccuuuugggcuu cccaaaggugaauuuuuugggaa caaagaauucuccuuuugggcuuucugaguuuauuuuaagcccaaaggugaauuuuuugggaa KI082568.1:11620..11683:-
MLY_29854_9322 2.1 548 548 0 0 yes blast uaauccuugcuaccugggugagagu ugcaucggggcaaggauucca uaauccuugcuaccugggugagagugcuauugaaaugcagugcaucggggcaaggauucca KI024417.1:8526..8587:+
MLY_92328_27263 2.1 rRNA 45005 45005 0 0 yes blast ggaauaccaggugcuguaggcuu gcaggguccggccuggcuaguacuug gcaggguccggccuggcuaguacuuggguggacgaccacccaggaauaccaggugcuguaggcuu AWHB01313157.1:435..500:+
MLY_50361_15310 2.1 825 825 0 0 yes blast gcggcccggguucgacuccc guaggggggggggggucggcac guaggggggggggggucggcacugucaacgcugcggcccggguucgacuccc KI041181.1:15742..15794:-
MLY_78748_23606 2.1 336 336 0 0 yes blast caguugguuagagcguggugc aucaggcuuguccaaccugug caguugguuagagcguggugcugauaaaucaggcuuguccaaccugug KI064216.1:23088..23136:+
MLY_127861_36826 2.1 12 12 0 0 yes blast uuuugcgauguguuccuaauau auugggaacauuuugcaugcau uuuugcgauguguuccuaauaugcaguauaaauauauugggaacauuuugcaugcau KI101582.1:1448..1505:+
MLY_9158_3020 2.1 375 375 0 0 yes blast ucggauccgucugagcuugg aagcucagagggcucugauu aagcucagagggcucugauucagaaagaucaucggauccgucugagcuugg KI007489.1:8074..8125:-
MLY_61308_18654 2.0 163 163 0 0 yes blast ucaacccugucacauacaccug gggaguaugugauggggguggca ucaacccugucacauacaccugcauuuguacggggaguaugugauggggguggca KI050144.1:14663..14718:+
MLY_28670_9009 2.0 4716 4715 0 1 yes blast agaaugguuuguagccugacauuu aaguggcuauuucuacgcuc aaguggcuauuucuacgcucagugcucagaacagugagcacuaagaaugguuuguagccugacauuu KI023408.1:15808..15875:+
MLY_75426_22687 2.0 163 163 0 0 yes blast ucaacccugucacauacaccug gggaguaugugauggggguggca ucaacccugucacauacaccugcauuuguacggggaguaugugauggggguggca KI061558.1:11561..11616:-
MLY_133478_38249 2.0 34 34 0 0 yes blast uguaugugaugggguuggug augaugccaucaugcc uguaugugaugggguuggugugaugaugccaucaugcc KI105699.1:19300..19338:-
MLY_98500_28945 2.0 378 378 0 0 yes blast uggcaguguauuguuagcuggu cagcuaacaugcaacugcuguu uggcaguguauuguuagcuggucgaauauauuaauggcaucagcuaacaugcaacugcuguu KI079713.1:22412..22474:-
MLY_58581_17820 2.0 40686 40686 0 0 yes blast gggagaggaugcagucugaguggu cacugaugaucauucucuuccac cacugaugaucauucucuuccacuugggggaguaagagggagaggaugcagucugaguggu KI047896.1:1427..1488:-
MLY_87091_25862 2.0 6423 6423 0 0 yes blast cuccuggcuggcucgcca gugaguccaguaggauug gugaguccaguaggauugggauugauggauuauuuccccuaggccccuccuggcuggcucgcca AWHB01297502.1:309..373:-
MLY_123747_35656 2.0 1111 1110 1 0 yes blast ggguucgauucccggucagggaaa ucccugaugguguaguggcuuaa ucccugaugguguaguggcuuaaggcuucggugcuggcgcugacagugcugcggccuggguucgauucccggucagggaaa KI098537.1:26158..26239:-
MLY_110739_32116 2.0 17 17 0 0 yes blast auauauguauguguguaugugu auguauauacuuguuuauguguau auguauauacuuguuuauguguauguguguuuauauauguauguguguaugugu AWHB01365463.1:6430..6484:-
MLY_102101_29885 2.0 57 57 0 0 yes blast ugcuggggugccuggccag caucaggaacucagcagg ugcuggggugccuggccagguccauucccaucaggaacucagcagg KI082514.1:7958..8004:-
MLY_160286_44574 1.9 33 33 0 0 yes blast ggaggcagcugauugauguu cucaguccaaaguuggccacuaa ggaggcagcugauugauguuccaacucaguccaaaguuggccacuaa AWHB01478383.1:445..492:+
