miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.8
Program call/mnt/prostlocal/programs/mirdeep/mirdeep2_0_0_8/bin/miRDeep2.pl /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/rfe/rfe_short_name.fa /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/rfe.renamed.fa.mirdeep_formated /mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/rfe/rfe_mapping.arf none none none
Reads/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/rfe/rfe_short_name.fa
Genome/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/genomes/rfe.renamed.fa.mirdeep_formated
Mappings/mnt/prostlocal2/projects/mh_bats_ncrna_annotation/2018/mirdeep2/rfe/rfe_mapping.arf
Reference mature miRNAsnone
Other mature miRNAsnone


Survey of miRDeep2 performance for score cut-offs -10 to 10
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
1018.83
918.43
818.13
717.53
6173
516.33
415.63
314.43
212.53
15.33
01.43
-11.13
-21.23
-31.13
-413
-513
-613
-713
-813
-913
-1013





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
RFE_43400_12327 7.5e+6 14814191 14807884 0 6307 yes blast uauugcacuugucccggccugu agguugggaucgguugcaaugcu agguugggaucgguugcaaugcuguguuucuguaugguauugcacuugucccggccugu KI152445.1:2327..2386:+
RFE_90712_24588 6.8e+6 13383348 13383267 0 81 yes blast uauugcacuugucccggccugu ggguggggauuuguugcauuacu ggguggggauuuguugcauuacuuguauuauacauaaaguauugcacuugucccggccugu AWHA01197304.1:4032..4093:-
RFE_160428_35065 5.6e+6 11009146 10695311 0 313835 yes blast aacauucaacgcugucggugagu accaccgaccguugacuguacc aacauucaacgcugucggugaguuugggauuugaaaaaaccaccgaccguugacuguacc AWHA01290613.1:12269..12329:-
RFE_42358_12020 5.4e+6 10695984 10695872 0 112 yes blast aacauucaacgcugucggugagu accaucgaccguugauuguacc aacauucaacgcugucggugaguuuggaauuaaagucaaaaccaucgaccguugauuguacc KI151850.1:14557..14619:+
RFE_112206_29222 1.5e+6 3123407 3123268 1 138 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuucc AWHA01233825.1:8676..8749:+
RFE_39898_11250 1.5e+6 3122326 3122148 0 178 yes blast ugagguaguagguuguauaguu cuauacaaucuacugucuuucc ugagguaguagguuguauaguuuggggcucugcccugcuaugggauaacuauacaaucuacugucuuucc KI150394.1:7647..7717:+
RFE_77156_21279 6.2e+5 1231583 1205396 0 26187 yes blast uguaaacauccucgacuggaagcu cuuucagucggauguuugcagc uguaaacauccucgacuggaagcugugaagccgcacaugggcuuucagucggauguuugcagc AWHA01172711.1:19143..19206:-
RFE_94195_25362 6.2e+5 1225874 1204463 28 21383 yes blast cacuagauugugagcuccugga aaggagcucacagucuauugag aaggagcucacagucuauugaguugccuuucugacuuccccacuagauugugagcuccugga KI180844.1:7785..7847:-
RFE_6559_2090 6.1e+5 1206444 769680 0 436764 yes blast agcucggucugaggccccucagu ugaggggcagagagcgagacuuu ugaggggcagagagcgagacuuuucuauuuuccaaaagcucggucugaggccccucagu KI130291.1:5918..5977:-
RFE_24752_7294 5.6e+5 1113377 1107139 0 6238 yes blast ucccugagacccuuuaaccuguga acaggugagguucuugggagc ucccugagacccuuuaaccugugagcacguccagggucacaggugagguucuugggagc KI141240.1:3233..3292:+
RFE_39898_11252 4.5e+5 890046 883709 7 6330 yes blast ugagguaguagguugugugguu cuauacaaccuacugccuuccc ugagguaguagguugugugguuucagggcagugauguugcccccucagaagauaacuauacaaccuacugccuuccc KI150394.1:8619..8696:+
RFE_40253_11361 4.4e+5 871159 861667 100 9392 yes blast uucacaguggcuaaguucug agagcuuagcugauuggugaac agagcuuagcugauuggugaacagugacugguuuccgcuuuguucacaguggcuaaguucug KI150618.1:36379..36441:+
RFE_6191_1971 4.3e+5 846247 844534 18 1695 yes blast ugagguaguaguuugugcuguu cugcgcaagcuacugccuug ugagguaguaguuugugcuguuggucggguugugacauugcccgcuguggagauaacugcgcaagcuacugccuug KI130102.1:13445..13521:-
RFE_67473_18817 3.9e+5 775191 774400 0 791 yes blast aagcugccaguugaagaacugu aguucuucaguggcaagcuuu aguucuucaguggcaagcuuuauguccugacccagcuaaagcugccaguugaagaacugu KI166654.1:1163..1223:+
RFE_30377_8899 3.2e+5 631615 629428 0 2187 yes blast caacggaaucccaaaagcagcug cugcgcuuggauuucguuccc caacggaaucccaaaagcagcuguugucuccagagcauuccagcugcgcuuggauuucguuccc KI144644.1:11317..11381:-
RFE_1083_335 3.0e+5 601946 600186 113 1647 yes blast uacccuguagauccgaauuugu caaauucguaucuaggggaau uacccuguagauccgaauuuguguaaggaauuuuguggucacaaauucguaucuaggggaau KI127047.1:1102..1164:-
