miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/ppa/ppa_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/ppa.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/ppa/ppa_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/ppa/ppa_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/ppa.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/ppa/ppa_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
1011.13
910.93
810.53
7103
69.53
59.23
48.73
38.23
29.73
15.63
01.23
-10.93
-213
-313
-40.93
-50.93
-60.93
-70.93
-80.93
-913
-1013





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
PPA_136090_44247 7.5e+6 14803634 14797327 0 6307 yes blast uauugcacuugucccggccugu agguugggaucgguugcaaugcu agguugggaucgguugcaaugcuguguuucuguaugguauugcacuugucccggccugu KE916595.1:2104..2163:+
PPA_89080_30297 6.8e+6 13372797 13372716 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguguuauauauaaaguauugcacuugucccggccugu KE888679.1:1991..2052:+
PPA_140287_45516 5.6e+6 11015945 10701737 0 314208 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaaaaaaaaaccaccgaccguugacuguacc AWGZ01402280.1:9878..9941:+
PPA_41990_14810 5.4e+6 10702511 10702399 0 112 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaauuaaagucaaaaccaucgaccguugauuguacc KE853214.1:2699..2761:+
PPA_41423_14583 1.1e+6 2349252 2349150 1 101 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc KE852751.1:11838..11911:-
PPA_93944_31889 8.0e+5 1571372 1550139 26 21207 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuucccacuagauugugagcuccugga KE892058.1:69406..69468:+
PPA_76063_25976 6.2e+5 1231468 1205281 0 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaagccacagaugggcuuucagucggauguuugcagc KE879330.1:9478..9541:+
PPA_112038_37434 6.1e+5 1206522 769718 0 436804 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu KE903314.1:22379..22438:-
PPA_5786_2191 5.6e+5 1113234 1106994 0 6240 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugaggauguccaggaucacaggugagguucuugggagc KE824563.1:13286..13345:-
PPA_39732_13988 5.6e+5 1105505 1104264 0 1241 no blast aucccggacgagcccccc ggugcgagaggucccgggu ggugcgagaggucccggguucaaaucccggacgagcccccc KE851427.1:6607..6648:-
PPA_107942_36250 4.6e+5 915461 915363 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuauacccugggaguuaacuguacaaccuucuagcuuucc KE901072.1:31927..31994:+
PPA_69041_23756 4.4e+5 871970 862486 95 9389 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgccuuguucacaguggcuaaguucug KE874094.1:32833..32895:-
PPA_86625_29450 4.4e+5 864550 862837 18 1695 yes blast ugagguaguaguuugugcuguu cugcgcaagcuacugccuug ugagguaguaguuugugcuguuggucggguugugacauugcccgcuguggagauaacugcgcaagcuacugccuug AWGZ01285185.1:143..219:+
PPA_17625_6442 3.9e+5 774940 774149 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu KE833889.1:10443..10503:-
PPA_20231_7331 3.2e+5 631616 629429 0 2187 yes blast caacggaaucccaaaagcagcug cugcgcuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc KE835984.1:5431..5495:-
PPA_87821_29815 3.0e+5 601971 600186 138 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaagaaauuuuguggucacaaauucguaucuaggggaau KE887787.1:1296..1358:-
PPA_77402_26365 2.6e+5 528881 528765 0 116 yes blast uucaaguaauccaggauaggcu ccuauucuugguuacuugcacg uucaaguaauccaggauaggcugugcaggucccaagggccuauucuugguuacuugcacg KE880298.1:15682..15742:-
PPA_92574_31449 2.1e+5 413793 413593 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacauagucacagauucgauucuaggggaaua KE891110.1:1412..1474:-
PPA_41649_14685 2.0e+5 410741 410477 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagcugggcacagugaagagccucggggcagcucaguacaggau KE852910.1:6089..6152:-
PPA_41649_14684 2.0e+5 403222 402724 1 497 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgaggcucuucacugugcccagcucggggcagcucaguacaggau KE852910.1:6090..6153:+
PPA_32681_11558 1.6e+5 330069 328538 0 1531 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcugc uguaaacauccccgacuggaagcuguaaggcauaacuaagcuuucagucagauguuugcugc KE845882.1:17209..17271:+
PPA_54224_18895 1.5e+5 306445 286172 0 20273 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaugucauggcaacagcagucgaugggcugu KE862773.1:7715..7774:-
PPA_139626_45311 1.5e+5 303580 281202 0 22378 yes blast uguaaacauccuacacucucagcu cugggagaaggcuguuuacucu uguaaacauccuacacucucagcuguggaaaguaagaaagcugggagaaggcuguuuacucu KE918548.1:16663..16725:-
PPA_1887_690 1.0e+5 205280 205261 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc KE821520.1:15233..15305:+
PPA_41423_14581 1.0e+5 204259 204202 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguuguaggguaguuauuuuacccuguucaggagauaacuauacaaucuauugccuuccc KE852751.1:11447..11525:-
PPA_84404_28678 8.6e+4 169400 169306 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaauauuaaacaccaauauuauugugcugcuuu KE885339.1:14655..14719:+
PPA_177141_49605 8.6e+4 169224 169216 0 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaacugugcugcugaa AWGZ01442861.1:8027..8092:-
PPA_100423_34038 6.7e+4 132298 69186 0 63112 yes blast ucgaggagcucacagucuagu cuagacugaagcuccuugagga ucgaggagcucacagucuaguaugucucagccccuacuagacugaagcuccuugagga KE896517.1:190..248:+
PPA_90397_30690 6.3e+4 124147 124098 0 49 no blast ugcggggcuagggcuaacagca cuguugccacuaaccucaaccu ugcggggcuagggcuaacagcagucucacugaagguuucccggaaaccacgcacaugcuguugccacuaaccucaaccu KE889615.1:6226..6305:+
PPA_25646_9261 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga KE840265.1:24498..24558:+
PPA_17100_6243 5.0e+4 99767 99682 0 85 yes blast uagguaguuuccuguuguuggg ucgacagcacgauacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgauacugccuuc KE833547.1:4937..4994:-
PPA_73723_25220 4.3e+4 84583 45301 0 39282 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuuuaguaacaucacaagucaggcucuugggaccu KE877601.1:6252..6313:+
PPA_131250_42836 4.3e+4 84473 78787 87 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaggagcuuucagucggauguuuacagc KE913884.1:5142..5206:+
PPA_31985_11365 4.0e+4 78975 78904 0 71 yes blast uagguaguuucauguuguuggg ucggcaacaagaaacugccuga uagguaguuucauguuguugggauugaguuuugaacucggcaacaagaaacugccuga KE845328.1:2901..2959:-
PPA_59235_20666 3.1e+4 61054 60960 0 94 yes blast uagguaguuucauguuguuggg caacgacauuaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacauuaaaccacccga KE866636.1:898..957:+
PPA_45691_16064 2.9e+4 58310 58294 0 16 yes blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugagaacagaggccagacccaccgagggaugaaugucac KE856141.1:1712..1776:+
PPA_1650_611 2.7e+4 53784 53073 0 711 yes blast uucaaguaauucaggauagguu ccuguucuccauuacuuggcuc uucaaguaauucaggauagguugugugccauccagccuguucuccauuacuuggcuc KE821297.1:1392..1449:-
PPA_84404_28676 2.7e+4 53186 52224 0 962 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacauacuacagugacgaugcgaaucauuauuugcugcucu KE885339.1:14514..14573:+
PPA_53909_18765 2.5e+4 50689 45511 0 5178 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggag KE862550.1:52376..52436:-
PPA_144690_46859 2.5e+4 49217 49164 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc KE921194.1:10799..10878:-
PPA_25646_9260 2.4e+4 48780 48224 0 556 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuuccaga caaagugcuguucgugcagguagugugauuaucugaccuacugcugagcuagcacuuccaga KE840265.1:24291..24353:+
PPA_41423_14580 2.4e+4 48748 31435 14 17299 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuuagggcagggauuuugcccaaaaggagguaacuauacgaccugcugccuuucu KE852751.1:9146..9223:-
PPA_120533_39813 2.4e+4 47148 45502 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguugagcaacagcuacauugucugcuggguuu KE907881.1:4112..4174:+
PPA_74186_25342 2.1e+4 42290 42128 0 162 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc KE877958.1:27280..27340:-
PPA_27729_10027 2.0e+4 39427 39044 0 383 yes blast uucacaguggcuaaguuccg agggcuuagcugcuugugagca agggcuuagcugcuugugagcagggucggcaccaagucguguucacaguggcuaaguuccg KE841910.1:1824..1885:+
PPA_71921_24697 1.8e+4 36653 36647 1 5 yes blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaaugggauccggugguucuagacuugccaacu KE876280.1:210..274:-
PPA_69041_23758 1.8e+4 36248 36122 0 126 no blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauuaaaaucacauugccagggauuaccacg KE874094.1:33064..33125:-
PPA_37232_13143 1.7e+4 35140 33709 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa KE849490.1:52951..53008:+