MLY_99221_29111 1.9 443 443 0 0 yes blast uucaacggguauuuauugagc ucccaauaagugucuguugaauu ucccaauaagugucuguugaauugagaugcauugaauucaacggguauuuauugagc KI080280.1:1512..1569:+
MLY_143596_40865 1.9 43 43 0 0 yes blast ucacugaccuccagggggcag gugaccaaggagcugagg gugaccaaggagcugagggaaaaugcugauuucauccguuuugcucucacugaccuccagggggcag KI112438.1:14886..14953:+
MLY_104250_30426 1.9 2307904 2307901 0 3 yes blast ugagguaguagguuguauaguu uacagccuccuagcuuuccu ugagguaguagguuguauaguuuagaaauacaucaagggagauaacuguacagccuccuagcuuuccu KI084126.1:12147..12215:+
MLY_100850_29546 1.9 162 57 0 105 yes blast uagcaccauuugaaaucaguguu cugguuucacaugguggcuuagau cugguuucacaugguggcuuagauuuuuccaucuuuguaucuagcaccauuugaaaucaguguu KI081567.1:4604..4668:-
MLY_104250_30424 1.9 23 23 0 0 yes blast aacccguagauccgaacuugug caagcuugugucuacagguaug aacccguagauccgaacuuguggucauaguccacacaagcuugugucuacagguaug KI084126.1:6509..6566:+
MLY_79748_23866 1.9 11 11 0 0 yes blast agccaggcggucaaugcgcug gugaacuggccgccugcuucu gugaacuggccgccugcuucucguucagcagagccaggcggucaaugcgcug KI065011.1:15130..15182:-
MLY_97511_28617 1.9 14 14 0 0 yes blast gagauagggcucagaagca cuuaggggagcccugaagccu cuuaggggagcccugaagccugaguacuugucucugcuggugagagccuacuuggggagauagggcucagaagca KI078972.1:1459..1534:+
MLY_35822_11100 1.9 34 34 0 0 yes blast uguaugugaugggguuggug augaucucaucacgcugggua uguaugugaugggguuggugugaugaucucaucacgcugggua KI029338.1:23516..23559:+
MLY_3645_1147 1.9 86 86 0 0 yes blast gacuuggagucagaaggc cucucugacauucucaggucag cucucugacauucucaggucagggcuagugucacaaacaggacacuucugacuuggagucagaaggc KI003033.1:57032..57099:+
MLY_48243_14626 1.9 52 52 0 0 yes blast uuggagggugggggguu ugcuuaaccuagua uuggagggugggggguucuguuauggucucuugugggcaggaaacuggguuucagcccucaagagucagggaugcuuaaccuagua KI039461.1:338..424:+
MLY_25908_8171 1.8 13208 13208 0 0 yes blast uucccuggacucugccuccc uaggcuaucagagggagga uaggcuaucagagggaggaucccgggucuucccuggacucugccuccc KI021206.1:8370..8418:+
MLY_130390_37505 1.8 14 13 0 1 yes blast cccugaccgggaaucgaaccg uuuuuuguuuuugguau uuuuuuguuuuugguaugugggcagcucccugaccgggaaucgaaccg KI103490.1:5971..6019:+
MLY_58420_17768 1.8 68 68 0 0 yes blast uuauggcccuucgguaauucacug gugaauucuaccagugccauacac uuauggcccuucgguaauucacugacugagacuguucacagugaauucuaccagugccauacac KI047756.1:334..398:+
MLY_145462_41281 1.8 30 30 0 0 yes blast aucaauauggugaccuc gguaccaccagguugc aucaauauggugaccuccugggagugggguaccaccagguugc AWHB01452063.1:1208..1251:-
MLY_85285_25372 1.8 1271287 1271259 0 28 yes blast aacauucauugcugucgguggg cucacugaucaaugaaugcaaa aacauucauugcugucgguggguuugagucugaaucaacucacugaucaaugaaugcaaa AWHB01292029.1:8539..8599:+
MLY_160016_44506 1.8 5069 5069 0 0 yes blast ggugcauucugaguggc cacaaugagaacugagcccu ggugcauucugaguggcuuacuuauugugagaccccacucgcucaaaggucacaaugagaacugagcccu KI120636.1:6955..7025:+
MLY_147696_41826 1.8 15 15 0 0 yes blast uucuggaggcucugagagaga ucucacagcucuggaagu ucucacagcucuggaagugagaagucugcaccauaagugucaucagggcuguuccuucuggaggcucugagagaga KI114608.1:11322..11398:-
MLY_6183_2025 1.8 5088 5088 0 0 yes blast ugagugugugugugugagugu acuuacacccacucaguuaua acuuacacccacucaguuauauccaauacggugugagugugugugugugagugu AWHB01022989.1:7893..7947:+