RFE_28526_8416 2.6e+5 510710 510594 0 116 yes blast uucaaguaauccaggauaggcu ccuauucuugguuacuugcacg uucaaguaauccaggauaggcugugcaggucccaaggggccuauucuugguuacuugcacg KI143512.1:133..194:+
RFE_71849_19848 2.1e+5 413791 413591 0 200 yes blast uacccuguagaaccgaauuugu agauucgauucuaggggaaua uacccuguagaaccgaauuugugugguauccacauagucacagauucgauucuaggggaaua KI169453.1:19806..19868:+
RFE_57271_16186 2.0e+5 403221 402725 0 496 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgaggcucuucacggugcccggcucggggcagcucaguacaggau KI160557.1:52789..52852:+
RFE_57271_16189 2.0e+5 402271 402007 0 264 yes blast uccuguacugagcugccccgag cggggcagcucaguacaggau uccuguacugagcugccccgagccgggcaccgugaagagccucggggcagcucaguacaggau KI160557.1:52788..52851:-
RFE_28979_8534 1.6e+5 332004 328518 0 3486 yes blast uguaaacauccccgacuggaagcu cuuucagucagauguuugcugc uguaaacauccccgacuggaagcuguaagacacagcuaagcuuucagucagauguuugcugc KI143785.1:16883..16945:+
RFE_159918_34931 1.5e+5 306421 286146 0 20275 yes blast uagcuuaucagacugauguugacu caacagcagucgaugggcugu uagcuuaucagacugauguugacuguugaaucucauggcaacagcagucgaugggcugu AWHA01290103.1:12424..12483:-
RFE_109982_28770 1.5e+5 303546 281167 0 22379 yes blast uguaaacauccuacacucucagcu cugggagaaggcuguuuacucu uguaaacauccuacacucucagcugugcaaagugagaaagcugggagaaggcuguuuacucu KI188181.1:5020..5082:+
RFE_24752_7290 1.1e+5 227698 216275 0 11423 no blast cacccguagaaccgaccuugcg caagcucgugucuguggguccg cacccguagaaccgaccuugcggggccuucgccgcacacaagcucgugucuguggguccg KI141240.1:2589..2649:+
RFE_24199_7142 1.0e+5 205415 205396 8 11 yes blast ugagguaguagauuguauaguu cuauacagucuacugucuuucc ugagguaguagauuguauaguuuuagggucauaccccaucuuggagauaacuauacagucuacugucuuucc KI140909.1:12616..12688:+
RFE_112206_29224 1.0e+5 202315 202258 0 57 yes blast ugagguaguagauuguauaguu cuauacaaucuauugccuuccc ugagguaguagauuguauaguugugggguagugauuuuacccuguucaggagauaacuauacaaucuauugccuuccc AWHA01233825.1:9056..9134:+
RFE_24752_7292 9.5e+4 186445 185303 33 1109 yes blast ugagguaggagguuguauaguu cuauacggccuccuagcuuucc ugagguaggagguuguauaguugaggaggacacccaaggagaucacuauacggccuccuagcuuucc KI141240.1:2767..2834:+
RFE_12893_3950 8.6e+4 169400 169306 0 94 yes blast uagcagcacguaaauauuggcg accaauauuauugugcugcuuu uagcagcacguaaauauuggcguagugaaauaaauauuaaacaccaauauuauugugcugcuuu KI134129.1:14532..14596:+
RFE_49970_14157 8.6e+4 169224 169216 0 8 yes blast uagcagcacguaaauauuggcg ccaguauuaacugugcugcugaa uagcagcacguaaauauuggcguuaagauucuaaaauuaucuccaguauuaacugugcugcugaa KI156316.1:3211..3276:-
RFE_67017_18689 7.8e+4 153404 153306 6 92 yes blast ugagguaguagguuguaugguu cuguacaaccuucuagcuuucc ugagguaguagguuguaugguuuagaguuacacccugggaguuaacuguacaaccuucuagcuuucc AWHA01149936.1:18177..18244:-
RFE_20039_5988 6.6e+4 129607 129551 0 56 yes blast agcuacaucuggcuacugggucuc ggcucaguagccaguguagauc ggcucaguagccaguguagauccugucuuuuguaaucaguagcuacaucuggcuacugggucuc KI138421.1:2984..3048:-
RFE_25305_7492 6.2e+4 122615 107741 1 14873 no blast cauugcacuugucucggucuga aggcggagacuugggcaauugcu aggcggagacuugggcaauugcuggacgcugcccugggcauugcacuugucucggucuga KI141580.1:11867..11927:-
RFE_4031_1303 5.8e+4 115312 115308 0 4 yes blast aaaagcuggguugagagggcga gccuucucuucccgguucuucccg gccuucucuucccgguucuucccggagucgggaaaagcuggguugagagggcga KI128734.1:36853..36907:+
RFE_67222_18749 5.3e+4 105191 104912 0 279 yes blast acuggacuuggagucagaaggc cuccugacuccagguccugugu cuccugacuccagguccuguguguuaccucgaaauagcacuggacuuggagucagaaggc KI166478.1:842..902:+
RFE_14306_4316 5.0e+4 99718 99619 0 99 yes blast uagguaguuuccuguuguuggg ucgacagcacgacacugccuuc uagguaguuuccuguuguugggauccaccuuucucucgacagcacgacacugccuuc KI134933.1:356..413:+
RFE_22458_6617 4.5e+4 89645 88752 0 893 yes blast caaaacgugaggcgcugcuau cagcagcaauucauguuuugaa cagcagcaauucauguuuugaagugcuuuaaaagguucaaaacgugaggcgcugcuau KI139862.1:2716..2774:+
RFE_109626_28686 4.3e+4 84603 45321 0 39282 yes blast ucccugagacccuaacuuguga acaagucaggcucuugggaccu ucccugagacccuaacuugugagguauuuuaguaacaucacaagucaggcucuugggaccu KI188024.1:27953..28014:+
RFE_74231_20483 4.3e+4 84474 78788 87 5599 yes blast uguaaacauccuugacuggaagcu cuuucagucggauguuuacagc uguaaacauccuugacuggaagcuguaagguguucagaggagcuuucagucggauguuuacagc KI170988.1:10938..11002:-
RFE_98220_26229 4.2e+4 83736 77676 1 6059 yes blast uaauacugccugguaaugaugac caucuuacugggcagcauugga caucuuacugggcagcauuggauggugucuggucucuaauacugccugguaaugaugac KI182724.1:19707..19766:+