PPA_25474_9210 1.4e+4 29375 29020 0 355 yes blast gagagaucagaggcgcagagu ccugugccuuuuaccucuuuaa gagagaucagaggcgcagagugcgucgugucaaugaagccugugccuuuuaccucuuuaa KE840126.1:10946..11006:+
PPA_13099_4907 1.4e+4 29088 28951 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac KE830357.1:29548..29610:+
PPA_96454_32713 1.2e+4 24402 24332 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca KE893778.1:1714..1775:+
PPA_25646_9257 1.0e+4 21033 19047 0 1986 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccuguccaugcuaccgcacuguggguacuugcu KE840265.1:24070..24130:+
PPA_45691_16062 1.0e+4 20989 18901 0 2088 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc KE856141.1:1539..1600:+
PPA_4073_1518 9.7e+3 19076 19072 0 4 yes blast uuagggcccuggcuccaucuccu aguggggcuucgacccuaacc uuagggcccuggcuccaucuccuuuaggaaaaccuucuguggggaguggggcuucgacccuaacc KE823230.1:4115..4180:+
PPA_45293_15904 9.6e+3 18829 12036 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu KE855804.1:94696..94752:-
PPA_143076_46355 9.0e+3 17701 17700 0 1 yes blast uguguauguguguguauauaug uauauacacacacauacaua uguguauguguguguauauauguguguauauauauaauguguguaucuauauauacacacacauacaua KE920385.1:20064..20133:-
PPA_96742_32814 8.9e+3 17560 16950 0 610 yes blast augcaccugggcaaggauucuga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcugucagaaugcaaugcaccugggcaaggauucuga KE893982.1:8608..8670:-
PPA_54302_18928 7.4e+3 14597 14596 0 1 yes blast acgcccuucccccccuucuuca aggagggaggagaugggc aggagggaggagaugggccaaguucccucugccuggaacgcccuucccccccuucuuca KE862842.1:976..1035:-
PPA_17880_6520 6.2e+3 12351 12255 0 96 yes blast agcugguguugugaaucaggccg gcuacuucacaacaccagggu agcugguguugugaaucaggccguugccaaccagagaacggcuacuucacaacaccagggu KE834085.1:39101..39162:+
PPA_84500_28724 6.2e+3 12211 12202 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagcgcauccucuugcccggcuauuucacgacaccaggguu KE885415.1:3279..3348:+
PPA_143614_46543 6.0e+3 11778 11460 0 318 yes blast uagcaccauuugaaaucgguua accgauuucuccugguguucaga accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua KE920645.1:6076..6134:-
PPA_17210_6278 4.9e+3 9678 9659 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucuuaaacaucuagcaaaucauuuuuuacucucca KE833638.1:233..294:+
PPA_19134_6967 4.8e+3 9571 7342 0 2229 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggccaauagaacugucucacacagaaaucgcacccguc KE835113.1:9461..9526:+
PPA_27729_10025 4.8e+3 9489 9232 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccugucacaaaucacauugccagggauuucca KE841910.1:1644..1702:+
PPA_136090_44238 4.7e+3 9384 8152 0 1232 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua KE916595.1:1407..1465:+
PPA_118173_39184 3.8e+3 7571 6733 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau KE906615.1:5283..5343:+
PPA_1887_692 3.7e+3 7390 7380 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugggguagggauuuuaggccccaauuagaagauaacuauacaacuuacuacuuuccc KE821520.1:16097..16177:+
PPA_88221_29985 3.5e+3 6878 6876 0 2 no blast auggauuuuuggagcugggaga ccucuuuccgaggacauu ccucuuuccgaggacauucuauuaaauggauuuuuggagcugggaga KE888079.1:32706..32753:+
PPA_14192_5311 3.4e+3 6829 6405 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaccacauggauuggcugggagguggauguuuacuuc KE831201.1:34243..34303:-
PPA_55476_19336 3.3e+3 6629 6051 1 577 yes blast ggggguguagcucagugguagagc ucaaucccuggcaccuccac ggggguguagcucagugguagagcacgugcuucgcauguacgaggucccugguucaaucccuggcaccuccac KE863765.1:10965..11038:+
PPA_53491_18623 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucugaguaugauagaagucagugcacuacagaacuuugu KE862187.1:837..897:+
PPA_127194_41687 3.1e+3 6198 6195 0 3 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu AWGZ01377617.1:16174..16234:+
PPA_107942_36248 2.9e+3 5874 5061 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu KE901072.1:31163..31223:+
PPA_17989_6540 2.8e+3 5627 5523 0 104 yes blast ugagaacugaauuccauaggcugu ugcccuagggacucaguucug ugagaacugaauuccauaggcugugagcucuagcaaaugcccuagggacucaguucug KE834184.1:11329..11387:+
PPA_13936_5213 2.8e+3 5534 5339 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa KE830982.1:538..600:-
PPA_61420_21324 2.7e+3 rRNA 5367 5148 4 215 no blast gucuacggccauaccacccugaac guuaguacuuggaugggag gucuacggccauaccacccugaacgcacccaaucuugucugaucuuagaaguuaagcagggucgggucugguuaguacuuggaugggag KE868303.1:13929..14018:-
PPA_68658_23655 2.6e+3 5170 5010 0 160 yes blast gucaacacuugcugguuuccucu gggagccaggaaguauugauguu gggagccaggaaguauugauguuucugcuaguuuagcgucaacacuugcugguuuccucu KE873798.1:6558..6618:+
PPA_96742_32820 2.5e+3 5038 4100 0 938 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguuggcaucuuaauuacccucccacacccaaggcuugca KE893982.1:13981..14040:-
PPA_136090_44239 2.3e+3 4711 4488 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug KE916595.1:1544..1607:+
PPA_104982_35444 2.2e+3 4374 4373 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc KE899358.1:2111..2170:+
PPA_135764_44144 2.1e+3 4211 4209 1 1 no blast gucuacggccauaccacccugaac uucagcccuggccagug gucuacggccauaccacccugaacgugcccgaucucaucugaucucggaaaaaauuaauagccuucagcccuggccagug KE916423.1:7931..8011:+
PPA_153070_47605 1.9e+3 3865 2799 0 1066 yes blast uaaugccccuaaaaauccuuau aaggacuuucaggggcagcugug aaggacuuucaggggcagcuguguauucuaucuccagucauaaugccccuaaaaauccuuau AWGZ01418790.1:953..1015:+
PPA_12506_4671 1.9e+3 3856 3570 0 286 yes blast cuccuggggcccgcacucuugc uggggagcggcccccgggcggg uggggagcggcccccgggcgggccucugcucuggccccuccuggggcccgcacucuugc KE829874.1:7445..7504:+
PPA_71396_24492 1.6e+3 3271 2938 26 307 yes blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauugguguaaagcuggagacccacugccccaggugcugcug KE875882.1:3154..3210:-
PPA_89080_30299 1.6e+3 3242 3211 0 31 yes blast aauugcacgguauccaucugu cggguggaucacgaugcaauuuu cggguggaucacgaugcaauuuugauuaguauaauaggagaaaaauugcacgguauccaucugu KE888679.1:2145..2209:+
PPA_136090_44244 1.1e+3 2155 2146 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu KE916595.1:1852..1911:+
PPA_66463_23000 7.4e+2 1464 1382 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu KE872159.1:6554..6613:-
PPA_32645_11539 6.2e+2 rRNA 1230 1015 0 215 no blast ccugguuaguacuuggaug ucucgucugaucucgga ucucgucugaucucggaggcuaagcagagucaggccugguuaguacuuggaug KE845853.1:23841..23894:-
PPA_6067_2297 5.5e+2 1085 921 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugauggucccuuccccaggggcuggcuuuccucuggu KE824784.1:8681..8737:+
PPA_135198_43964 5.5e+2 1080 1078 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucugaaagguacaguacugugauaacugaa KE916117.1:1739..1796:-
PPA_136090_44245 5.4e+2 1057 1048 0 9 yes blast ugugcaaauccaugcaaaacuga aguuuugcagguuugcauccagc aguuuugcagguuugcauccagcugugugauguucugcugugcaaauccaugcaaaacuga KE916595.1:1987..2048:+
PPA_30744_10956 4.9e+2 973 727 0 246 yes blast aaggagcuuacaaucuagcuggg caacuagacugugagcuucuaga aaggagcuuacaaucuagcuggggguaaacgacuugcacaugaacgcaacuagacugugagcuucuaga KE844318.1:33123..33192:+
PPA_44820_15742 4.1e+2 802 472 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg KE855453.1:310..374:+
PPA_6627_2500 3.6e+2 709 708 0 1 yes blast uguaacagcaacuccaugugga ccaguggagaugcuguuacuu uguaacagcaacuccauguggacuguguaccaauuuccaguggagaugcuguuacuu KE825302.1:8554..8611:+
PPA_96742_32807 2.7e+2 548 538 0 10 yes blast uacccauugcauaucggaguug accuccuaugugcauggauu uacccauugcauaucggaguugugaauucucaaagcaccuccuaugugcauggauu KE893982.1:4615..4671:-
PPA_36799_13003 2.3e+2 464 463 0 1 no blast acugaagaggguuguaaag ugccauccucgucacca acugaagaggguuguaaagagaauuucccugccauccucgucacca KE849118.1:3588..3634:-
PPA_148_40 2.2e+2 442 441 0 1 no blast uucccuuugucauccuuugccua gcagggacagcaaaggggugc uucccuuugucauccuuugccuagggcucugaguggggcagggacagcaaaggggugc KE820105.1:11227..11285:+
PPA_18122_6574 2.2e+2 434 346 4 84 yes blast gcugguuucauuuggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauuuggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu KE834309.1:29692..29756:-
PPA_96742_32817 2.0e+2 408 383 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca KE893982.1:13587..13647:-
PPA_6627_2502 1.8e+2 358 356 0 2 yes blast augaccuaugaauugacagacu ucugucacuucuguaggcc augaccuaugaauugacagacuguggcuaagcaugucugucacuucuguaggcc KE825302.1:8812..8866:+
PPA_7488_2873 1.7e+2 340 339 0 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugagcaauagugaaggaagcaaucagcaaguauacugcccu KE825914.1:14090..14155:-