MLY_65538_19902 1.8 rRNA/tRNA 617 617 0 0 yes blast ggguucgauucccggucaggga ccuggugguggagugguuuaagg ccuggugguggagugguuuaaggcuucagcgcuguggccuggguucgauucccggucaggga KI053543.1:651..713:-
MLY_56161_17034 1.8 11 5 6 0 yes blast gccuacgaccaucggaaaacacaua gguguucaucuuuggucuauugugggucg gguguucaucuuuggucuauugugggucgugaccccuuugggggucaaacgacccuuucacaggggucgccuacgaccaucggaaaacacaua KI045912.1:6511..6604:-
MLY_111962_32450 1.8 4853 4853 0 0 yes blast ugagugugugugugugagugu augugcaugugcuuacauuggca ugagugugugugugugaguguguguguguguacacgcgcaugugcaugugcuuacauuggca KI089896.1:723..785:+
MLY_61543_18710 1.8 10246 10246 0 0 yes blast cccggguuucggcacca gagcugaaacacugggcg cccggguuucggcaccaaaauauuagcgauaugagcugaaacacugggcg AWHB01216398.1:553..603:+
MLY_27540_8637 1.8 10 10 0 0 yes blast cggggcucggggcucgc ccgcccccacuccagcc cggggcucggggcucgcugagcacgucaucagccccgcccccacuccagcc KI022521.1:216..267:-
MLY_76340_22944 1.7 63 63 0 0 yes blast uaugugacaggguuggcgcca gcgccaaacccaucacauaca gcgccaaacccaucacauacaccccauucaaauauagguauaugugacaggguuggcgcca KI062277.1:381..442:-
MLY_149092_42112 1.7 825 825 0 0 yes blast gcggcccggguucgacuccc guaguggcuuaaggcuccgg guaguggcuuaaggcuccggugcuaucagugcugcggcccggguucgacuccc KI115314.1:580..633:-
MLY_89865_26612 1.7 rRNA 1023 1023 0 0 yes blast ccugguuaguacuuggaug ucucagaagcuaagcagggu ucucagaagcuaagcaggguugggccugguuaguacuuggaug KI073064.1:2002..2045:+
MLY_52665_16001 1.7 448 448 0 0 yes blast gccgccccccccacgcccgc gaggacgcaggagggguauggaga gccgccccccccacgcccgccagucccacccccgcuccggaugagggacggaagaggacgcaggagggguauggaga KI043070.1:3292..3369:-
MLY_104284_30436 1.7 134 128 6 0 yes blast ugugugugugugugugugugu auauauauacacauauaugua auauauauacacauauauguauauauauguauauauguguguguguguaugugugugugugugugugugu AWHB01347639.1:376..446:-
MLY_63921_19434 1.7 93 93 0 0 yes blast cgccgccccccccccgcc uggggcaggaaggcaggugcu uggggcaggaaggcaggugcuguccuacuaugggcugaauuguguccccgccgccccccccccgcc KI052211.1:9576..9642:-
MLY_79731_23858 1.7 11 11 0 0 yes blast acccacaggcugagaaccgcugcu gggugguucagcugugguucu acccacaggcugagaaccgcugcuuuagaguguugguuagagggugguucagcugugguucu KI064996.1:6137..6199:+
MLY_127861_36824 1.7 12 12 0 0 yes blast uuuugcgauguguuccuaauau auugggaacauuuugcauucau uuuugcgauguguuccuaauauguaaucuaaauguauugggaacauuuugcauucau KI101582.1:1314..1371:+
MLY_47988_14574 1.7 91 91 0 0 yes blast caaggcggguagagguuggg cuccucuacccaccacuca caaggcggguagagguugggagcuggaaugucugcaucuuacugccucuccuacaauuucuaccccuccucuacccaccacuca KI039229.1:1715..1799:+
MLY_70949_21344 1.6 39 32 7 0 yes blast ggggguaccaaaaaaaa ggcguuggugcugucag ggcguuggugcugucagcgcuucagccuggguucgauucccggggggggggggggggggguaccaaaaaaaa KI057926.1:209..281:-
MLY_49099_14918 1.6 38777 38774 0 3 yes blast agcagcauuguacagggcu agcuucuuuacaguguugccuug agcuucuuuacaguguugccuuguggcauggaguucaagcagcauuguacagggcu KI040130.1:34142..34198:-
MLY_162316_45048 1.5 59 59 0 0 yes blast uguguauguguguguauaua uuugcacauacacacaca uguguauguguguguauauaucuauaggaggcuuugcacauacacacaca KI121732.1:5999..6049:+
MLY_32028_9958 1.5 rRNA 1169 1023 0 146 yes blast ccugguuaguacuuggaug ucggaagcuaagcaggguc ucggaagcuaagcagggucaggccugguuaguacuuggaug KI026147.1:15880..15921:-