RFE_58632_16548 4.0e+4 78784 78728 0 56 yes blast uagguaguuucauguuguuggg ucggcaccaagaaacugccuga uagguaguuucauguuguugggauugagguuugaacucggcaccaagaaacugccuga KI161332.1:245..303:+
RFE_110183_28827 3.1e+4 60880 60786 0 94 yes blast uagguaguuucauguuguuggg caacgacauuaaaccacccga uagguaguuucauguuguugggccuggauuucugaacacaacgacauuaaaccacccga AWHA01230525.1:6077..6136:-
RFE_6392_2029 2.9e+4 58117 58101 0 16 no blast aacauucauuguugucgguggg ccaccgagggaugaaugucac aacauucauuguugucgguggguugugaggacggaggccagacccaccgagggaugaaugucac KI130207.1:18604..18668:-
RFE_12893_3948 2.7e+4 53148 52185 0 963 yes blast uagcagcacaucaugguuuaca cgaaucauuauuugcugcucu uagcagcacaucaugguuuacacacuacagucaagaugcgaaucauuauuugcugcucu KI134129.1:14385..14444:+
RFE_17717_5328 2.5e+4 50715 45531 0 5184 yes blast ucccugagacccuaacuuguga acggguuaggcucuugggag ucccugagacccuaacuugugauguuuaccguuuaaauccacggguuaggcucuugggag AWHA01041212.1:14477..14537:+
RFE_44979_12731 2.5e+4 49220 49167 8 45 yes blast ugagguaguaguuuguacaguu cuguacaggccacugccuugcc ugagguaguaguuuguacaguuugagggucuaugauaccacccgguacaggagauaacuguacaggccacugccuugcc KI153376.1:4982..5061:-
RFE_25305_7493 2.4e+4 48904 48224 0 680 yes blast caaagugcuguucgugcagguag acugcugagcuagcacuucccga caaagugcuguucgugcagguagugugauuaccugaccuacugcugagcuagcacuucccga KI141580.1:12072..12134:-
RFE_112206_29225 2.4e+4 48791 31435 15 17341 yes blast cuauacgaccugcugccuuucu agagguaguagguugcauaguu agagguaguagguugcauaguuuuagggcagggauuuugcccacaaggagguaacuauacgaccugcugccuuucu AWHA01233825.1:11573..11649:+
RFE_20039_5986 2.4e+4 47153 45507 0 1646 yes blast agcuacauugucugcuggguuu accuggcauacaauguagauuucugu accuggcauacaauguagauuucuguguuuguuaggcaacagcuacauugucugcuggguuu KI138421.1:2265..2327:-
RFE_25339_7510 1.9e+4 38841 38412 46 383 yes blast uucacaguggcuaaguuccg agggcuuagcugcuugugagca agggcuuagcugcuugugagcagggucugcuccaagucauguucacaguggcuaaguuccg KI141605.1:19717..19778:-
RFE_24864_7325 1.8e+4 36658 36652 1 5 yes blast uuuggcaaugguagaacucacacu gugguucuagacuugccaacu uuuggcaaugguagaacucacacuggugagguaaugggauccggugguucuagacuugccaacu KI141324.1:2417..2481:-
RFE_40253_11359 1.8e+4 36250 36121 0 129 yes blast aucacauugccagggauuaccacg ggguuccuggcaugcugauuu ggguuccuggcaugcugauuugugacuuaagauaaaaucacauugccagggauuaccacg KI150618.1:36153..36213:+
RFE_13227_4039 1.7e+4 35138 33707 0 1431 yes blast gccccugggccuauccuagaa ucuagguauggucccagggau ucuagguauggucccagggaucccagaucaaaccaggccccugggccuauccuagaa KI134300.1:27599..27656:+
RFE_14135_4257 1.4e+4 29106 28969 7 130 yes blast accacaggguagaaccacggac cagugguuuuacccuaugguagg cagugguuuuacccuaugguagguuacgucaugcuguucuaccacaggguagaaccacggac KI134810.1:37849..37911:+
RFE_84756_23130 1.4e+4 29084 22291 0 6793 yes blast ucacagugaaccggucucuuu cggggccguagcacugucugaga cggggccguagcacugucugagagguuuacauuucucacagugaaccggucucuuu KI176434.1:7837..7893:-
RFE_59851_16867 1.3e+4 26984 23703 14 3267 yes blast uccgagccugggucucucucu ggggguccccggugcucggau ggggguccccggugcucggaucucgagggugcuuauuguucgguccgagccugggucucucucu AWHA01134400.1:185..249:-
RFE_42796_12145 1.2e+4 24401 24331 17 53 yes blast cagugcaauguuaaaagggca gcucuuuucacauugugcuacu gcucuuuucacauugugcuacugucugcaccuaccacuagcagugcaauguuaaaagggca KI152110.1:2253..2314:+
RFE_153006_34136 1.1e+4 23121 23117 0 4 no blast ugauuagaggucuuggggc uucucaaacuuuaaauugau ugauuagaggucuuggggccaaaacaaucucaacuuauucucaaacuuuaaauugau AWHA01283191.1:2742..2799:+
RFE_25305_7496 1.0e+4 21035 19049 0 1986 yes blast ccgcacuguggguacuugcu uaaagugcugacagugcagau uaaagugcugacagugcagauagugguccucuccgugcuaccgcacuguggguacuugcu KI141580.1:12299..12359:-
RFE_6392_2031 1.0e+4 21010 18901 0 2109 yes blast aacauucaaccugucggugaguu accaucgaccguugaguggacc aacauucaaccugucggugaguuugggcagcucaggcaaaccaucgaccguugaguggacc KI130207.1:18768..18829:-
RFE_80911_22284 1.0e+4 20275 20266 0 9 no blast ucacagugaaccggucucuuu gggggccgaugcacuguacgaga gggggccgaugcacuguacgagagugaguagcaggucucacagugaaccggucucuuu KI174668.1:16276..16334:-
RFE_22458_6619 1.0e+4 20018 17696 0 2322 yes blast gaguauuguuucugcugcccgg uagcagcgggaacacuacug uagcagcgggaacacuacugcagugagugauuggugcucuggaguauuguuucugcugcccgg KI139862.1:3037..3100:+