PPA_19615_7114 1.3e+2 263 243 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca KE835541.1:72169..72231:+
PPA_68033_23443 1.2e+2 248 246 0 2 no blast gguucgauucccggucaggga cugacugguguggcucagu cugacugguguggcucaguugguuggguuucauccugcaaggagaaaggucacugguucgauucccggucaggga KE873350.1:2804..2879:+
PPA_17273_6302 9.0e+1 175 174 0 1 yes blast cacccugccugagcucuaaag cuugugcugggcuuggaga cacccugccugagcucuaaagcaaccugagauggcugcuacuugugcugggcuuggaga KE833666.1:42132..42191:+
PPA_92218_31288 8.9e+1 172 128 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua KE890871.1:9496..9560:+
PPA_3083_1137 6.6e+1 137 135 0 2 no blast ugaccuggggcucggagagcug gcugcucgauccacuggucc ugaccuggggcucggagagcugcuugcacucauucagcugcucgauccacuggucc KE822409.1:13569..13625:-
PPA_88018_29899 6.4e+1 125 77 0 48 yes blast gagacugaugaguucccggga ugcaggaacuugugagucu ugcaggaacuugugagucuccuauuaaaaaugaacaggagacugaugaguucccggga AWGZ01288981.1:9178..9236:-
PPA_134494_43761 6.3e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaaccguuuuucauuauugcuccugacc KE915692.1:1392..1451:+
PPA_66162_22895 6.1e+1 117 113 0 4 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaagua cuuuuugcggucugggcuugcuguuccucucaauaguagucaggaagcccuuaccccaaaaagua KE871945.1:2308..2373:-
PPA_81081_27611 5.9e+1 115 109 0 6 yes blast ucggggaucaucaugucacgag ugugacagauugauaacugaaag ucggggaucaucaugucacgagcuaccacugugcacuugugacagauugauaacugaaag KE882995.1:12882..12942:-
PPA_61850_21452 4.3e+1 96 93 0 3 yes blast cagcugaucgaugugucuc cucacaucgauguuucucucuc cagcugaucgaugugucucucucacaucgauguuucucucuc KE868647.1:34138..34180:+
PPA_98104_33245 3.9e+1 85 83 0 2 no blast ugcaagcaacacucuguggcaga gacacaauuugagcuugcuaua ugcaagcaacacucuguggcagaugaucaaaacugucugacacaauuugagcuugcuaua KE894917.1:3222..3282:-
PPA_113246_37728 3.4e+1 73 64 0 9 no blast cugcccuggcccgagggaccgacu cggccccacgcaccaggguaaga cggccccacgcaccaggguaagagagagucucauuuccugcccuggcccgagggaccgacu KE903955.1:12227..12288:-
PPA_21830_7864 3.3e+1 62 23 0 39 yes blast uagcagcacagaaauauuggca ccaauauuggcugagcugcuccag uagcagcacagaaauauuggcacugggaagagugccugccaauauuggcugagcugcuccag KE837293.1:4148..4210:+
PPA_71841_24657 3.3e+1 72 71 0 1 no blast gccgguccugagcccccu ggcggcagucaggcuccg gccgguccugagcccccuugaacuugaagcagccauggcggcagucaggcuccg KE876209.1:5175..5229:-
PPA_55339_19292 3.2e+1 62 41 0 21 yes blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucaugugucgagugugggauccgucucaguuacuuuauagcc KE863640.1:10302..10367:+
PPA_13304_4967 3.1e+1 61 24 0 37 yes blast aguuugauccuggguca auucccagucaggacacaugccu auucccagucaggacacaugccuaaguugggaguuugauccuggguca KE830536.1:32748..32796:-
PPA_81474_27763 3.0e+1 57 46 0 11 yes blast agcggacuggccgccugcuucu agccaggcggucaaugcgcug agcggacuggccgccugcuucucguucagcagagccaggcggucaaugcgcug KE883281.1:11823..11876:-
PPA_75986_25944 2.8e+1 55 49 0 6 yes blast aauuacagauugucuaagagga ucucaggcaagcuguagguccu aauuacagauugucuaagaggaaaacauuuauuguauuuucucaggcaagcuguagguccu KE879271.1:28238..28299:+
PPA_88919_30247 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu KE888572.1:445..499:+
PPA_20231_7330 2.1e+1 39 37 0 2 yes blast gaacgaaauccaagcgcagcug gcugcuuuugggauuccguugcc gaacgaaauccaagcgcagcuggaaugcucuggagacaacagcugcuuuugggauuccguugcc KE835984.1:5433..5497:+
PPA_23553_8477 1.5e+1 35 34 0 1 no blast ggcggcgggcggcgggcggg ggucgagcgcgcgcggc ggcggcgggcggcgggcggggcagccccccuggucgagcgcgcgcggc KE838610.1:1892..1940:-
PPA_54726_19076 1.4e+1 27 26 0 1 yes blast uauauauauauauguacguaug uacguagauauauauguauuu uauauauauauauguacguauguguauaugaauguauacguagauauauauguauuu KE863165.1:1843..1900:+
PPA_1657_618 1.4e+1 32 28 0 4 no blast caggagcgggcggguggcgg ggcgcggccugcagccug caggagcgggcggguggcggggaagaaggaaauggcgcgacgggcugcgcgugcuccucggcgcggccugcagccug KE821304.1:7397..7474:+
PPA_73470_25123 1.1e+1 20 15 0 5 yes blast ucaaaugcucagacuccuguggu ccacggauguuugagcaugugcua ucaaaugcucagacuccugugguggcugcucaugcaccacggauguuugagcaugugcua KE877411.1:1990..2050:-
PPA_77366_26361 1.1e+1 20 19 0 1 yes blast aggcaggggcgcggguggg accugcagcucugccug aggcaggggcgcgggugggcacggcauggcaccugcagcucugccug KE880270.1:160..207:-
PPA_29928_10652 1.1e+1 26 25 0 1 no blast cagggcugggcagggcagggca ccucccuucucccgccc cagggcugggcagggcagggcaaggccccagggcuuggauuucugguuccuagugguggccccuccucccuucucccgccc KE843666.1:896..977:+
PPA_112038_37432 1.1e+1 19 10 0 9 yes blast ugaggggccucagaccgagcuu gucucgcucucugccccucagc ugaggggccucagaccgagcuuuuggaaaauagaaaagucucgcucucugccccucagc KE903314.1:22381..22440:+
PPA_31343_11151 9.9 17 15 0 2 yes blast guuucccucucccuuccucu gggggggggggggaaaaaau guuucccucucccuuccucucucucgggggggggggggaaaaaau KE844775.1:5741..5786:-
PPA_26738_9673 9.1 15 13 0 2 yes blast ucuggcaggguccucuggcc caggccaggcccagcag caggccaggcccagcagaguccccucgcccucucuccacacuagcugucggcugaaugggcaucuggcaggguccucuggcc KE841135.1:30663..30745:+
PPA_23722_8544 8.9 18 12 0 6 yes blast uaauuuuauguauaagcuagu gagcuuauucauaaaaguacag gagcuuauucauaaaaguacaguauaauccaguaaaccuguaauuuuauguauaagcuagu KE838768.1:45507..45568:-
PPA_26673_9633 5.9 9 8 0 1 yes blast gggggaaaggggcugggac cccuggugcugucgccu cccuggugcugucgccucaaagcugggggaaggucauagagcuuuuacaucagaaaagggggaaaggggcugggac KE841072.1:24391..24467:+
PPA_33817_11939 5.4 9 8 0 1 yes blast uuagcaucuggcacuauggacu cuccauggacucccagauguuagc cuccauggacucccagauguuagcgacuagcucuauggauucccagauguuagcaucuggcacuauggacu KE846774.1:660..731:+
PPA_105912_35703 5.0 14 12 0 2 no blast cuccaguccacucugcccu ggggggggggggggggca ggggggggggggggggcagacucuccucaagcaucuccaguccacucugcccu AWGZ01334199.1:4344..4397:+
PPA_84485_28709 4.6 13 12 0 1 no blast gagccgcgggccgccgggc ccggccgcccacgccgg gagccgcgggccgccgggcacugcucuguggcccggccgcccacgccgg KE885401.1:1369..1418:-
PPA_53633_18672 4.3 11 10 0 1 yes blast ggaagcagcugauugauguu aucgauguuuuucucucu ggaagcagcugauugauguuuaucuuucacaucgauguuuuucucucu KE862316.1:13455..13503:+
PPA_4428_1667 4.1 16 15 0 1 no blast gagcaccggccuguggacu agcccuggcuggugugg agcccuggcuggugugguucauggauugagcaccggccuguggacu KE823479.1:4311..4357:+
PPA_123296_40515 3.8 20 19 0 1 no blast acuggagcugaaggugcugugcu aagucacuuucugcucuuggaa acuggagcugaaggugcugugcuagaugaagcuaagaacaucaacaagucacuuucugcucuuggaa KE909422.1:13638..13705:-
PPA_126646_41513 3.7 4 3 0 1 yes blast gagggcagagggaaaaggaa cuucccucuguccucag cuucccucuguccucagccucuggggaggaagggggagggcagagggaaaaggaa KE911334.1:3738..3793:+
PPA_125873_41305 3.0 5156 5156 0 0 yes blast cucaccgccgcggcccg ggugguugggcguguggggu cucaccgccgcggcccgggcuggggagcugguggcagcggagugcgggugguugggcguguggggu KE910891.1:25..91:-
PPA_53206_18548 2.9 120 120 0 0 yes blast cugccuagaccccugcucacc ggggcaggggcacugggcuggg ggggcaggggcacugggcugggguugggugcacucccugccuagaccccugcucacc KE861985.1:1758..1815:-
PPA_88634_30159 2.8 24 24 0 0 yes blast gcggcagcggcggcggc cgcagucugucugcugucg gcggcagcggcggcggcgggggnnncggcggcgccagcggcagcgucgcuguucccuuguccgcagucugucugcugucg KE888377.1:351..431:-
PPA_39179_13824 2.8 150 150 0 0 yes blast cggcggcggcggcggcu cggccuccagcccugcg cggccuccagcccugcgguggcagcuucuagcuccgacgcggcggcggcggcggcu AWGZ01139822.1:199..255:-
PPA_62628_21679 2.8 82 82 0 0 yes blast aggggcugggugggugugg uccgcucccagccccuca uccgcucccagccccucaccucuaaggcagcuaannnnnnnnaggcagcuaacaggggcugggugggugugg KE869255.1:621..693:+
PPA_26471_9559 2.7 33 33 0 0 yes blast cagggcgggaggggcggc ugguguuagcccuggg cagggcgggaggggcggcugcuguucccggccgcccaggccgccucagcagggacagcgcugguguuagcccuggg KE840907.1:5403..5479:-
PPA_113546_37819 2.7 rRNA 15 11 0 4 yes blast ugugugugugugugugggugua cccacacacacacacaca uguguguguguguguggguguauguauauguguauauauauguauacauauauauacccacacccacacacacacacaca KE904134.1:5906..5986:-
PPA_130928_42749 2.6 20 20 0 0 yes blast uuacaguugugaguaugugaaag uuccauacaaacaacuguaauc uuacaguugugaguaugugaaaguuuauuuuugaauuauuauuguauuauuuuccauacaaacaacuguaauc KE913697.1:6416..6489:-
PPA_90223_30624 2.6 63 63 0 0 yes blast gggggcggggaggggggca ccccccuuccuagugccuccuc ccccccuuccuagugccuccuccaugguugaacuguguguggggggcggggaggggggca KE889498.1:7307..7367:-
PPA_131520_42920 2.6 13 13 0 0 yes blast aguggcagaguugggauuugcac acaaauaacucacucugccacucg acaaauaacucacucugccacucgccuuuaauauggcacauuaaaggcgaguggcagaguugggauuugcac KE914036.1:20537..20609:-
PPA_80824_27497 2.6 22 22 0 0 yes blast cccuucccccuccccccug ugggugugaggaaggggagggug ugggugugaggaaggggagggugaggggcuagcucugcuccugcacccuucccccuccccccug KE882816.1:1804..1868:+