MLY_49441_15028 1.5 11 11 0 0 yes blast gagagagagagagagagaugcug ucaucacucuaacucugccuccacccu ucaucacucuaacucugccuccacccugaggaagacucaggagagagagagagagagaugcug KI040448.1:92240..92303:-
MLY_65431_19864 1.5 29 28 1 0 yes blast uccggccgguaggauggc cccuccgcuuccggcuucggcug cccuccgcuuccggcuucggcuguggggagucccugcugcagugcuccguguccggccgguaggauggc KI053461.1:424..493:-
MLY_53244_16194 1.5 726 726 0 0 yes blast ccugagccuuggcuucccagu uggugaucccuuggcccagugc ccugagccuuggcuucccaguuccuugcugccccagggccuuugcauaugcuaggcccucugccuggugaucccuuggcccagugc KI043574.1:683..769:+
MLY_62216_18932 1.5 9 9 0 0 yes blast cugcucugugccaggcccuggg cagggccucacugugucaacagga cugcucugugccaggcccugggggagagggcaugaggacaguaacccucucccccagggccucacugugucaacagga AWHB01218724.1:407..485:+
MLY_56802_17244 1.5 34 34 0 0 yes blast aucuggaggcucugccu gcagcccugugccaugucu aucuggaggcucugccuucgaaagcagcccugugccaugucu KI046476.1:3009..3051:+
MLY_98686_28982 1.5 10 10 0 0 yes blast auauauguauguguguaugugu guguguguacgugcguguaugc auauauguauguguguaugugugugcauauguguguauguacauguguguguacgugcguguaugc KI079861.1:1235..1301:+
MLY_142289_40496 1.4 11 11 0 0 yes blast uaugugugugugugugugucccu uuuaucacaccauauacaaggu uaugugugugugugugugucccuguguguguguguauguauuuaaacauucacauauuuuuuuuuaucacaccauauacaaggu KI111666.1:10993..11077:+
MLY_78748_23605 1.4 336 336 0 0 yes blast caguugguuagagcguggugc aucaggcuugcccaauuggc aucaggcuugcccaauuggccaguuagcucaguugguuagagcguggugc KI064216.1:23059..23109:+
MLY_115305_33362 1.4 44 44 0 0 yes blast ugacaaugagaccuguaacauuu gagacgcagguuacgcugucauc gagacgcagguuacgcugucaucacaguaaguuuauuggaauggugacaaugagaccuguaacauuu KI092345.1:23206..23273:-
MLY_133192_38181 1.4 49371 49366 1 4 yes blast agcagcauuguacagggcu agcuucuuuacagugcugccuug agcuucuuuacagugcugccuuguagcauucaggucaagcagcauuguacagggcu KI105495.1:13213..13269:+
MLY_98686_28981 1.4 10 10 0 0 yes blast auauauguauguguguaugugu auguguguguacauguguau auguguguguacauguguauacgugugugugcauguacguguguguacguacgugugugcauguguauauauguauguguguaugugu KI079861.1:1169..1257:+
MLY_17012_5654 1.4 10 10 0 0 yes blast guucgauuccccgccgggga ccugguggagcaguggcuagg ccugguggagcaguggcuaggcuuuggcucucucaacgcuguggccuggguucgauuccccgccgggga KI013963.1:13435..13504:-
MLY_3346_1034 1.4 16 16 0 0 yes blast guaguggcuaggcuucggcgcua augcugcggccuggguuugauuc guaguggcuaggcuucggcgcuaucaaugcugcggccuggguuugauuc KI002839.1:1669..1718:+
MLY_141994_40423 1.4 10 10 0 0 yes blast cagguguaugugacaggguuggc caaccccaucacauacaccccgua caaccccaucacauacaccccguacaaauacagguguaugugacaggguuggc KI111480.1:12274..12327:+
MLY_106324_31004 1.3 3980 3977 0 3 yes blast uguguauguguguguauauaug ugugugugggggggggg uguguguggggggggggggggggggguguguguguguacgugugcaugcacccaugcaugcaccuguguguauguguguguauauaug AWHB01353202.1:4820..4908:-
MLY_126290_36386 1.3 30 30 0 0 yes blast gucaucguugucaucauca augaugauaacccu augaugauaacccucauggucaucguugucaucauca KI100412.1:7691..7728:-
MLY_157271_43884 1.3 3958 3958 0 0 yes blast uguguauguguguguauauaug uguacucauauauauauauauauu uguguauguguguguauauauguguguaugcagauguacucauauauauauauauauu KI119323.1:9851..9909:+
MLY_44_43 1.3 333 333 0 0 yes blast aaaagugcuuacagugcagguag acugcaacgcaagcacuucuuac aaaagugcuuacagugcagguagcuuuugagaucuacugcaacgcaagcacuucuuac KI000043.1:4809..4867:-