RFE_126228_32247 9.7e+3 19092 19088 0 4 yes blast uuagggcccuggcuccaucuccu aguggggcuucgacccuaacc uuagggcccuggcuccaucuccuuuaagaaaaccuucuguggggaguggggcuucgacccuaacc KI195055.1:28708..28773:-
RFE_24198_7140 7.4e+3 14563 14562 0 1 yes blast acgcccuucccccccuucuuca aggagggaggagaugggc aggagggaggagaugggccaaguucccucugccuggaacgcccuucccccccuucuuca AWHA01056019.1:16797..16856:-
RFE_80349_22148 7.2e+3 14256 14225 0 31 yes blast uagcaccaucugaaaucgguua acugauuucuuuugguguucag acugauuucuuuugguguucagagucaauacaauuuucuagcaccaucugaaaucgguua KI174387.1:2605..2665:-
RFE_3448_1120 6.5e+3 12907 12906 0 1 no blast acccugcucgcugcgcca gggcggcccgcgggguc acccugcucgcugcgccauccgucacgcagggcggcccgcgggguc AWHA01008043.1:2708..2754:+
RFE_33241_9628 6.5e+3 12896 11331 0 1565 yes blast ucccuguccuccaggagcuc agcuccucgaggccagagccc ucccuguccuccaggagcucacuuacaucaggccgugagcuccucgaggccagagccc KI146379.1:5868..5926:+
RFE_38085_10804 6.5e+3 12807 12423 0 384 yes blast cacuccucuccucccgucuucu aggacgggaggaaaggaggg aggacgggaggaaaggagggcgugguuucuugcagguccucacuccucuccucccgucuucu KI149266.1:1317..1379:-
RFE_146964_33693 6.2e+3 12284 12275 5 4 yes blast agcugguguugugaaucaggccg gcuauuucacgacaccaggguu agcugguguugugaaucaggccgacgagcagugcauccucuuacccggcuauuucacgacaccaggguu AWHA01277149.1:1256..1325:-
RFE_13586_4114 5.8e+3 11554 11548 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucgccucuucaauggauuugguccccuucaaccagcugu KI134518.1:1277..1337:-
RFE_76224_21009 5.8e+3 11554 11548 0 6 yes blast uuugguccccuucaaccagcugu agcugguaaaauggaaccaaau agcugguaaaauggaaccaaaucaacuguucaauggauuugguccccuucaaccagcugu KI172207.1:5645..5705:+
RFE_16094_4827 4.9e+3 9678 9659 0 19 yes blast agagguaaaaauuugauuugacu agcaaaucauuuuuuacucucca agagguaaaaauuugauuugacuaguucuuaaacacaucuagcaaaucauuuuuuacucucca KI136034.1:5149..5212:-
RFE_43400_12318 4.8e+3 9599 8177 0 1422 yes blast caaagugcuuacagugcagguag acugcagugaaggcacuugua caaagugcuuacagugcagguagugauaugugcaucuacugcagugaaggcacuugua KI152445.1:1627..1685:+
RFE_96658_25874 4.8e+3 9571 7342 1 2228 yes blast ucucacacagaaaucgcacccguc ggggugcuaucugugauugagggac ggggugcuaucugugauugagggacauggcaaauagaauugucucacacagaaaucgcacccguc KI181992.1:4302..4367:-
RFE_25339_7512 4.8e+3 9490 9233 0 257 no blast aucacauugccagggauuucca gggguuccuggggaugggauuu gggguuccuggggaugggauuugcugccugucacaaaucacauugccagggauuucca KI141605.1:19886..19944:-
RFE_126912_32397 4.1e+3 8113 7169 0 944 yes blast uccgguucucagggcuccacc aggaagcccuggaggggcuggagg aggaagcccuggaggggcuggaggugauggauguguuccuccgguucucagggcuccacc KI195307.1:4888..4948:+
RFE_46088_13039 4.1e+3 8048 7500 0 548 yes blast augcaccugggcaaggauuccga uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcuguuggaacgcaaugcaccugggcaaggauuccga KI154035.1:10059..10121:+
RFE_78315_21545 3.8e+3 7578 6740 8 830 no blast ccaccuccccugcaaacgucca gacguuggcucugguggugau ccaccuccccugcaaacguccagugaugcagagguaauggacguuggcucugguggugau KI173345.1:34588..34648:-
RFE_15685_4691 3.8e+3 7570 7377 133 60 no blast ucuggcuccgugucuucacuccc gagggagggacgggggcugugc ucuggcuccgugucuucacucccguguguguccgaggagggagggagggacgggggcugugc KI135756.1:1420..1482:-
RFE_24199_7144 3.7e+3 7425 7415 0 10 yes blast ugagguaguaaguuguauuguu cuauacaacuuacuacuuuccc ugagguaguaaguuguauuguugugggguagggauuuuaggccccaauuagaagauaacuauacaacuuacuacuuuccc KI140909.1:13495..13575:+
RFE_28979_8536 3.4e+3 6831 6407 0 424 yes blast uguaaacauccuacacucagcu cugggagguggauguuuacuuc uguaaacauccuacacucagcuguaauauguggauuggcugggagguggauguuuacuuc KI143785.1:21242..21302:+
RFE_28996_8543 3.2e+3 6458 4484 0 1974 yes blast ucccccaggugugauucugauuug uuaucagaaucuccagggguac uuaucagaaucuccagggguacuuauaauuugaaaaagucccccaggugugauucugauuug KI143790.1:5111..5173:+
RFE_145760_33613 3.2e+3 6441 5864 0 577 yes blast ucagugcacuacagaacuuugu aaaguucugagacacuccgacu aaaguucugagacacuccgacucuguauaugauagaagucagugcacuacagaacuuugu AWHA01275945.1:613..673:+
RFE_67017_18691 2.9e+3 5875 5062 0 813 yes blast aacccguagauccgaucuugug caagcucgcuucuaugggucugu aacccguagauccgaucuuguggugaaguggaccgcacaagcucgcuucuaugggucugu AWHA01149936.1:18916..18976:-
RFE_49275_13949 2.8e+3 5595 5491 0 104 yes blast ugagaacugaauuccauaggcugu ugcccuagggacucaguucug ugagaacugaauuccauaggcugugagcucuagcacaugcccuagggacucaguucug AWHA01111728.1:5345..5403:-