PPA_21830_7862 2.6 254 249 5 0 yes blast cagcagcacacugugguuugua caaaccacacugugguguuagagcgag cagcagcacacugugguuuguacggcacuguggccacguccaaaccacacugugguguuagagcgag KE837293.1:3830..3897:+
PPA_109781_36725 2.6 81 81 0 0 yes blast cagggcugggcugggcuggg caggcgggggcccagcugacugac cagggcugggcugggcugggcuggguaaauaucagcugcucacucaggccaggcgggggcccagcugacugac KE902087.1:1851..1924:-
PPA_49694_17382 2.6 363 363 0 0 yes blast gcggcggcggcggcggcggcggc caucgccgccuccagacggcggcggcgn caucgccgccuccagacggcggcggcgnnnnnnnnnnnnnnnngcggcggcggcggcggcggcggc KE859228.1:712..778:-
PPA_83379_28334 2.5 198 198 0 0 yes blast ucugacagccucucucuccccg cggagggaggugucaaacaggag ucugacagccucucucuccccgcaccccgugcacggagggaggugucaaacaggag AWGZ01276316.1:339..395:+
PPA_27729_10031 2.5 24 24 0 0 yes blast uguuccugcugaacugagccag guguuucagcucaguaggcacggg uguuccugcugaacugagccagucuguacaaaucaacuguguuucagcucaguaggcacggg KE841910.1:1977..2039:-
PPA_41789_14744 2.5 17700 17700 0 0 yes blast uguguauguguguguauauaug uauauauacacacacgcacaca uguguauguguguguauauauguauauacaugcaugcauguguguacauauaugcacgugugcauauauauauauauacacacacgcacaca KE853036.1:68033..68125:+
PPA_106986_35999 2.5 18 18 0 0 yes blast acucaaacugugggggcacuu gugccgccauuuuuugaguuc acucaaacugugggggcacuuucuguucugacaagaaagugccgccauuuuuugaguuc KE900523.1:4027..4086:-
PPA_66566_23025 2.5 47 46 0 1 yes blast ccgcggggcccgcgggc ccccgcaggccuccccgc ccccgcaggccuccccgcggnnnnnnnnnnnccccgcggggcccgcgggc KE872247.1:8363..8413:+
PPA_101896_34480 2.5 22 22 0 0 yes blast cuggcucaguggauggagcgccggc cgcugguucaauucccagucagag cuggcucaguggauggagcgccggcccugugaaccauagggucgcugguucaauucccagucagag AWGZ01324794.1:379..445:+
PPA_58954_20568 2.5 14 14 0 0 yes blast caggggcugugggagggcu gccuuggcacugccucugcc caggggcugugggagggcuaccccaggaaggccuuggcacugccucugcc KE866437.1:2707..2757:+
PPA_74722_25555 2.5 24 24 0 0 yes blast cccagggcucugaugugucu gcacugggcccgaggggca cccagggcucugaugugucucucgcagcugcugacggugagacccugagggcaggacgcgggggcacugggcccgaggggca KE878371.1:590..672:-
PPA_153202_47619 2.5 13 13 0 0 yes blast ggaggaggaggaggagg cccuccucacccccau ggaggaggaggaggagggcccuaccccuccucacccccau AWGZ01418922.1:1188..1228:-
PPA_6085_2315 2.4 16 16 0 0 yes blast uccuucauuccaccggagucugu agauuucaguggagugaaguuca uccuucauuccaccggagucugucucauacccaaccagauuucaguggagugaaguuca KE824801.1:37932..37991:-
PPA_40751_14365 2.4 80 79 0 1 yes blast uuuguucguucggcucgcguga ccgcgacgagccccucg ccgcgacgagccccucgcacaaaccggaccugagcguuuuguucguucggcucgcguga KE852212.1:16..75:+
PPA_100086_33910 2.4 108 108 0 0 yes blast agugguucucaaccuuggcugc agucaggcuugagagcuuugg agucaggcuugagagcuuugguuuagagcagugguucucaaccuuggcugc KE896275.1:4189..4240:-
PPA_35209_12453 2.4 123 123 0 0 yes blast uugguccccuucaaccagc uggucaaacggaaccaagu uggucaaacggaaccaaguccgucuuccugagagguuugguccccuucaaccagc KE847868.1:37072..37127:+
PPA_24909_8996 2.4 9 3 0 6 no blast agcccucggccagcucugaccucu gggagggcggcgcgggg agcccucggccagcucugaccucuugguggggagggcggcgcgggg KE839714.1:8555..8601:+
PPA_32707_11561 2.4 508 508 0 0 yes blast gcggcggcggcggcggcggcggc cgagccgcgcugcugagcgg cgagccgcgcugcugagcggguugcugcggcggcggcggcggcggcggc KE845904.1:9826..9875:+
PPA_121445_40029 2.4 96 95 0 1 yes blast agggguccccggugcuc ggggguggggcugcuca ggggguggggcugcucagggaagagagggguccccggugcuc AWGZ01366076.1:1669..1711:+
PPA_96742_32806 2.4 136 136 0 0 yes blast augcaccugggcaaggauu uccuugcuaucugggugcuagu uccuugcuaucugggugcuagugcugucuccaugcaaugcaccugggcaaggauu KE893982.1:3718..3773:-
PPA_95802_32521 2.4 15 13 1 1 yes blast ggguucgguucccggucaggg ggguggcucagcugguug ggguggcucagcugguuggagcguuguccggugcaccaaaaggcuguggguucgguucccggucaggg KE893341.1:5070..5138:+
PPA_53943_18776 2.4 20 20 0 0 yes blast uuacaguugugaguaugugaaag uuccauacaaacaacuguaaac uuacaguugugaguaugugaaagugauuauuauuuaucaauuauuuguauuuuccauacaaacaacuguaaac AWGZ01188508.1:4727..4800:+
PPA_26698_9654 2.4 4 2 1 1 no blast gagcggagccuggggccg gccucgggcuccuuccca gagcggagccuggggccgucauccccgggagcugucagagccgucugcagacucucccggccucgggcuccuuccca KE841096.1:182..259:+
PPA_4742_1785 2.4 12 12 0 0 yes blast gggugggggucggggggac ccaccucgaggguguuaugggc gggugggggucggggggacaguccugggaagcuuccucuccaggauuuaccaccucgaggguguuaugggc KE823748.1:7994..8065:-
PPA_20536_7432 2.4 36 36 0 0 yes blast gcucgcucgcucgcucgcu ugagugcugcgggcgcgcuu gcucgcucgcucgcucgcuccccauccggugagugcugcgggcgcgcuu KE836258.1:3100..3149:+
PPA_87834_29824 2.4 51 50 0 1 yes blast uagaggagaggcgaccaccacc ggugaggccccuucguu ggugaggccccuucguuccaccccuggaacccgcagggguagaggagaggcgaccaccacc KE887800.1:10797..10858:-
PPA_139580_45281 2.4 131952 131952 0 0 yes blast uuaaugcuaaucgugauagggguu cuccuacauguuagcauuaaca uuaaugcuaaucgugauagggguuuuuaccuccgacugacuccuacauguuagcauuaaca KE918518.1:4144..4205:-
PPA_65322_22597 2.3 78 78 0 0 yes blast agggggcggggaggggg cccuucccacugc cccuucccacugcugguggccagccugugccaggccaucggggagcagggggcggggaggggg KE871291.1:6876..6939:+
PPA_132256_43150 2.3 18 18 0 0 yes blast ggggcgggggcgggggcg cccccacccccggccaccacca ggggcgggggcgggggcggggccgcgcccccccucaauuccaucccuucugucacucccccacccccggccaccacca KE914431.1:3083..3161:+
PPA_48653_17009 2.3 17 17 0 0 yes blast uucaauuccuggucagggcacaag ugguccuggucagggcacaagcu uucaauuccuggucagggcacaagcuuagguugcaaguuugguccuggucagggcacaagcu KE858456.1:7535..7597:-
PPA_133508_43471 2.3 25 25 0 0 yes blast uggagugugacaaugguguuu acgccauuaucacacuaaaua uggagugugacaaugguguuuguguccaagcuaucaaacgccauuaucacacuaaaua KE915138.1:6303..6361:-
PPA_78403_26711 2.3 278 278 0 0 yes blast guguggcgcaguugguugggc ccagccagugcacauuc guguggcgcaguugguugggccuuguccugcaaagcaaaagcucacugguucgauucccagccagugcacauuc KE881064.1:43916..43990:-
PPA_96904_32887 2.3 250 250 0 0 yes blast gguucgauucccggucaggga ccugacugggguacguaccag gguucgauucccggucagggaacgugguuggguuucgcguuugguccugacugggguacguaccag KE894089.1:3307..3373:-
PPA_142782_46279 2.3 16 16 0 0 yes blast cugagcccgccgccucccccaga cgggggaaauggggaggacagaa cgggggaaauggggaggacagaagugaaggcuauuucugagcccgccgccucccccaga AWGZ01406594.1:10693..10752:+
PPA_105852_35675 2.3 129 129 0 0 yes blast uggaagacuagugauuuuguuguu caacaagucacaucuuccuca uggaagacuagugauuuuguuguucugguguacuaugacaacaagucacaucuuccuca AWGZ01334041.1:9084..9143:-
PPA_69041_23750 2.3 24 24 0 0 yes blast uguuccugcugaacugagccag gauaucagcucaguaggcaccgg uguuccugcugaacugagccaguguguaaaaugagaacugauaucagcucaguaggcaccgg KE874094.1:32299..32361:+
PPA_66918_23107 2.3 17 17 0 0 yes blast cccugggucucccucuu gaggggcuccagcacugggc gaggggcuccagcacugggcaggaggcauccaaaaugccccugggucucccucuu KE872501.1:26422..26477:+
PPA_130473_42660 2.3 483 483 0 0 yes blast ugagaacugaauuccauggguug accugugaaguucaguucuucag ugagaacugaauuccauggguugugucacugucagaccugugaaguucaguucuucag KE913423.1:6317..6375:+
PPA_106702_35928 2.3 50 50 0 0 yes blast ucuggcugcuauggcccccucc gaggugccauucugagggccaggagu gaggugccauucugagggccaggaguuugauuaugugucacucuggcugcuauggcccccucc KE900354.1:1351..1414:-
PPA_53874_18753 2.3 53 53 0 0 yes blast gcacuuggggccccggg ugggggccuuggaaagu ugggggccuuggaaagucccccaaugagcagcgcuacucagacgcacuuggggccccggg KE862521.1:6561..6621:+
PPA_128709_42157 2.3 96 96 0 0 yes blast uguguauguguguguauguaug uacauauauacacauuauauaca uguguauguguguguauguaugcacauguauguguauguauauguauacauauauacacauuauauaca AWGZ01380594.1:5502..5571:-
PPA_122426_40272 2.3 78 78 0 0 yes blast gcagcugaucgauguuu ucacgcaucaguguuu gcagcugaucgauguuugucucacgcaucaguguuu KE908948.1:4938..4974:-
PPA_25270_9153 2.3 12 12 0 0 yes blast aauauaacacagauggccugu agguugucugugaugaguucg agguugucugugaugaguucgcgucauuaaugccgaauauaacacagauggccugu KE840002.1:1747..1803:+
PPA_24250_8707 2.3 49 49 0 0 yes blast ggcggcggaggcggcggcgg ggcgcugcucagccccgg ggcgcugcucagccccggagacggcggcggaggcggcggcgg KE839172.1:33993..34035:+
PPA_96282_32675 2.3 59 59 0 0 yes blast gugugugugugugagugu ucuccacacacacacacau gugugugugugugaguguguauaucuccacacacacacacau KE893675.1:32265..32307:-
PPA_66549_23024 2.3 13 13 0 0 yes blast gguuaggguuaggguuagggc guuagaccuagcccuaacuug gguuaggguuaggguuagggcuagaguuaggguuagaccuagcccuaacuug KE872231.1:105227..105279:+
PPA_7161_2723 2.3 31 14 0 17 yes blast gagagaggaagggagagggaggga ucucucucucucucucucu ucucucucucucucucucucacccaaggauacuuuguucacugcuuugagagagaggaagggagagggaggga KE825664.1:14620..14693:+
PPA_99020_33543 2.3 55 55 0 0 yes blast auguguguguguguguguguag acauauauacacaauauauau acauauauacacaauauauauguguguauguguguguguguguguguag AWGZ01317547.1:2008..2057:+