MLY_78638_23596 1.3 16 16 0 0 yes blast uagaucugggguggggccu accccacucccagaauuucuaau accccacucccagaauuucuaauucaguagaucugggguggggccu KI064134.1:17757..17803:-
MLY_143078_40724 1.3 20 20 0 0 yes blast uuaugcuguccugggcuucu uagucagcaggacaacauagac uagucagcaggacaacauagaccuccauggauugauuaugcuguccugggcuucu KI112144.1:4531..4586:-
MLY_178585_47823 1.2 200 200 0 0 yes blast uagaucugggguagggccu gcccaccuccagaauuugau gcccaccuccagaauuugauucaguagaucugggguagggccu AWHB01504040.1:860..903:+
MLY_171962_47161 1.2 4452 4443 1 8 yes blast uagcagcacauaaugguuug caggccauauugugcugcc uagcagcacauaaugguuuguggguuuugaaaagaugcaggccauauugugcugcc AWHB01496937.1:12356..12412:-
MLY_92146_27232 1.2 376 376 0 0 yes blast ggagcucacagucuagu caggcuguguccuu caggcuguguccuuggcacugagaauggagauaacccuggcccucaaggagcucacagucuagu KI074832.1:6417..6481:-
MLY_163444_45325 1.2 rRNA 1025 1023 2 0 yes blast ccugguuaguacuuggaug uaccacccugaacaugcc uaccacccugaacaugccugaucuccucugcucuuggaagcuaggcagaguugggccugguuaguacuuggaug KI122300.1:3107..3181:+
MLY_39691_12226 1.2 9 9 0 0 yes blast cccuccccucgccuucccca gggaaggccccugagaaggcggc gggaaggccccugagaaggcggcccgugagcucagugacaaggcacucagccagggccccuccccucgccuucccca KI032498.1:4383..4460:-
MLY_15593_5154 1.2 10 9 0 1 yes blast agcucugccccgucggc ggagauggcgggcuuggu agcucugccccgucggccgcuuuuccccaggaggaggggagauggcgggcuuggu KI012840.1:428..483:+
MLY_42486_13098 1.2 48 48 0 0 yes blast aucaguggggcuguggggg cauauagcccccucucuu aucaguggggcugugggggugaggcagaggaguagauuuccuguacuguuuucaaaguacauauagcccccucucuu KI034766.1:40125..40202:+
MLY_73997_22239 1.1 9 9 0 0 yes blast cgggggagggggcgggggg ccgaaggccuccuggaccggu ccgaaggccuccuggaccgguggccucaguagugaaacgguggucgcggucacugucuguguuugcggccgggggagggggcgggggg KI060421.1:1556..1644:+
MLY_67460_20431 1.0 40 40 0 0 yes blast acacacacacacacacacaug uuugugugugugugugagcac uuugugugugugugugagcacacacacacacacacacacacacaug AWHB01235524.1:3935..3981:+
MLY_94741_27944 1.0 9 9 0 0 yes blast uggggcuggguguggcuggg gagagcacccagcccugcu uggggcuggguguggcugggagaggagugagagcacccagcccugcu KI076865.1:397..444:+
MLY_24566_7778 1.0 26 26 0 0 yes blast ucucccucucccuuccucu gggacgggcaggaccca ucucccucucccuuccucucagucccugucacucugugcuggcccagacccugugcacaugguacuaggggacgggcaggaccca KI020128.1:12126..12211:+
MLY_84376_25145 1.0 62 62 0 0 yes blast guauguguguguauauaug uguauauauggauauauau uguauauauggauauauauguguguggauauauagguauauauauauauauauagguguauguguguguauauaug KI068704.1:3444..3520:+
MLY_176636_47701 1.0 34 34 0 0 yes blast uguguguguguacguguguau acauauauuauauauacauaua uguguguguguacguguguauauauauacauauauuauauauacauaua AWHB01502091.1:56..105:-
MLY_4849_1522 1.0 34 33 1 0 yes blast acgaggacgaggacgagga cucgccccgugcugacc acgaggacgaggacgaggacgagggagaggagcccuugcucgccccgugcugacc KI003982.1:1321..1376:+
MLY_4693_1459 0.9 28 28 0 0 yes blast guuuccucgcagggcccg gugucccugaugaagacaacuc guuuccucgcagggcccgugucuaggagccaucuucucccagcacugugucccugaugaagacaacuc AWHB01017534.1:20396..20464:-
MLY_87113_25865 0.9 13 13 0 0 yes blast uagaucugggguggggccu gccucaacccaagauucuga gccucaacccaagauucugauucaguagaucugggguggggccu KI070894.1:13916..13960:+