RFE_24864_7329 2.8e+3 5538 5343 1 194 yes blast uauggcacugguagaauucacug ugaauuaccgaagggccauaaa uauggcacugguagaauucacugugaacagucucggucagugaauuaccgaagggccauaaa KI141324.1:6740..6802:-
RFE_145157_33578 2.6e+3 5163 5003 0 160 yes blast gucaacacuugcugguuuccucu gggagccaggaaguauugauguu gggagccaggaaguauugauguuucugccaguuuagcgucaacacuugcugguuuccucu AWHA01275342.1:864..924:-
RFE_46088_13035 2.5e+3 5062 4124 0 938 yes blast ccucccacacccaaggcuugca caugccuugaguguaggaccgu caugccuugaguguaggaccguuggcaucuuaauuacccucccacacccaaggcuugca KI154035.1:4814..4873:+
RFE_43400_12319 2.3e+3 4710 4487 0 223 no blast acugcccuaagugcuccuucug uaaggugcaucuagugcagauag uaaggugcaucuagugcagauagugaaguagauuagcaucuacugcccuaagugcuccuucug KI152445.1:1763..1826:+
RFE_58573_16528 2.2e+3 4376 4375 0 1 yes blast aggcaagaugcuggcauagcug ugcuaugccaacauauugccauc aggcaagaugcuggcauagcuguugaacugagaaccugcuaugccaacauauugccauc KI161294.1:3518..3577:+
RFE_50365_14287 2.0e+3 3954 2796 0 1158 yes blast uaaugccccuaaaaauccuuau agggacuuucaggggcagcugug agggacuuucaggggcagcuguguuuucugacucagucauaaugccccuaaaaauccuuau KI156552.1:15498..15559:+
RFE_50365_14286 1.9e+3 3787 3266 0 521 yes blast ugggucuuugcgggcgagauga aacuggccuacaaagucccagu ugggucuuugcgggcgagaugagggugucgguucaacuggccuacaaagucccagu KI156552.1:2861..2917:+
RFE_162_90 1.7e+3 3379 3310 0 69 yes blast cuuggcaccuaguaagcacuca agugccugcuaugugccagg cuuggcaccuaguaagcacucaguaaauaguugaugagugccugcuaugugccagg KI126528.1:16092..16148:+
RFE_17272_5191 1.6e+3 3266 2933 26 307 no blast ccacugccccaggugcugcug cgcauccccuagggcauuggugu cgcauccccuagggcauugguguaaagcuggagacccacugccccaggugcugcug KI136761.1:13235..13291:+
RFE_98220_26231 1.4e+3 2799 2416 1 382 yes blast uaacacugucugguaacgauguu caucuuaccggacagugcugga caucuuaccggacagugcuggauuucucggcucgacucuaacacugucugguaacgauguu KI182724.1:20289..20350:+
RFE_55515_15710 1.2e+3 2469 2188 0 281 yes blast cuccuggggcccgcacucucgc uggggagcggcccccgggcggg uggggagcggcccccgggcgggccucugcucuggccccuccuggggcccgcacucucgc AWHA01125276.1:22253..22312:+
RFE_43400_12324 1.1e+3 2155 2146 0 9 yes blast uaaagugcuuauagugcagguag acugcauuaugagcacuuaaagu uaaagugcuuauagugcagguaguguuuaguuaucuacugcauuaugagcacuuaaagu KI152445.1:2075..2134:+
RFE_46088_13043 7.6e+2 1495 945 0 550 yes blast gugcaccugggcaaggauucug uaauccuugcuaccugggugagagu uaauccuugcuaccugggugagagugcuuucugaaugcagugcaccugggcaaggauucug KI154035.1:11894..11955:+
RFE_17275_5193 7.4e+2 1463 1381 0 82 yes blast aacuggcccacaaagucccgcu cgggguuuugagggcgagauga cgggguuuugagggcgagaugaguuuauguuuuauccaacuggcccacaaagucccgcu KI136764.1:1142..1201:+
RFE_93278_25148 6.1e+2 1206 1204 0 2 yes blast guacaguacugugauaacugaa cgguuaucaugguaccgaugcug cgguuaucaugguaccgaugcuguauaucugaaagguacaguacugugauaacugaa AWHA01201820.1:3976..4033:-
RFE_119674_30834 6.0e+2 1192 1191 0 1 yes blast guacaguacugugauaacugaa caguuaucacagugcugaugc caguuaucacagugcugaugcuguccauucuaaagguacaguacugugauaacugaa KI192380.1:3558..3615:-
RFE_35525_10143 5.8e+2 1148 1088 1 59 yes blast uaacagucuacagccauggucg accguggcuuucgauuguuacu accguggcuuucgauuguuacugugggaaccgaagguaacagucuacagccauggucg KI147724.1:177..235:+
RFE_106098_28004 5.5e+2 1085 921 0 164 yes blast aggggcuggcuuuccucuggu uggagagaaaggcaguuccuga uggagagaaaggcaguuccugaugguccccuccccaggggcuggcuuuccucuggu KI186379.1:9897..9953:-
RFE_43400_12325 5.4e+2 1057 1048 0 9 yes blast ugugcaaauccaugcaaaacuga aguuuugcagguuugcauccagc aguuuugcagguuugcauccagcugugugauauucugcugugcaaauccaugcaaaacuga KI152445.1:2210..2271:+
RFE_59330_16707 5.0e+2 998 997 0 1 yes blast uguaacagcaacuccaugugga ccaguggagauguuguuacuu uguaacagcaacuccauguggacuguguaccaauuuccaguggagauguuguuacuu KI161749.1:11614..11671:-
RFE_167_92 4.9e+2 970 715 0 255 yes blast aaggagcuuacaaucuagcuggg caacuagacugugagcuucuaga aaggagcuuacaaucuagcuggggguaaaugacuugcacaggaacgcaacuagacugugagcuucuaga KI126531.1:101759..101828:+
RFE_7460_2355 4.3e+2 841 789 0 52 yes blast uguaacagcaacuccaugugga ccaguggggcugcuguuaucugg uguaacagcaacuccauguggaaguacccacuaguuccaguggggcugcuguuaucugg KI130835.1:4773..4832:-
RFE_46757_13227 4.1e+2 802 472 0 330 yes blast ucucugggccugugucuuaggcu caaagcacacggccugcagagagg ucucugggccugugucuuaggcucugcaagaucaaccgagcaaagcacacggccugcagagagg KI154409.1:13103..13167:-