PPA_7178_2728 2.3 3068 3068 0 0 yes blast cagcugaucgauguuucu gcacaugcagagggggugag gcacaugcagagggggugaggaagaggcagcugaucgauguuucu AWGZ01026302.1:11598..11643:-
PPA_52347_18258 2.2 403 385 0 18 yes blast aauggugccacuaggguug gaacccuaggagagugugccauuc gaacccuaggagagugugccauucacauagacuauaauugaauggugccacuaggguug AWGZ01183233.1:910..969:+
PPA_134351_43704 2.2 34 34 0 0 yes blast augugcaugugcgugugcgug cgcgugcgugcgugugcguuc augugcaugugcgugugcgugugccugcgcgugcgugcgugugcguuc AWGZ01391347.1:2004..2052:+
PPA_136325_44306 2.2 73781 73779 0 2 yes blast caaagaauucuccuuuugggcuu cccaaaggugaauuuuuugggaa caaagaauucuccuuuugggcuuucuaaguuuauucuaagcccaaaggugaauuuuuugggaa KE916714.1:31487..31550:+
PPA_129997_42531 2.2 15 15 0 0 yes blast gucccaucuggggugcca ggaccucagccuagacag ggaccucagccuagacaguccagguccuauggggguccacacugucccaucuggggugcca KE913162.1:4627..4688:+
PPA_2434_891 2.2 2048 2048 0 0 yes blast cagcugaucgauguuucu ucauaucgaugguucuc cagcugaucgauguuucuuucucauaucgaugguucuc KE821963.1:407..445:+
PPA_15685_5778 2.2 56 56 0 0 yes blast gguucgauucccggucaggg cagguugggggugugugagaggc gguucgauucccggucagggcaccugccuggguugugggcagggucccagguugggggugugugagaggc KE832425.1:1613..1683:+
PPA_63397_21974 2.2 13 13 0 0 yes blast cagcagauaccugggcuc gcccagccucuggcuggu gcccagccucuggcugguguggcucaauggacugagcaccagccugagaaccagaagguggucaguuugauucuaagucccagcagauaccugggcuc KE869840.1:19651..19749:+
PPA_68469_23586 2.2 81 81 0 0 yes blast cuguccuccaggagcucacg ugggagggagggagagag ugggagggagggagagagggagggguuaacaaggagaucuaagaauuuuuuaaaauccccuuugucuguccuccaggagcucacg KE873682.1:401..486:-
PPA_14071_5279 2.2 50 50 0 0 yes blast gguucgauucccggucaggg cuggcugggggcgugcgagaggc gguucgauucccggucagggcucaugccuggguuguggcccaggucuggcugggggcgugcgagaggc KE831092.1:9605..9673:-
PPA_111813_37362 2.2 12 12 0 0 yes blast caacugaucgauguuucgc cucacauugauguugcu caacugaucgauguuucgcucucacauugauguugcu AWGZ01346611.1:4502..4539:-
PPA_98864_33486 2.2 19 19 0 0 yes blast gaagggucccagguuugau ucagccgguuggguguuguccgg ucagccgguuggguguuguccggcaaaccgaagggucccagguuugau KE895462.1:3779..3827:-
PPA_57188_19905 2.2 14 14 0 0 yes blast cccgacugcuccugccuccc gaggcuaggaaguuugggc gaggcuaggaaguuugggccucuccccgacugcuccugccuccc KE865069.1:7311..7355:+
PPA_48542_16952 2.2 18 18 0 0 yes blast uucucaaccuuggcugcacuu gugccugccagguguugagccaguu gugccugccagguguugagccaguuagacugcagagcagucauucucaaccuuggcugcacuu AWGZ01170849.1:7801..7864:-
PPA_176569_49441 2.2 1059 1059 0 0 yes blast ucuuugguuaucuagcuguauga auaaagcuagauaaccgaaagua ucuuugguuaucuagcuguaugaguguauuggucuucauaaagcuagauaaccgaaagua AWGZ01442289.1:5689..5749:-
PPA_34475_12172 2.2 15 15 0 0 yes blast cagggaggaggggaggga gcucacgugugucgcuggg cagggaggaggggagggagaugggggggcaaugagaguuauaucuugauuuucagcucuccaguucugagcucacgugugucgcuggg KE847290.1:4026..4114:+
PPA_1747_648 2.2 77 77 0 0 yes blast gguuugauccuggcucag ggccaggcgcauaccua ggccaggcgcauaccuaggcugcggguuugauccuggcucag KE821389.1:6864..6906:-
PPA_33275_11784 2.2 281 281 0 0 yes blast guguggcgcaguugguugggc caccaguucgauuccug guguggcgcaguugguugggccuugucccaggaaguggaaggucaccaguucgauuccug KE846309.1:1231..1291:+
PPA_39523_13924 2.2 17 17 0 0 yes blast cggcacacaguaggcgcuc gugcccgcuguguugcugcc gugcccgcuguguugcugccuguccccagggggcccggcacacaguaggcgcuc KE851265.1:4908..4962:-
PPA_100651_34113 2.2 20 19 1 0 yes blast gagggaggaggggaggga cccccuucuuuaucuuuccc cccccuucuuuaucuuucccaagaauugggucccaggccgcccuucgggucugagcagugggagggaggaggggaggga KE896669.1:230..309:+
PPA_73471_25128 2.1 2867 2867 0 0 yes blast ucccuguccuccaggugcucacc uggaucuugggacucgggaca ucccuguccuccaggugcucaccuuguuguggaucuugggacucgggaca KE877412.1:49505..49555:+
PPA_104366_35226 2.1 85 85 0 0 yes blast gugugugugugugugugugu acacagauaucuaugu guguguguguguguguguguacguguguacacacagauaucuaugu KE899027.1:8145..8191:-
PPA_41990_14812 2.1 1248698 1248698 0 0 yes blast aacauucauugcugucgguggg cacugaacaaugaaugcaac aacauucauugcugucggugggcugaaguguguggacaagcucacugaacaaugaaugcaac KE853214.1:2881..2943:+
PPA_89080_30295 2.1 1060 1059 0 1 yes blast ugugcaaauccaugcaaaacuga uuaguuuugcagguuug uuaguuuugcagguuugcauuucagcguauauuuguauauauggcugugcaaauccaugcaaaacuga KE888679.1:1849..1917:+
PPA_21849_7873 2.1 174 174 0 0 yes blast cacccugccugagcucuaaag uugggguuuccuggguggu uugggguuuccuggguggugcaggccaaggucagucucuaucuguguuuugcccaggaccacccugccugagcucuaaag AWGZ01079379.1:721..801:+
PPA_5119_1928 2.1 17 17 0 0 yes blast uguguauguguguguguauaug uauauaaacacacauacacaua uauauaaacacacauacacauauauauauacuucuccauauauguguauguguguguguauaug KE824099.1:3408..3472:-
PPA_24729_8924 2.1 100 100 0 0 yes blast cccggaucugucucuugcu cgugcggacagacccgggg cccggaucugucucuugcuuuaaacugcgugcggacagacccgggg KE839544.1:9042..9088:+
PPA_109016_36519 2.1 15 15 0 0 yes blast guguguguguguguccguguc uacuuacucgcgcgcgcgcgc uacuuacucgcgcgcgcgcgcgugugcacgcacgcguguguguguguguguccguguc KE901682.1:89987..90045:+
PPA_26604_9605 2.1 11 11 0 0 yes blast ugaggaggaggaggaagaggag cuucagcccuuccugccucuaga cuucagcccuuccugccucuagacccagagcccccagacacuucugaggaggaggaggaagaggag KE841013.1:12886..12952:+
PPA_87057_29575 2.1 32 12 20 0 yes blast uccugcuccgucggccc uuagacugggcaaggcac uccugcuccgucggcccaguguucagacuaccuguucaggacaaugccguuguacaguagucugcacauugguuagacugggcaaggcac KE887247.1:18342..18432:+
PPA_79959_27218 2.1 14 14 0 0 yes blast ccuuucaguccacaggccg gccugcaacccaggug gccugcaacccagguggcugcccugacagggaauagaaccagcgaccuuucaguccacaggccg KE882198.1:5366..5430:-
PPA_40086_14120 2.1 375 375 0 0 yes blast ucggauccgucugagcuugg aagcucagagggcucugauu aagcucagagggcucugauucagaaagaucaucggauccgucugagcuugg KE851678.1:1440..1491:-
PPA_116983_38838 2.0 23 23 0 0 yes blast cugggcugggcagggcagggca caggucucugccugaaagug cugggcugggcagggcagggcagggcuuaggugaaucauugacagacgacacuggagccgugcaggucucugccugaaagug AWGZ01357168.1:4676..4758:+
PPA_134086_43648 2.0 13 13 0 0 yes blast gguucgauucccggucggggcac gccccgguugguguggaucag gccccgguugguguggaucaguggauugguugccagccugugaaccaaagagccgcugguucgauucccggucggggcac KE915475.1:6563..6643:-
PPA_135199_43966 2.0 81 81 0 0 yes blast cagggcugggcugggcuggg gggcucugcagagccccaggag cagggcugggcugggcugggcugggcucugcagagccccaggag AWGZ01393024.1:3632..3676:+
PPA_48021_16787 2.0 18 18 0 0 yes blast gauugaaccugcaaccugggcaugu aaccuagguagcaugugccucaaucag aaccuagguagcaugugccucaaucagggauugaaccugcaaccugggcaugu KE857945.1:19396..19449:+
PPA_98485_33378 2.0 17 17 0 0 yes blast ggguucgguucccggucaggg cuggcaggggggcucgg cuggcaggggggcucgguugguuggaguguccucccauaccgaaaggucaccggguucgguucccggucaggg KE895190.1:9389..9462:-
PPA_98044_33213 2.0 28 28 0 0 yes blast auugaauggcucagugagg uggugcugcagccccggugc uggugcugcagccccggugccacauugaauggcucagugagg KE894873.1:11592..11634:+
PPA_173265_48876 2.0 3495 3495 0 0 yes blast ggguucgauucccggucaggga ccugacuggguggcucgg ccugacuggguggcucgguugguuggagugccauccaguacaccaaaagguugcggguucgauucccggucaggga AWGZ01438985.1:3939..4015:-
PPA_13010_4857 2.0 23 23 0 0 yes blast aacccguagauccgaacuugug caagcuugugucuauagguaug aacccguagauccgaacuuguggugauaguccacacaagcuugugucuauagguaug KE830272.1:7867..7924:-
PPA_12469_4642 2.0 66 66 0 0 yes blast ccccggccccuccccca ggggagacugcggua ggggagacugcgguaugagccccggccccuccccca KE829848.1:22064..22100:-
PPA_13010_4855 2.0 2350524 2350518 0 6 yes blast ugagguaguagguuguauaguu uacagccuccuagcuuuccu ugagguaguagguuguauaguuuagaauuacaacaagggagauaacuguacagccuccuagcuuuccu KE830272.1:1653..1721:-
PPA_35930_12724 2.0 164 164 0 0 yes blast cuccuuucccuuccucucc gcacucagggagagugugaugaa gcacucagggagagugugaugaaaacauguuuuguauaacaugucuucuccuuucccuuccucucc KE848440.1:2950..3016:-
PPA_8607_3305 2.0 58 58 0 0 yes blast uuuacagagaggaagggagaca uuucccuuucuuuuuuaaaaaaaau uuucccuuucuuuuuuaaaaaaaauccucacucaaggauauguauguggauuuuacagagaggaagggagaca KE826788.1:35558..35631:+
PPA_117006_38850 2.0 51 50 0 1 yes blast gcccugacugguuuggcucagug aauuccaagucagggcacaug gcccugacugguuuggcucaguggacugagcaccuaacugugaagcaaagggucgcugguucaauuccaagucagggcacaug KE905998.1:5468..5551:+
PPA_16022_5868 1.9 35 35 0 0 yes blast cuagcccugaccaguuugg aaaggucauggguuagau cuagcccugaccaguuuggcucaguuggcugggugucauccuacaaagcaaaaggucauggguuagau KE832700.1:15098..15166:+
PPA_4665_1751 1.9 14 14 0 0 yes blast gguuaggguuaggguuagggc cccagccugcccacccc cccagccugcccaccccccaacucagguguuauuggccugaaccccaggguuaggguuaggguuaggguuagggc KE823674.1:4208..4283:+