MLY_12674_4189 0.9 31 31 0 0 yes blast auuuauggaggcucuucag gguauguuggcuuuuauuuugc auuuauggaggcucuucaggcuggugcagauaucuucauaauuggacaguuugguauguuggcuuuuauuuugc KI010332.1:3107..3181:-
MLY_148018_41881 0.9 13 13 0 0 yes blast uagaucugggguggggccu guuccacacagaguuucu guuccacacagaguuucugauucaguagaucugggguggggccu AWHB01456890.1:2946..2990:+
MLY_155304_43472 0.9 14 14 0 0 yes blast agggcaaggagcuggaguuc aaaucgagcccaggcaaucu agggcaaggagcuggaguuccagcugaggaaaaucgagcccaggcaaucu KI118370.1:8760..8810:+
MLY_102587_29997 0.9 6542 6507 0 35 yes blast ucagugcaucacagaacuuugucu gaaguucuguuauacacucaggcu gaaguucuguuauacacucaggcuguggcucucugaaagucagugcaucacagaacuuugucu KI082894.1:42369..42432:+
MLY_114487_33188 0.8 10 10 0 0 yes blast uggcacuggaacucugggc cacaaucuccgcuggu cacaaucuccgcugguuuucacaacuagaaguuguaggaacuucucuuacuggcacuggaacucugggc KI091735.1:10328..10397:-
MLY_38970_12021 0.8 11 11 0 0 yes blast ucaaaguggcugcaccauuu uauguguaaccuuuugagg uauguguaaccuuuugaggaacugucaaacuguuuuucaaaguggcugcaccauuu KI031930.1:173..229:+
MLY_94398_27821 0.8 rRNA/tRNA 1778 1777 0 1 yes blast ucgauuccggcucgaagga uccuuaggucgcugggucgauuccgg uccuuaggucgcugggucgauuccggnnnnnnnnngguucgauuccggcucgaagga KI076573.1:314..371:+
MLY_118082_34071 0.8 226 211 0 15 yes blast cagugcaauaguauugucaaagc gcucugacuuuauugcacuacu gcucugacuuuauugcacuacuguacuuuacagcuagcagugcaauaguauugucaaagc KI094386.1:2291..2351:+
MLY_191203_48886 0.8 11 11 0 0 yes blast agccaccaggagcccuucuu gaggccccuguuuagcaauggcugc gaggccccuguuuagcaauggcugcugggcucuguuuuuuauuuugaaccuaaucagccaccaggagcccuucuu AWHB01516658.1:4645..4720:-
MLY_20548_6688 0.8 10 10 0 0 yes blast gugugcgugcgugugugagug uguacaugugugagugcaugu gugugcgugcgugugugagugcaugggugcaugugugcgugugugcaugugugaguguguguguacaugugugagugcaugu KI016806.1:669..751:+
MLY_23603_7483 0.8 10 10 0 0 yes blast uggcacuggaacucugggcug gaguagacuuccacagcugag uggcacuggaacucugggcuggggagcauggcauaggacaccucacuccuucagaguagacuuccacagcugag KI019287.1:8776..8850:-
MLY_38783_11965 0.8 24 24 0 0 yes blast cuuggccccacccucagc cgagggagcaagaa cgagggagcaagaaaaaaauguccacgguugcugccccuauaugacauuuuaaccuuggccccacccucagc KI031790.1:1889..1961:+
MLY_98470_28935 0.8 10 10 0 0 yes blast agguugagaacugcugcuuuagg uaaaccagcaguuucaggugca agguugagaacugcugcuuuagggggugugcaaagagaugccucacacacucauaaaccagcaguuucaggugca KI079689.1:12652..12727:-
MLY_15975_5300 0.7 10 10 0 0 yes blast uauauauauauauguacguaua uauguauuguauauguauaua uauauauauauauguacguauauguguauguauauguauauguauauguguauguauuguauauguauaua KI013103.1:40047..40118:+
MLY_107903_31395 0.7 317 317 0 0 yes blast uguguauguguguguguauaug uauauauucauauauguauaug uauauauucauauauguauauguaugcauguguauguguauaugugucccccccuguguauguguguguguauaug KI086863.1:24695..24771:+
MLY_140814_40114 0.7 46 46 0 0 yes blast aucugggguagggccuggguau gcuugggcccuguacccgguuau gcuugggcccuguacccgguuauuuaaauuuaguucaucugggguagggccuggguau KI110772.1:2487..2545:-
MLY_136436_39037 0.7 261 261 0 0 yes blast gugccugggucucccucu aggauucuaggcaacaccgu gugccugggucucccucuccugaggauucuaggcaacaccgu KI107865.1:2689..2731:+
MLY_52698_16013 0.7 10 10 0 0 yes blast uuucugggguuuuuuguuuguu caagucaaucucacuccaggguuc caagucaaucucacuccaggguucacauuucugggguuuuuuguuuguu KI043095.1:7654..7703:+