RFE_41690_11832 3.8e+2 752 277 0 475 yes blast cauuauuacuuuugguacgcg ucguaccgugaguaauaaugcg cauuauuacuuuugguacgcgcugugacacuucaaacucguaccgugaguaauaaugcg KI151451.1:4865..4924:+
RFE_159858_34923 3.1e+2 615 571 0 44 yes blast ucuaguaagaguggcaguugaag augcugacauauuuacuagagg augcugacauauuuacuagaggguaaaauuaauaaccuucuaguaagaguggcaguugaag AWHA01290043.1:10855..10916:+
RFE_37463_10692 2.9e+2 rRNA 580 579 0 1 yes blast aaaaaaaaaaaaaaaaaaaaaaaa uuuuuuuuucuuuuuuu aaaaaaaaaaaaaaaaaaaaaaaauuuuuuggggguuuuuuuuuuuucuuuuuuu AWHA01085923.1:1607..1662:+
RFE_106331_28065 2.7e+2 533 532 0 1 yes blast uugcagcugccugggagugauuuc cggucacucugggcacc cggucacucugggcaccgcagcacugugcugggcauguugcagcugccugggagugauuuc AWHA01224081.1:7410..7471:+
RFE_29771_8742 2.7e+2 528 527 0 1 yes blast agaguugagucuggacgucccg ugauuguccaaacgcaauucucga ugauuguccaaacgcaauucucgagucucuggcuccggccgagaguugagucuggacgucccg KI144249.1:494..557:-
RFE_46088_13048 2.5e+2 499 488 0 11 yes blast uacccauugcauaucggagcug accuccugugugcauggauuaca uacccauugcauaucggagcugugaauucucaaagcaccuccugugugcauggauuaca KI154035.1:13913..13972:+
RFE_106707_28131 2.4e+2 483 463 0 20 yes blast uugugcuugaucuaaccaugug caugguuccgucaagcacca uugugcuugaucuaaccaugugguugccagguaugaguaaaacaugguuccgucaagcacca AWHA01224698.1:3981..4043:-
RFE_80349_22149 2.2e+2 441 381 4 56 yes blast gcugguuucauauggugguuuaga uagcaccauuugaaaucaguguu gcugguuucauauggugguuuagauuuaaauagugauugucuagcaccauuugaaaucaguguu KI174387.1:3003..3067:-
RFE_155011_34338 2.1e+2 423 318 0 105 yes blast accgauuucuccugguguucaga uagcaccauuugaaaucgguua accgauuucuccugguguucagagucuguuuuugucuagcaccauuugaaaucgguua AWHA01285196.1:1276..1334:+
RFE_46088_13038 2.0e+2 407 382 21 4 yes blast caucccuugcaugguggagggu cucccacaugcaggguuugca caucccuugcaugguggagggugcgcuugcugaaaaccccucccacaugcaggguuugca KI154035.1:5202..5262:+
RFE_59330_16705 1.9e+2 375 326 0 49 yes blast augaccuaugaauugacagaca ucugucauuucuauaggccaau augaccuaugaauugacagacaauauggcuaacugugucugucauuucuauaggccaau KI161749.1:10975..11034:-
RFE_32988_9551 1.9e+2 372 365 0 7 yes blast aucucagguucgucagcccgug aggacuguccaaccugagaaug aggacuguccaaccugagaauggugucuccagggucaaucucagguucgucagcccgug KI146232.1:2524..2583:+
RFE_12029_3678 1.7e+2 340 339 0 1 yes blast uggcagugucuuagcugguuguu aaucagcaaguauacugcccu uggcagugucuuagcugguuguugugaguaauagugaaggaagcaaucagcaaguauacugcccu KI133604.1:19437..19502:+
RFE_2968_971 1.5e+2 300 238 0 62 yes blast cagugccucggcagugcagcc gugcauugcuguugcauug gugcauugcuguugcauugcaugugugugaggcgggugcagugccucggcagugcagcc KI128121.1:7938..7997:+
RFE_22450_6614 1.1e+2 238 213 0 25 no blast cauggaggucucugucuggcu ucugaucguuccccuccauaca cauggaggucucugucuggcuuaggacagcugacuaagucugaucguuccccuccauaca KI139855.1:38351..38411:+
RFE_96957_25937 9.9e+1 192 191 0 1 yes blast uucccuuugucauccuuugccc gcagggacagcaaaggggugc uucccuuugucauccuuugcccaggacucugaggggggcagggacagcaaaggggugc KI182127.1:17052..17110:-
RFE_115556_29925 9.2e+1 179 135 0 44 yes blast uggaagacuagugauuuuguuguu caacaaaucacagucugccaua uggaagacuagugauuuuguuguuuuuagauaacuaaaucgacaacaaaucacagucugccaua KI190607.1:421..485:-
RFE_94116_25343 6.4e+1 123 115 0 8 yes blast uuuuucauuauugcuccugacc ucaagagcaauaacgaaaaaug ucaagagcaauaacgaaaaauguuugucauaaaccguuuuucauuauugcuccugacc KI180798.1:4016..4074:+
RFE_71303_19733 6.2e+1 119 116 0 3 yes blast cuuuuugcggucugggcuugc aagcccuuaccccaaaaag cuuuuugcggucugggcuugcuguuccucucaacaguagucaggaagcccuuaccccaaaaag KI169108.1:16857..16920:-
RFE_57360_16210 6.1e+1 118 77 0 41 yes blast gagacugaugaguucccggga ugcaggaacuugugagucuccu ugcaggaacuugugagucuccuauugaaaaugaacaggagacugaugaguucccggga KI160615.1:2908..2966:+
RFE_50230_14243 4.4e+1 84 82 1 1 yes blast uccagcucccggcgcugcccacu caggcagcgcagguggcugagc caggcagcgcagguggcugagccccgcagcagcggccccgcaccggccgcucgguccagcucccggcgcugcccacu KI156473.1:5718..5795:+
RFE_25018_7367 3.8e+1 83 82 0 1 no blast ugcaagcaacacucuguggcaga gacacaauuugagcuugcuaua ugcaagcaacacucuguggcagaugaucaaaacugucugacacaauuugagcuugcuaua KI141407.1:24236..24296:-
RFE_89025_24162 3.4e+1 75 74 0 1 no blast cccuguccuccaggagcuc agggagaggaacgaggg cccuguccuccaggagcucaggggccagugagggagaggaacgaggg KI178428.1:83833..83880:+