PPA_6279_2388 1.9 37 34 3 0 yes blast agcccuggcugguguggcuc ggcacaugccuggguugc agcccuggcugguguggcucaguggauauaccagccugagaaccaaagggucucugguucgauuccagucaaggcacaugccuggguugc KE824983.1:14557..14647:-
PPA_113500_37799 1.9 15 15 0 0 yes blast cagggaagcugaccucugguc cccucugggggucaguuucccuuua cagggaagcugaccucuggucucauguaucugguugaaaauagaaaugccuggagcccucugggggucaguuucccuuua KE904103.1:12221..12301:-
PPA_13936_5212 1.9 68 68 0 0 yes blast uuauggcccuucgguaauucacug gugaauucuaccagugccauacac uuauggcccuucgguaauucacugaccgagacuguucacagugaauucuaccagugccauacac KE830982.1:539..603:+
PPA_145808_47243 1.9 29 28 0 1 yes blast acuuguguguguguguguguau cacacacacacacuaaa acuuguguguguguguguguauacacacacaggcacacacacacacuaaa AWGZ01411437.1:12468..12518:-
PPA_18071_6566 1.9 29 25 0 4 yes blast ucucccucugccucugccagg gcagcugggggaggaggc gcagcugggggaggaggcauggagaccaucaaaauugucacuuacucagcucucccucugccucugccagg KE834261.1:96..167:-
PPA_26850_9717 1.9 57 57 0 0 yes blast gggcccgcccccggggc accgacagggcgcucccuc accgacagggcgcucccucannnnnnnnnnnnnnnnnnnnnnnnnnnnngggcccgcccccggggc KE841241.1:632..698:+
PPA_63100_21856 1.9 1852 1851 1 0 yes blast uuaucagaaucuccagggguac accccgggcgugauucugauuugc uuaucagaaucuccagggguacuuauacuuugaaaaaguaccccgggcgugauucugauuugc KE869614.1:11454..11517:+
PPA_3332_1241 1.9 53841 47357 0 6484 yes blast cucggcguggcgucggucgugg ucgaccggaccucgaccggcu ucgaccggaccucgaccggcucgucuauguugccaaucgacucggcguggcgucggucgugg KE822640.1:47622..47684:+
PPA_96742_32811 1.9 51 51 0 0 yes blast aauccuuggaaccuaggugugagu acacaccuauucaaggguuca aauccuuggaaccuaggugugagugcuauuucagugcaacacaccuauucaaggguuca KE893982.1:8080..8139:-
PPA_109215_36576 1.9 13 13 0 0 yes blast cagccuccccagucaccugagcug gcuccaggugcacuucuugcaggcugug cagccuccccagucaccugagcugggugcuccaggugcacuucuugcaggcugug AWGZ01341292.1:628..683:+
PPA_115107_38239 1.9 20 13 7 0 yes blast auauauguauguguguaugugu auauguauauauauguauauau auauguauauauauguauauauauauguauauguguguguguauauauauacacacuaaauauguguauauauauguauguguguaugugu KE904939.1:11098..11189:+
PPA_101065_34220 1.9 368 362 6 0 yes blast ggaagcucggcgggcggccc cccgcccugcucugagcucuc cccgcccugcucugagcucuccagggccagcugggcugcaggaggaggaggaggaagcucggcgggcggccc KE896946.1:425..497:-
PPA_8937_3454 1.8 11 10 1 0 yes blast uucaauuccugguccgggcacau ggucccuagcugggguguguguaaga uucaauuccugguccgggcacaugccaggguuuugggccuggucccuagcugggguguguguaaga KE827071.1:55176..55242:+
PPA_50387_17609 1.8 66 63 0 3 yes blast ggcgguggcggcggcggcg gguggugguggugacugc ggcgguggcggcggcggcgguggugguggugcuggugcugguggugccggugguggugguggugacugc KE859776.1:7102..7171:-
PPA_40692_14333 1.8 17681 17681 0 0 yes blast uguguauguguguguauauaug uauagaaauacacgugcacuugagga uguguauguguguguauauaugugugcauacacacauauagaaauacacgugcacuugagga AWGZ01144904.1:13749..13811:-
PPA_97533_33058 1.8 15 15 0 0 yes blast ucacuccugucagagacuaguccgu ggacuguccuccagggguugag ggacuguccuccagggguugaguggagccaagagcccacuucacuccugucagagacuaguccgu KE894515.1:1138..1203:-
PPA_89080_30294 1.8 162 162 0 0 yes blast caaagugcucauagugcagguag acuguagugugggcacuuccag caaagugcucauagugcagguaguuuugccauuauucuacuguagugugggcacuuccag KE888679.1:1727..1787:+
PPA_57604_20099 1.8 2332 2332 0 0 yes blast gaucgaugaugacucccu ggaguuuccaacguccca ggaguuuccaacgucccagagugugcucggaucgaugaugacucccu KE865385.1:16525..16572:+
PPA_143614_46546 1.8 185 84 0 101 yes blast uagcaccauuugaaaucaguguu cugguuucacaugguggcuuagau cugguuucacaugguggcuuagauuuuuccaucuuuguaucuagcaccauuugaaaucaguguu KE920645.1:6619..6683:-
PPA_83447_28355 1.8 38 37 1 0 yes blast uggcccugacugaagacc uuucaagcagaggcccaa uggcccugacugaagaccagcaguuauacuauggcuguugguuucaagcagaggcccaa KE884667.1:5526..5585:-
PPA_40468_14238 1.8 19 19 0 0 yes blast uccacaccugaccccuggcau uccagggaacagguucagagg uccagggaacagguucagagguucaucgcagagcacccuccacaccugaccccuggcau KE852012.1:13777..13836:-
PPA_13374_4992 1.8 33 33 0 0 yes blast uagaucugggguggggccuga gggccucaccuucagaauuucug gggccucaccuucagaauuucugagucaguagaucugggguggggccuga KE830602.1:10310..10360:-
PPA_62099_21515 1.8 18 18 0 0 yes blast ggacccgggcgggggcuc ucccccgccuccucucg ggacccgggcgggggcuccuguguguacaucaccgcuccccuccccucccccgccuccucucg KE868845.1:194..257:-
PPA_114488_38097 1.7 51 51 0 0 yes blast agugccugcuaugugccagg ugggauacagaggugcuac agugccugcuaugugccagggcuugggauacagaggugcuac KE904627.1:39818..39860:-
PPA_140287_45518 1.7 1850570 1850542 0 28 yes blast aacauucauugcugucgguggg cucacugaucaaugaaugcaaa aacauucauugcugucgguggguuugagucugaaucaacucacugaucaaugaaugcaaa AWGZ01402280.1:11130..11190:+
PPA_65171_22561 1.7 33 33 0 0 yes blast uguguauguguguguaucuaua uaaauaucucuacauauauagg uguguauguguguguaucuauaucuagauauguacauguauauguauagguauaaauaucucuacauauauagg KE871195.1:22480..22554:-
PPA_40219_14171 1.7 49427 49422 1 4 yes blast agcagcauuguacagggcu agcuucuuuacagugcugccuug agcuucuuuacagugcugccuuguagcauucaggucaagcagcauuguacagggcu KE851804.1:22814..22870:+
PPA_81081_27609 1.7 12 12 0 0 yes blast uuuugcgauguguuccuaauau auugggaacauuuugcauucau uuuugcgauguguuccuaauauguaguauaaauguauugggaacauuuugcauucau KE882995.1:12092..12149:-
PPA_102116_34547 1.7 102 102 0 0 yes blast ggguucgauucccggucaggua ccuggccggguugcucag ccuggccggguugcucaguugguuacagugucguccacauacuguaagcccauggguucgauucccggucaggua KE897624.1:3920..3995:+
PPA_62628_21680 1.7 82 82 0 0 yes blast aggggcugggugggugugg gggccuggagaccgagcuuugaa aggggcugggugggugugggcugugcgggaggcuggcaucaugcacaguucuuggggccuggagaccgagcuuugaa KE869255.1:674..751:+
PPA_81081_27607 1.7 12 12 0 0 yes blast uuuugcgauguguuccuaauau auugggagcauuuugcaugcau uuuugcgauguguuccuaauaugcaauauaaauauauugggagcauuuugcaugcau KE882995.1:11957..12014:-
PPA_32715_11565 1.7 12 12 0 0 yes blast ccuuuggucugcaggcug gccagggaucauugagc ccuuuggucugcaggcuggugcucaauccacugagccauaccagccagggaucauugagc KE845911.1:16814..16874:-
PPA_118927_39410 1.7 186 186 0 0 yes blast ugugugugugugugugugugu auauaacacauaugcaggcaca uguguguguguguguguguguauaaauucauacauauaacacauaugcaggcaca AWGZ01361061.1:21884..21939:+
PPA_89080_30293 1.6 162 162 0 0 yes blast caaagugcucauagugcagguag guguacagugagcaguuguuu guguacagugagcaguuguuuaccaaggauaagauccuagugguaccaaagugcucauagugcagguag KE888679.1:1681..1750:+
PPA_36314_12850 1.6 82 82 0 0 yes blast gggggcggggaggggggca ucuuugggcccuguugaggg gggggcggggaggggggcaaggguuaaugauaggugaugggcuugaauaggaagagucuuugggcccuguugaggg KE848784.1:40250..40326:+
PPA_32136_11408 1.6 38833 38830 0 3 yes blast agcagcauuguacagggcu agcuucuuuacaguguugccuug agcuucuuuacaguguugccuuguggcauggaguucaagcagcauuguacagggcu KE845426.1:31825..31881:-
PPA_89730_30482 1.6 5977 5977 0 0 yes blast caaaggcucuuuucagagccacu caucucugaggaagagcuuaggu caaaggcucuuuucagagccacuaaccaucucugaggaagagcuuaggu AWGZ01293512.1:159..208:+
PPA_107419_36103 1.6 46 44 2 0 yes blast gccugcggacugaaagg uuuuaguccuggcug uuuuaguccuggcugguguggcucaguggacugagcacuggccugcggacugaaagg KE900779.1:9969..10026:+
PPA_124152_40754 1.6 36 36 0 0 yes blast uguguguguacguguguau auguguauauagauaca auguguauauagauacauauauauguguguguguacguguguau KE909909.1:25333..25377:-
PPA_66324_22946 1.6 14 14 0 0 yes blast cagauuucugggccucauc caaggccuaggagugugcg cagauuucugggccucauccuggaaucuaggcaaggccuaggagugugcg KE872044.1:6526..6576:+
PPA_129268_42328 1.6 29 29 0 0 yes blast gcagcugauugauguuucug cacacauuaaugcugcuc gcagcugauugauguuucugucacacauuaaugcugcuc KE912761.1:18529..18568:+
PPA_47607_16656 1.5 11 11 0 0 yes blast aaagguuguggguucgaguc uucgagucucacccccaguca aaagguuguggguucgagucccagucggggcacaugucuggguuucgagucucacccccaguca KE857587.1:2393..2457:+
PPA_140098_45454 1.5 35 35 0 0 yes blast aagcaaaggucagggucaagu ccaaccccagaccuggguauca ccaaccccagaccuggguaucagggacugucucagucucucuggcaugauaaagcaaaggucagggucaagu KE918781.1:7825..7897:-
PPA_1218_454 1.5 46 46 0 0 yes blast guuaguacuuggauggga ccauccaaggcccgaccc guuaguacuuggaugggaaaccccauccaaggcccgaccc KE820958.1:53801..53841:-
PPA_55828_19470 1.5 39 39 0 0 yes blast aaguuucccucaggaua uagaggggagaaagucug uagaggggagaaagucugagccaucuaauugcuagugcuguucaaaguuucccucaggaua KE864015.1:26837..26898:-
PPA_39838_14030 1.5 39 39 0 0 yes blast guauguguguguauauaug uauauacacacacacacauaccu guauguguguguauauaugauacacacauauguaacauauauacacacacacacauaccu KE851492.1:46954..47014:+
PPA_85117_28955 1.5 6593 6593 0 0 yes blast ucccgggcggcgcacca gagcgccggaaggaau ucccgggcggcgcaccagcaggccggagcgccggaaggaau KE885851.1:802..843:-