MLY_8824_2908 0.7 3977 3977 0 0 yes blast uguguauguguguguauauaug uguguauauuuggugcauaua uguguauguguguguauauauguguauguauguguguaauauguguguauguguguauauuuggugcauaua KI007178.1:112..184:+
MLY_98275_28873 0.7 66 63 3 0 yes blast guauguguguguauauaug uauguacguauauguguguauau guauguguguguauauauguacucuguauauguguguguguauauauacguauuguguguauauauguacguauauguguguauau KI079563.1:2056..2142:-
MLY_83740_24998 0.7 3957 3957 0 0 yes blast uguguauguguguguauauaug uguguauacauuguuuuggcacc uguguauacauuguuuuggcacccucuguauuuguggguguguauguguguguauauaug KI068199.1:330..390:-
MLY_71565_21528 0.7 15 15 0 0 yes blast ugagugugugugugaguguguga gcacauuaauaccucucucaca gcacauuaauaccucucucacagucgugagugugugugugaguguguga KI058412.1:15540..15589:-
MLY_60192_18324 0.7 10 10 0 0 yes blast gaguggagacugguguucuca ggucaccuuugcuccacucaa gaguggagacugguguucucagacccggcaugguggucaccuuugcuccacucaa KI049239.1:3819..3874:+
MLY_121351_34947 0.7 20 20 0 0 yes blast aacuguuugcagaggaaacugaga acuguauuucucuucagcaaagaaguaa aacuguuugcagaggaaacugagacuuuguaacuguauuucucuucagcaaagaaguaa KI096791.1:7260..7319:-
MLY_67007_20322 0.6 12 10 0 2 yes blast uguguauguauguguauauaug auguguguguguaugugugu auguguguguguauguguguuuauagguguguaugcauguguauguauguguauauaug KI054724.1:21504..21563:-
MLY_73081_21932 0.6 20 20 0 0 yes blast uucaaacccaugcuguucaagg uugaacaacaugggucccugugca uugaacaacaugggucccugugcaguucaaacccaugcuguucaagg KI059681.1:1055..1102:-
MLY_67519_20452 0.6 16 16 0 0 yes blast ucucucucucucucucuuuaaaa gccuagagcagagacuugggagagc gccuagagcagagacuugggagagcuugcucucucucucucucucuuuaaaa KI055174.1:17943..17995:-
MLY_81923_24459 0.6 10 10 0 0 yes blast ugggcuggggcuggggcu ucccugucccguuccuuc ucccugucccguuccuucccucauucugucccuagggccugggcuggggcuggggcu KI066771.1:7534..7591:+
MLY_101969_29845 0.6 8 8 0 0 yes blast gggucggggucgggguc ccccgcccccgacaccac gggucggggucggggucgggguucuucucuccccgccccgcccccgacaccac KI082405.1:3218..3271:-
MLY_59528_18137 0.6 5089 5089 0 0 yes blast ugagugugugugugugagugu auaacaugcauauggaaccaua ugagugugugugugugagugugagugugagugagugugugauacacacauaacaugcauauggaaccaua KI048660.1:5446..5516:-
MLY_69313_20918 0.6 40 40 0 0 yes blast ucuggcuguuguggugugcaa gccacacugcaacaccuuaca ucuggcuguuguggugugcaaaacuccguacauugcuauuuugccacacugcaacaccuuaca KI056620.1:5051..5114:+
MLY_79764_23877 0.5 150 150 0 0 yes blast gaguaggcauuagacugua aggucuaguucucuuuu gaguaggcauuagacuguaaaacuaagcacagaggucuaguucucuuuu KI065026.1:530..579:-
MLY_151603_42657 0.5 153 153 0 0 yes blast gcauaauuuguggucgugggagac cuccccugaaaaauacaaaauuaugcgu gcauaauuuguggucgugggagacugugugugcgcucuccccugaaaaauacaaaauuaugcgu KI116591.1:142..206:-
MLY_33252_10386 0.5 3977 3977 0 0 yes blast uguguauguguguguauauaug uauauacaggaucagacaauaucauc uguguauguguguguauauauguguuuauauauacaggaucagacaauaucauc KI027191.1:6485..6539:+
MLY_69965_21101 0.5 317 317 0 0 yes blast uguguauguguguguguauaug uauauauauaucuuuuacuuc uguguauguguguguguauauguauauguauguguauguauauauauaucuuuuacuuc KI057133.1:36189..36248:-
MLY_126716_36514 0.5 323 323 0 0 yes blast gacagcaggaagguggcca cccaccccuccccaccugnnnn gacagcaggaagguggccagucuccgggaccagaggaggugcccugagucccucgucaugcccaccccuccccaccugnnnn KI100747.1:2727..2809:+