RFE_79586_21886 3.3e+1 64 42 1 21 yes blast uuauaaagcaaugagacugauu uccgucucaguuacuuuauagcc uuauaaagcaaugagacugauugucaugugucgugugugggauccgucucaguuacuuuauagcc KI174013.1:5619..5684:+
RFE_35996_10279 3.3e+1 62 23 0 39 yes blast uagcagcacagaaauauuggca ccaauauuggcugagcugcuccag uagcagcacagaaauauuggcacugggaagaaagucugccaauauuggcugagcugcuccag KI148028.1:2815..2877:-
RFE_20587_6124 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucagggggcucugaauguguacaguagucugcacauugguu KI138747.1:26603..26665:-
RFE_112539_29308 3.2e+1 60 58 0 2 yes blast acaguagucugcacauugguu cccaguguucagacuaccuguuc cccaguguucagacuaccuguucaggaaaaugccguuguacaguagucugcacauugguu KI189313.1:724..784:-
RFE_27536_8126 2.8e+1 52 51 0 1 yes blast ugagaugaagcacuguagcu ggugcagugcugcaucucugguca ggugcagugcugcaucucuggucaguugggagucugagaugaagcacuguagcu KI142932.1:4933..4987:-
RFE_79344_21836 2.3e+1 43 27 0 16 yes blast caauguuuccacagugcaucac gugcauuguaguugcauugca gugcauuguaguugcauugcacguucuagcgguacccgugcaauguuuccacagugcaucac KI173887.1:47822..47884:+
RFE_30377_8898 2.1e+1 39 37 0 2 yes blast gaacgaaauccaagcgcagcug gcugcuuuugggauuccguugcc gaacgaaauccaagcgcagcuggaaugcucuggagacaacagcugcuuuugggauuccguugcc KI144644.1:11319..11383:+
RFE_12846_3922 2.1e+1 41 40 0 1 yes blast uauauauauauauguacguaug uacguagauauauauguauuu uauauauauauauguacguauguguauaugaauguauacguagauauauauguauuu KI134097.1:6616..6673:+
RFE_31780_9294 1.8e+1 46 45 0 1 no blast acuggacuuggcgucagaaa ucugaaucuugaucugg acuggacuuggcgucagaaacacuagguuaaaauccuggaauguguucugaaucuugaucugg KI145485.1:8080..8143:+
RFE_112428_29281 1.3e+1 23 21 0 2 yes blast uuacaguuguucaaccaguuacu uaaccaguugaacaacugaaccc uuacaguuguucaaccaguuacuaaucuaacuaauuguaaccaguugaacaacugaaccc KI189263.1:10892..10952:-
RFE_15490_4648 1.3e+1 22 12 0 10 yes blast uaaaaugcucagacuccuguggu ccacggauguuugagcaugugcua uaaaaugcucagacuccugugguggcugcucaugcaccacggauguuugagcaugugcua KI135653.1:28708..28768:-
RFE_6559_2088 1.1e+1 19 10 0 9 yes blast ugaggggccucagaccgagcuu gucucgcucucugccccucagc ugaggggccucagaccgagcuuuuggaaaauagaaaagucucgcucucugccccucagc KI130291.1:5920..5979:+
RFE_41325_11729 1.1e+1 26 25 0 1 no blast uccggcucuggcucaccg gggcuuggccgggggcu uccggcucuggcucaccgucugcugccuccacagacucacucuccaagcucucaggcagcagcgggcuuggccgggggcu KI151228.1:21450..21530:-
RFE_112539_29306 1.0e+1 18 10 0 8 yes blast uaaccaaugugcagacuacugu cagguagucugaacacuggggc uaaccaaugugcagacuacuguacaacggcauuuuccugaacagguagucugaacacuggggc KI189313.1:723..786:+
RFE_45007_12736 9.4 19 13 0 6 yes blast uaauuuuauguauaagcuagu gagcuuauucauaaaaguacag gagcuuauucauaaaaguacaguauaauccaguaaaccuguaauuuuauguauaagcuagu KI153392.1:19180..19241:-
RFE_45821_12983 8.9 15 7 0 8 yes blast aagcccuuaccccaaaaag uuuuugcggucugggcuugcu uuuuugcggucugggcuugcuguaccuaacucaauagccggaagcccuuaccccaaaaag KI153893.1:17..77:+
RFE_20587_6122 7.7 12 10 0 2 yes blast uaaccaaugugcagacuacugu agguagucugaacacuggg uaaccaaugugcagacuacuguacacauucagagcccccugaacagguagucugaacacuggg KI138747.1:26602..26665:+
RFE_131783_32963 7.3 12 8 0 4 yes blast uacacacacacacacccacau uguguauguguguguguauauu uacacacacacacacccacauacacacacacguguguguguguauguguguguguauauu AWHA01261968.1:20..80:-
RFE_38051_10787 6.9 11 9 0 2 yes blast agggaagaggaggaggagg cuacccugcccuuccug cuacccugcccuuccugacccuagggaagaggaggaggagg KI149239.1:11218..11259:+
RFE_89935_24350 5.8 9 8 0 1 yes blast ugaucucuccaucacccacccac gagcaggguguggaggg gagcaggguguggagggcccagcagccggggcugaucucuccaucacccacccac KI178821.1:16078..16133:-
RFE_22458_6621 5.5 9 6 0 3 yes blast ugugacagauugauaacugaaag ucggggaucaucguguca ucggggaucaucgugucacgagagaccacugugcacuugugacagauugauaacugaaag KI139862.1:8032..8092:+
RFE_47764_13511 5.1 rRNA 42 40 0 2 yes blast aaaaaaaaaaaaaaaaa uuuuuuuuuuuuuuuug uuuuuuuuuuuuuuuugggccccaaaaaaaaaaaaaaaaa AWHA01108496.1:0..40:+
RFE_84806_23142 4.7 6 5 0 1 yes blast ucaacaaaaucacugaugcuggagu ucagcaccaggauauuguuggaga ucaacaaaaucacugaugcuggaguuacgugugucaucacucagcaccaggauauuguuggaga KI176458.1:5839..5903:+
RFE_155855_34418 3.1 15 15 0 0 yes blast ccgggggggccgggggggg uuccccugucuccccgguc uuccccugucuccccggucucuagaggagcccaggaaggaggcucggcuagcgccgggggggccgggggggg AWHA01286040.1:22..94:-