PPA_54826_19107 1.5 29 29 0 0 yes blast cagagaggaagggagagggagaga uuccccuaugcucccugaccaggg cagagaggaagggagagggagagaagcauugauguaagagacauugauugguugcuuccccuaugcucccugaccaggg KE863250.1:2958..3037:-
PPA_99382_33644 1.5 1462 1462 0 0 yes blast aggagcucacagucuagua caugacugagagaagccuuccua aggagcucacagucuaguaggguuggagaagucaugacugagagaagccuuccua KE895807.1:41368..41423:+
PPA_99382_33643 1.5 1462 1462 0 0 yes blast aggagcucacagucuagua cuagacaguggggauuca cuagacaguggggauucaaagacaaguaagaagugguucuuccucuagaggagcucacagucuagua KE895807.1:41320..41387:+
PPA_64550_22382 1.5 14 14 0 0 yes blast uagccaggaccuggacccacaac ugcugggcaguggaucuuggcuugcu uagccaggaccuggacccacaaccuucacuauuuugcugggcaguggaucuuggcuugcu KE870732.1:669..729:+
PPA_64886_22486 1.5 255 255 0 0 yes blast gggucguuucccggucaggga cggcggauagggaaaggacucag gggucguuucccggucagggaaccagauguugcggcggauagggaaaggacucag KE870963.1:704..759:+
PPA_124290_40802 1.4 78 78 0 0 yes blast gcagcugaucgauguuu auaucgauguuuuucucccu gcagcugaucgauguuugucucacauaucgauguuuuucucccu KE909993.1:5269..5313:+
PPA_50534_17654 1.4 114 114 0 0 yes blast gggaaucgaaccugggaccc guuuacaggacgacgcuccaa gggaaucgaaccugggacccuuggguuuacaggacgacgcuccaa KE859912.1:59317..59362:+
PPA_13374_4991 1.4 33 33 0 0 yes blast uagaucugggguggggccuga cuaacagaucccaggugcuacu uagaucugggguggggccugaaaauuugcuuuucuaacagaucccaggugcuacu KE830602.1:10276..10331:-
PPA_117731_39076 1.4 919 919 0 0 yes blast ccugguuaguacuuggaug uuuuugucuauggcuauacc uuuuugucuauggcuauaccacccugaauguacccaaucucaugugaucuuggaagcuaagcaggguagggccugguuaguacuuggaug KE906384.1:10086..10176:-
PPA_17209_6275 1.4 17677 17677 0 0 yes blast uguguauguguguguauauaug uguauauauacacauacauauu uguguauguguguguauauaugaguguguauguauguauauauguguggguguguauauauacacauacauauu KE833637.1:18175..18249:-
PPA_41449_14596 1.4 23 23 0 0 yes blast cauugauuggcugccuc gggagagauauaucaaugug gggagagauauaucaaugugcaagagauacauugauuggcugccuc KE852765.1:4756..4802:-
PPA_84821_28836 1.4 10 10 0 0 yes blast gugaccugcuguggucugacccug gauucggcguaucaugcggcccacag gauucggcguaucaugcggcccacagaugugcccgaccaggggcuauuaugugaccugcuguggucugacccug KE885644.1:6208..6282:-
PPA_89080_30290 1.4 335 335 0 0 yes blast aaaagugcuuacagugcagguag acugcaaugcaagcacuucuuac aaaagugcuuacagugcagguagcuuuuugagaucuacugcaaugcaagcacuucuuac KE888679.1:1336..1395:+
PPA_29563_10583 1.3 737 737 0 0 yes blast acuggacuuggagucagaa gugacucuaagucuucauu acuggacuuggagucagaaaagcuggguuuuucccaccuucugccugugugacucuaagucuucauu KE843342.1:1175..1242:-
PPA_176511_49430 1.3 12 12 0 0 yes blast agcccugaccaguuuggcucag aagcuaggggucacuga agcccugaccaguuuggcucaguugguagggagucucccgcaaagcuaggggucacuga AWGZ01442231.1:10501..10560:+
PPA_19730_7165 1.3 32 30 2 0 yes blast cugcccuggcugguuuggcuc ucuauucccaguuagggcacau cugcccuggcugguuuggcucaccccccccccccccccccugggaaccaaagggucacugguucuauucccaguuagggcacau KE835620.1:49819..49903:-
PPA_97686_33107 1.3 26 26 0 0 yes blast aucugggguagggccugggca ccuaggcuuccaccccaggaac ccuaggcuuccaccccaggaacuccaauuuaauugaucugggguagggccugggca KE894622.1:65256..65312:+
PPA_88027_29907 1.3 10 10 0 0 yes blast ggcugggcugggcugggcua gcuacaauguucagcaucuugugcu gcuacaauguucagcaucuugugcuaggcugggcugggcugggcua KE887936.1:66180..66226:+
PPA_2457_897 1.2 9 9 0 0 yes blast ggcugggcugggcugggcua gugcagcucgcaaacgcgau gugcagcucgcaaacgcgauggggaccgccugacgaggucugccugcguggcggcccccaggcugggcugggcugggcua KE821970.1:14153..14233:+
PPA_177141_49607 1.2 4452 4443 1 8 yes blast uagcagcacauaaugguuug caggccauauugugcugcc uagcagcacauaaugguuuguggguuuugaaaaggugcaggccauauugugcugcc AWGZ01442861.1:8172..8228:-
PPA_18597_6730 1.2 rRNA 157 157 0 0 yes blast ugugugugugugugugugugu auauauauuuauacauauaau uguguguguguguguguguguaaaaaaucauauauauuuauacauauaau KE834697.1:2958..3008:+
PPA_106783_35954 1.2 10 10 0 0 yes blast cccugguagggggcgugca cacccccccugccuggguu cacccccccugccuggguugcaggcaggucccugguagggggcgugca KE900394.1:24999..25047:-
PPA_49238_17232 1.2 6563 6528 0 35 yes blast ucagugcaucacagaacuuugucu gaaguucuguuauacacucaggcu gaaguucuguuauacacucaggcuguggcucucugaaagucagugcaucacagaacuuugucu KE858899.1:27213..27276:-
PPA_41753_14725 1.2 875 875 0 0 yes blast uuccuguccuccaggagcucac gagccccgggagccccaggguaac gagccccgggagccccaggguaacagguagguggagguguuuccuguccuccaggagcucac KE853003.1:899..961:+
PPA_13803_5174 1.2 32 32 0 0 yes blast aucucucucucuuccuccc gagugugcgagaggcaa gagugugcgagaggcaaucacacauugaugauuaucucucucucuuccuccc KE830894.1:3002..3054:-
PPA_103183_34837 1.1 35 35 0 0 yes blast uccugacugguuuggcucag gguucaauuccuugucagggca uccugacugguuuggcucaguggguuggugcaaacugaaaggucacugguucaauuccuugucagggca KE898282.1:28610..28679:-
PPA_81081_27605 1.1 40 40 0 0 yes blast uuuugcaauauguuccugaau uuggggacauuuugcauccau uuuugcaauauguuccugaauauguaauauaaguguauuggggacauuuugcauccau KE882995.1:11787..11845:-
PPA_105385_35568 1.1 10 10 0 0 yes blast uagagaaguuucucugaac ucagagaucacuucuauagu ucagagaucacuucuauaguuuaugacuagagaaguuucucugaac KE899608.1:5515..5561:-
PPA_155288_47708 1.0 8 7 0 1 no blast gcgggcagggcagggcaggg ugcucuuuucucuuccag ugcucuuuucucuuccaguggguguuuagaaaggaggguuuagacagaagaaggagcgggcagggcagggcaggg AWGZ01421008.1:268..343:-
PPA_57559_20061 1.0 226 211 0 15 yes blast cagugcaauaguauugucaaagc gcucugacuuuauugcacuacu gcucugacuuuauugcacuacuguacuuuacacuagcagugcaauaguauugucaaagc KE865351.1:4908..4967:+
PPA_73160_25048 1.0 10 10 0 0 yes blast gcugguguagcucagug ccaggcauaugccu gcugguguagcucaguggauagagugcuugccugugaaccaaaagguuacugguuugauucucaguccaggcauaugccu KE877210.1:5953..6033:+
PPA_33165_11735 1.0 335 335 0 0 yes blast auugauuggcugccuccugc gggagagauagaaagaaggaga gggagagauagaaagaaggagagagggaaacacugaugugggagaggaacauugauuggcugccuccugc KE846218.1:8019..8089:+
PPA_58359_20352 1.0 12450 12435 15 0 yes blast ggggauguagcucagugguaga aacccuggcaucuccag ggggauguagcucagugguagagcauaugcuucgcaugcaugaggccccagguucaaacccuggcaucuccag KE865986.1:15914..15987:+
PPA_26970_9755 1.0 9 9 0 0 yes blast cuggguggggggcgggggg uccagucuccuucuggcca uccagucuccuucuggccagcugcuuggcccuggguggggggcgggggg KE841349.1:300..349:+
PPA_36337_12854 1.0 3795 3795 0 0 yes blast aauggauuuuuggagcaggga cucuccaaggacaacauagu cucuccaaggacaacauaguuaauggauuuuuggagcaggga KE848805.1:7078..7120:-
PPA_49014_17147 1.0 15 15 0 0 yes blast ccuuucagucugcaggccg gcauguguccugacuggaaaucg gcauguguccugacuggaaaucgaaccagcgaccuuucagucugcaggccg KE858697.1:67170..67221:+
PPA_167643_48354 1.0 rRNA 216 216 0 0 yes blast gagaacucgggaucccg aaguucuuguuuucug gagaacucgggaucccgucaaguucuuguuuucug AWGZ01433363.1:1459..1494:+
PPA_26841_9713 0.9 17 17 0 0 no blast gagggcggguggaggaggac ucccugcggggcgugugu ucccugcggggcgugugugugugcgcgcgcgugcgcgcacggccgcggguacgugcgcgaagacgggggagggcggguggaggaggac KE841232.1:1957..2045:+
PPA_23668_8506 0.9 9 9 0 0 yes blast gaggaggggcugggggccuggacuc gcugguguucuugggucugagggag gcugguguucuugggucugagggaggaguggcugggggcccggaugccuggguccaagggaggaggggcugggggccuggacuc KE838716.1:1743..1827:-
PPA_49951_17462 0.9 20 20 0 0 yes blast acuggccaggccccccag cugucaccugcucagugu cugucaccugcucaguguacacuacuggccaggccccccag KE859457.1:10465..10506:-
PPA_90740_30806 0.9 10 10 0 0 yes blast cucguccucguccucguccuc gugaggcugcagcacagacc cucguccucguccucguccuccuccuccacuugcagugaggcugcagcacagacc KE889854.1:273..328:+
PPA_93416_31718 0.9 14 14 0 0 yes blast aaaggcuguggguucgaccc guuggaacaucagcccauac guuggaacaucagcccauacaccaaaaggcuguggguucgaccc KE891689.1:1673..1717:-
PPA_57616_20110 0.8 10 10 0 0 yes blast gugugugugugugacugugug cagggucaggcagaaguaacac gugugugugugugacuguguguguauuuuugacauauauauauaauauauauguuaauauauauauaacagggucaggcagaaguaacac KE865394.1:24269..24359:+
PPA_121828_40105 0.8 9 9 0 0 yes blast aggggagaggagaggaggca cccccuagcuucuuccugac aggggagaggagaggaggcagggaaauguacccuuggaucugggaggcccccuagcuucuuccugac AWGZ01366841.1:1039..1106:-
PPA_122482_40288 0.8 48 42 6 0 yes blast gugugugugugugagugu auguggcauaaaaauau gugugugugugugaguguggguguguguguguguguaugacuguuucugggcaaacauauacacagagacauguggcauaaaaauau KE908983.1:51730..51817:+
PPA_100470_34052 0.8 18 18 0 0 yes blast ugcugaugggcacuuaggcuguuuc aauaaugcugcuauguccugcuuaguuuu ugcugaugggcacuuaggcuguuuccaguacuugucuauuguaaauaaugcugcuauguccugcuuaguuuu KE896552.1:21577..21649:+
PPA_55905_19500 0.8 10 10 0 0 yes blast uguguauguauguguauauaug uauguauguauacauauauaug uauguauguauacauauauauguauguauauauauguaugcauguguauguauguguauauaug AWGZ01194586.1:2199..2263:-
PPA_104366_35225 0.7 85 85 0 0 yes blast gugugugugugugugugugu acacagauaucuaugu guguguguguguguguguguacguguguacacacagauaucuaugu KE899027.1:8145..8191:-