MLY_142839_40668 0.5 8 8 0 0 yes blast gggggcggcugcgggcggagg gacccugcagccguggugccu gggggcggcugcgggcggaggcagaaaugacccugcagccguggugccu AWHB01446925.1:642..691:+
MLY_12573_4153 0.4 173 172 1 0 yes blast agggcugacuguaugcauuguu aaauguguacacauuuuaacccccc agggcugacuguaugcauuguuauacacuauuuuauacagagggugugaaaaaaaauguguacacauuuuaacccccc KI010240.1:14638..14716:-
MLY_127677_36777 0.3 rRNA/tRNA 7012 7011 0 1 yes blast aggauucggcgcucucacc gcucgauucccagucag aggauucggcgcucucaccgccacggcuccaagcucgauucccagucag KI101453.1:7710..7759:-
MLY_157447_43918 0.3 8 8 0 0 yes blast uguaugugaugggguugg aaaccugucacauacacc aaaccugucacauacaccuguauuuguaugggguguaugugaugggguugg AWHB01473521.1:2718..2769:-
MLY_78486_23532 0.3 164 164 0 0 yes blast acuggacuuggagucag gaccuagguuuugc acuggacuuggagucaggagaccuagguuuugc KI064023.1:1532..1565:-
MLY_22466_7188 0.2 13 13 0 0 yes blast cccccuaucccccaccccc caauaggggaggggggca cccccuaucccccacccccugccauuuugauaguauaaucuauuuuuaaacaggacuuuucaauaggggaggggggca KI018407.1:11..89:+
MLY_24150_7664 0.2 8 8 0 0 yes blast ucuacgagggcaucaagguggu uaucuuggaugccaacauggagc ucuacgagggcaucaaggugguccugcaaguggccuuggcuaucuuggaugccaacauggagc KI019752.1:1846..1909:+
MLY_76371_22962 0.2 8 8 0 0 yes blast ucgaggggcucacagucuagca cuggacauaggagcccagagg cuggacauaggagcccagagguacuucagaccuggauccugcccucgaggggcucacagucuagca KI062304.1:798..864:-
MLY_7330_2430 0.2 10 10 0 0 yes blast ggggguuggggggggggc ugaauccuuaaccuucaa ggggguuggggggggggccggaaggcugaggugguuguuggggugguuggggggugggcuggaaggcugaauccuuaaccuucaa KI006027.1:880..965:+
MLY_120243_34690 0.2 8 8 0 0 yes blast auggggcccaggaaucugcauu uguagauucccaaaucuaucu uguagauucccaaaucuaucuccagagauuuuagcaugugagcucugggauggggcccaggaaucugcauu KI095989.1:4922..4993:-
MLY_23375_7432 0.2 7 7 0 0 yes blast gggagggagggagggagguc cugugagcccucuucccuuguccaa gggagggagggagggaggucggggcccccagcacacgguggggcucacugacugugagcccucuucccuuguccaa KI019129.1:109..185:+
MLY_92056_27197 0.1 45159 45159 0 0 yes blast uaccugguugauccugcc uaggaaaaguaggugau uaggaaaaguaggugaugauuuacuuuuaaaaaaagaaaacucuguaccugguugauccugcc KI074750.1:14435..14498:+
MLY_158615_44179 0.1 341002 340987 15 0 yes blast ccucaacacaaggguuugu aaacuuuuggguugagguu aaacuuuuggguugagguuuuguagguagcagagcagcucccuugaugaaaucuauugaaaauuaccccucaacacaaggguuugu KI119974.1:3094..3180:+
MLY_9158_3017 0.1 7 7 0 0 yes blast ucuuggaguaggucauugggu uggauggcuccuccaugucu ucuuggaguaggucauuggguggauccuuaauuucccuaugugggccacuggauggcuccuccaugucu KI007489.1:6561..6630:-
MLY_41998_12923 0.1 41 41 0 0 yes blast uaguacuuggaugggaga ucauauucauauagaacu uaguacuuggaugggagauaaaauaaucaucauauucauauagaacu AWHB01150673.1:79..126:-
MLY_161960_44968 0 189 184 5 0 yes blast ugugugugugugugugugugu acacauacaugcacccacgua acacauacaugcacccacguaccuauaugugugugugugugunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnugugugugugugugugugugugugugugu KI121556.1:6395..6496:+
MLY_18337_6021 0 114 114 0 0 yes blast ugaguguguguguguguguaa ucauauacauauuucuucucgca ucauauacauauuucuucucgcagaugugugugaguguguguguguguguaa KI014991.1:24498..24550:+
MLY_113901_33021 0 14 12 2 0 yes blast gaagaugaagaagaagaugaug caguuuuuuucuugucuauaa gaagaugaagaagaagaugaugaugaaugaguuggcucuaucacaguuuuuuucuugucuauaa KI091315.1:7681..7745:-