PPA_79213_26942 0.7 11 11 0 0 yes blast cugcagaaauuuagagaaagcug gcuaauaaaucugcuuac gcuaauaaaucugcuuaccuggauguguuucugcagaaauuuagagaaagcug KE881662.1:54..107:-
PPA_130072_42542 0.7 59 59 0 0 yes blast agcccugacugguuuggcucagu ugagauucaauuccuuggucaggguaca agcccugacugguuuggcucaguaggcuggucaucauccuaaaaaccaaaaagucacugagauucaauuccuuggucaggguaca AWGZ01383167.1:13745..13830:+
PPA_65532_22639 0.7 28 27 1 0 yes blast ucucucucucucucucucucu ggaggagcaggaggaggaga ucucucucucucucucucucucccccaaauccaauaaauauuaaaaagaaaagaaggaagaagaggaggaggaggagcaggaggagcaggaggaggaga KE871454.1:6034..6133:+
PPA_176689_49470 0.7 9 9 0 0 yes blast ggcgguuagcucagcgguagag ggcccgcuggcgggccgcagu ggcccgcuggcgggccgcaguaacacgaugggcgguuagcucagcgguagag AWGZ01442409.1:1..53:-
PPA_127709_41832 0.7 10 10 0 0 yes blast uguguauguauguguauauaug uguguguauguauauagagaga uguguauguauguguauauauguauauguguguauguauauagagaga KE911931.1:11112..11160:+
PPA_46221_16218 0.7 9 6 0 3 yes blast ucccucggccuucuuuugaugccu gaagaggaggaugaaga ucccucggccuucuuuugaugccucagcuagugaagaggaggaagaagaggaggaugaaga KE856526.1:1076..1137:+
PPA_55047_19188 0.6 74 74 0 0 yes blast ucuggcuguuguggugugcaa gccacacugcaacaccuuaca ucuggcuguuguggugugcaaaacuccguacauugcuauuuugccacacugcaacaccuuaca KE863437.1:5434..5497:+
PPA_129175_42302 0.6 9 9 0 0 yes blast ucuuggacggugggaccucuucaga ggaagggggaccugcuguuuggcc ggaagggggaccugcuguuuggccaauuuauccuacgggucuuggacggugggaccucuucaga AWGZ01381477.1:29937..30001:-
PPA_85554_29066 0.6 61 51 10 0 yes blast auuuuuggagcagggag cucuguucucaucaguuu cucuguucucaucaguuuaauaucggacacgugcucuauccgaggacaacacaucuaauggaauuuuuggagcagggag KE886161.1:13329..13408:-
PPA_141870_46017 0.6 13 13 0 0 yes blast gaagaggcuaacacagaaggguaaa cgcccuuuucugugcccuuuua cgcccuuuucugugcccuuuuaagguugacacagugcuaacacagaaggugaagaggcuaacacagaaggguaaa KE919741.1:1484..1559:+
PPA_54188_18878 0.5 28 28 0 0 yes blast gagaagauuagcauggc caugcaaauuuuugaau gagaagauuagcauggcaccuguacaaagaugacaugcaaauuuuugaau KE862740.1:30048..30098:+
PPA_128469_42098 0.5 766 766 0 0 yes blast gguuagcacucuggacucug gccuucagagacaguuggccau gguuagcacucuggacucuggaaguucuauacuucuguaauuuuuggaauugccuucagagacaguuggccau KE912353.1:12988..13061:+
PPA_126628_41505 0.5 20 20 0 0 yes blast ucuuccucucucucucucucaaa uagaaauucagagguagaugaaguga ucuuccucucucucucucucaaauacaagcaacaguuuauuuagaaauucagagguagaugaaguga KE911322.1:5313..5380:-
PPA_94881_32191 0.5 14 14 0 0 yes blast gagagaggaagggagagggaggga cccccauucaccuaccuccccca cccccauucaccuaccucccccauuuguuaauuuuagagagaggaauggagagaggaagggagagggaggga KE892701.1:9384..9456:+
PPA_130274_42601 0.4 7 7 0 0 yes blast cccuggauguucugcug gcggggcacauggggcu gcggggcacauggggcuccgcgggucccuggggcccuggauguucugcug AWGZ01383545.1:1502..1552:+
PPA_125940_41330 0.4 9 9 0 0 yes blast cugggcuggggcuggggg caggcagcccugaagucggcu cugggcuggggcugggggaagggggugggcugcaagcuggucugaugcagcauauugcauauuucccaggcagcccugaagucggcu KE910923.1:12892..12979:+
PPA_78093_26603 0.4 9 9 0 0 yes blast caugcccugaccgggaaucgaacu uuggucacuucacauacaugcc uuggucacuucacauacaugcccugaccuggguugaaucugcaacccaggcacaugcccugaccgggaaucgaacu KE880824.1:2927..3003:+
PPA_91715_31142 0.4 9 9 0 0 yes blast uccucucuggcccugccc gagggaaaccagaagauugcu gagggaaaccagaagauugcucuuguccucucuggcccugccc KE890530.1:7946..7989:-
PPA_76871_26214 0.4 894 894 0 0 yes blast gguuuucggaacugaggcc ucccuggagauuuu gguuuucggaacugaggccaacucaacuguuggucccuggagauuuu KE879932.1:16097..16144:+
PPA_23458_8435 0.3 14 14 0 0 no blast gccuggguuguggguucgauc ucgauuuccuaucagggcag ucgauuuccuaucagggcagaugccuggguuguggguucgauc KE838529.1:15708..15751:+
PPA_22408_8063 0.3 10 10 0 0 yes blast uucuggaggcucugagagaga ucucuuugccuuugguggu uucuggaggcucugagagagaaacuaucccaggucccucucuuugccuuugguggu KE837703.1:58398..58454:-
PPA_60102_20933 0.3 rRNA 8 5 0 3 yes blast uuuuuuuuuuuuuuuuuuu aaaaaaaaaagaaaaaaaaaaaa uuuuuuuuuuuuuuuuuuuggggccauaaucaacauaaucccaaaaccaaaaaaaaaaagaaaaaaaaaaaa KE867324.1:2462..2534:+
PPA_114502_38107 0.3 9 9 0 0 yes blast ccccaguggggggugugcaagag cucuuucucccuccucucugggauu ccccaguggggggugugcaagaggcaaucacacauugauguuucucucccucucuuucucccuccucucugggauu AWGZ01352043.1:524..600:-
PPA_103132_34830 0.3 371 370 0 1 yes blast gccauugaugaucguucuu gaaugcagucugagugg gccauugaugaucguucuuuucuuccuuuggaagaguaagagggagggaaugcagucugagugg KE898252.1:127..191:+
PPA_16617_6086 0.2 9 9 0 0 yes blast caucugacccccccccccccc gaaggaggggaagaaagaugga caucugaccccccccccccccccuuuagagagggggaaggaggggaagaaagaugga KE833102.1:6605..6662:+
PPA_160406_47946 0.2 267 267 0 0 yes blast uugcuuuuuuucugaua uuugagaggaaggaaaagu uugcuuuuuuucugauaagucuugcuucaguguaaggcuuuguacuguauuugagaggaaggaaaagu AWGZ01426126.1:1133..1201:+
PPA_29296_10482 0.2 8 8 0 0 yes blast cuccugcacgcucuccuc ggcugagcaugggcc cuccugcacgcucuccucugaggagcacgcgcggugagaacggggacgcuccuuggaggcugagcaugggcc KE843148.1:32574..32646:+
PPA_108815_36476 0.2 9 9 0 0 yes blast uagcucaguugguugaaca uucgauuccaagucagagcauaug uagcucaguugguugaacauugucuugcaauacaaaauggcaccuguucgauuccaagucagagcauaug AWGZ01340449.1:4094..4164:+
PPA_137701_44728 0.2 9 9 0 0 yes blast ugaguucaguucucggucagggca uucaguugguuggacucuca uucaguugguuggacucucaacccauacgccaaaagguugugaguucaguucucggucagggca AWGZ01397621.1:12873..12937:-
PPA_117909_39105 0.1 4421 4157 264 0 yes blast ucgugaagcguuccauauuu aauuggaacaauacagagau aauuggaacaauacagagauuagcauggccccugcgcaaggaugccgugcauauucgugaagcguuccauauuu KE906485.1:25918..25992:+
PPA_91715_31141 0.1 9 9 0 0 yes blast uccucucuggcccugccc gaaaccagaagauugcu gaaaccagaagauugcucuuguccucucuggcccugccc KE890530.1:7946..7985:-
PPA_83862_28478 0.1 39 39 0 0 yes blast ugugucuguguguguauauaug uguguguauauauucaugug uguguguauauauucaugugugugugucuguguguguauauaug KE884968.1:109849..109893:-
PPA_100234_33962 0.1 8 8 0 0 yes blast uauauauauauauguacguau auguauauauacauauauaca uauauauauauauguacguauauauauauguauguauauauacauauauaca KE896385.1:10318..10370:+
PPA_991_362 0.1 53 53 0 0 yes blast auguguguguguguguguguag guacauccauagaucauauua auguguguguguguguguguagccuuuccucacaaaauuaagacuguacauccauagaucauauua KE820802.1:5524..5590:+
PPA_8490_3261 0.1 256 256 0 0 yes blast agcugaucgauguuucu ucacaucgauguuuc agcugaucgauguuucucugucacaucgauguuuc KE826716.1:6771..6806:-
PPA_58686_20466 0.1 7 7 0 0 yes blast uggggcccaggaaucugcauuu acucggauugcugggcucugcc acucggauugcugggcucugcccccagaguuucugauucaguaggucagggguggggcccaggaaucugcauuu KE866203.1:30783..30857:-
PPA_36777_13001 0 10 10 0 0 yes blast uggggcccaggaaucugcauuu augcaaauuuccagacccacu augcaaauuuccagacccacugaaucagaaaugguauccguggggcccaggaaucugcauuu KE849100.1:12654..12716:+
PPA_64303_22290 0 8 8 0 0 yes blast guagagcugcugugucuuc uggcacagcuucacca guagagcugcugugucuucugggcuugguagaauggccuuauguaauaggcauccuauaaggguucaguggcacagcuucacca KE870547.1:7076..7160:+
PPA_16395_6022 0 8 7 0 1 yes blast ugguccugacugguguggcucagu auucccagucagggcac ugguccugacugguguggcucagucguuugggcauugugccacaaaccaaaaggucacugauucuauucccagucagggcac KE832935.1:25697..25779:+
PPA_11656_4405 0 80 80 0 0 yes blast cagcccuggcugguguggcu cgccagccugcaaac cagcccuggcugguguggcucagugcuuugagcgccagccugcaaac KE829198.1:18501..18548:+
PPA_86928_29532 0 15 15 0 0 yes blast cgcagggcccggcgccggc cccgguccccgccuc cgcagggcccggcgccggcguucaccgccccgguccccgccuc KE887144.1:739..782:+
PPA_102726_34718 0 8 7 1 0 yes blast uugggggcggggaggggag cccauaggcgcccaaccaagg uugggggcggggaggggagagagagaaacauugaugugacagagcagcauggauggauuguuugccucccauaggcgcccaaccaagg KE898009.1:37914..38002:+
PPA_67023_23131 0 83 83 0 0 yes blast agggggcggggaggggg ucacuuaaaaagcucauucugg ucacuuaaaaagcucauucuggcugugaaauagagcacggccagggggcggggaggggg KE872596.1:6698..6757:+
PPA_143938_46660 0 10 10 0 0 yes blast uucuggaggcucugagagaga aaucaaagugucauccaggcug aaucaaagugucauccaggcugguuucuucuggaggcucugagagaga KE920803.1:7661..7709:-
PPA_108170_36321 0 9 9 0 0 yes blast uuuuguguguguguguguggcu ccauauugcucuaacuuuaagg uuuuguguguguguguguggcuaaucugccauauugcucuaacuuuaagg KE901200.1:8373..8423:-
PPA_42924_15102 0 519 517 0 2 yes blast aagguuauagaaauuucagacaguu cgguuugaggccuugcccug cgguuugaggccuugcccugccgcauccagagcaagguuauagaaauuucagacaguu KE853953.1:8297..8355:-
PPA_172269_48775 0 10 10 0 0 yes blast uguguauguauguguauauaug uauaugcauauaguguaauuauauaca uauaugcauauaguguaauuauauacaguacauauuagcguauuucuauauuaguguguguguguguauguauguguauauaug AWGZ01437989.1:4114..4198:+