RFE_12940_3963 3.0 324 318 0 6 yes blast gcggaggcggcggcggcggcggcgg gccgccgcggcuguggc gccgccgcggcuguggcggcggcgccggggguugcauguguggcugcuggaugcggaggcggcggcggcggcggcgg KI134161.1:6598..6675:+
RFE_62081_17431 3.0 21 21 0 0 yes blast cggcuccggcuccggcucc ggcugcgggagcugga ggcugcgggagcuggagcugcugcuacugcggguccggcuccggcuccggcucc AWHA01139097.1:34893..34947:+
RFE_67685_18880 2.9 5 4 0 1 yes blast cucuccagcuccaccguuaccgcu gguucuccccgugcggc gguucuccccgugcggcuuggagaauucgcaauacucuccagcuccaccguuaccgcu KI166785.1:21887..21945:-
RFE_72008_19895 2.8 64 64 0 0 yes blast ggggucgggggcggucggg caacagacuggcucugacuccug caacagacuggcucugacuccugccccgggggucgggggcggucggg KI169555.1:12179..12226:+
RFE_75871_20919 2.8 26 26 0 0 yes blast cccggcccugcccugcccu agcccuagggcgggccuggga cccggcccugcccugcccugcccagcccuagggcgggccuggga AWHA01170071.1:355..399:-
RFE_20120_6024 2.7 16 16 0 0 yes blast cggggcggggcgggccggg cggcccgcccacaccugcccggcc cggcccgcccacaccugcccggccucggggcggggcgggccggg KI138481.1:9607..9651:-
RFE_42884_12159 2.7 35 35 0 0 yes blast cugccugucugugccugcugu agcaggcaccgagggcaggu cugccugucugugccugcugucaggccuggcccaggcugagcaggcaccgagggcaggu KI152157.1:17904..17963:-
RFE_85940_23421 2.6 581 581 0 0 yes blast aauggcgccacuaggguug acccuaggaaagcgugccauuca acccuaggaaagcgugccauucacauagacuaaaauugaauggcgccacuaggguug KI176982.1:2886..2943:+
RFE_115230_29854 2.6 212 160 52 0 yes blast ugugugugugugugugugugu acacacacuauauauaugug acacacacuauauauauguguguauguguguguauauauauagugugugugugugugugugugu KI190464.1:15581..15645:-
RFE_79232_21805 2.6 17 17 0 0 yes blast cggggcggggcggggccgg ggucacugucaucguccugug cggggcggggcggggccgggagcugagggcuuccuucugacggucacugucaucguccugug KI173825.1:2163..2225:-
RFE_94628_25447 2.6 55 55 0 0 yes blast cugggcugggcugggcugggu ccugcuaagucaccagccuggcu cugggcugggcugggcuggguugggaacccucugggcuccugccccaggauuuuccccugcuaagucaccagccuggcu KI181035.1:17896..17975:-
RFE_74623_20621 2.6 21 21 0 0 yes blast ucucccaacccuuguaccagug cugguacagguaugggaggca ucucccaacccuuguaccagugaugugcugcagucccugguacagguaugggaggca KI171247.1:30855..30912:-
RFE_751_232 2.6 12838 12838 0 0 yes blast acccugcucgcugcgcca ggcagccugcggggucu acccugcucgcugcgccacgugucgugcggggcagccugcggggucu KI126843.1:1910..1957:+
RFE_29847_8763 2.6 17708 17708 0 0 yes blast uguguauguguguguauauaug uauccauacacacauauauaua uguguauguguguguauauaugugcgcauauauguauguguguauauauccauacacacauauauaua KI144310.1:11045..11113:-
RFE_109291_28622 2.5 12838 12838 0 0 yes blast acccugcucgcugcgcca ggcggccugcggggucu acccugcucgcugcgccacgugucgugcggggcggccugcggggucu AWHA01229074.1:12693..12740:+
RFE_64725_18134 2.5 90 90 0 0 yes blast cgggcgggcgggcaggcgg gccuccucuuuccgcuccuc gccuccucuuuccgcuccuccacgccggcgccucggagacgggcgcgacuuccgcuuccgggcgggcgggcaggcgg KI164919.1:5976..6053:-
RFE_22929_6773 2.5 61 60 0 1 yes blast cggcggcggcggcggcg cagcugcuggccgcugc cggcggcggcggcggcggggcgccugucccuggccucagcacagcugcuggccgcugc KI140140.1:20081..20139:-
RFE_46486_13169 2.5 13312 13312 0 0 yes blast acccugcucgcugcgcca gggcggccugcggggucu acccugcucgcugcgccaguugucacguggggcggccugcggggucu KI154268.1:2343..2390:-
RFE_35996_10281 2.5 254 249 5 0 yes blast cagcagcacacugugguuugua caaaccacacugugguguuagagcgag cagcagcacacugugguuuguacggcacuguggccacguccaaaccacacugugguguuagagcgag KI148028.1:3139..3206:-
RFE_25444_7552 2.5 121 121 0 0 yes blast ugugugugugugugugugugu acaucuacacauggaugcacacaca acaucuacacauggaugcacacacacacucacaccuuuuguuggcaucugagcucaggcuacugcacucucaugaggguguguguguuugugugugugugugugugugu KI141670.1:9488..9597:+
RFE_3466_1132 2.5 1131 1131 0 0 yes blast uuccuggggcccgcacucuug ggggaguggcccccagagcagg ggggaguggcccccagagcaggccuccacuccaugccuuccuggggcccgcacucuug KI128430.1:13926..13984:-
RFE_36912_10524 2.4 16 16 0 0 yes blast uccuucauuccaccggagucugu agauuucaguggagugaaguuca uccuucauuccaccggagucugucucauacccaaccagauuucaguggagugaaguuca KI148591.1:4700..4759:+
RFE_27396_8093 2.4 406 406 0 0 yes blast cagccuggccccacccucc agagcagggccuugcuggg cagccuggccccacccuccuuagaggcagcacgucuacccucagagcagggccuugcuggg KI142850.1:2246..2307:-
RFE_113505_29481 2.4 18 18 0 0 yes blast acucaaacugugggggcacuu gugccgccaucuuuugaguuu acucaaacugugggggcacuuucuguucugucgaggaaagugccgccaucuuuugaguuu AWHA01235883.1:817..877:-
RFE_41690_11834 2.4 21 21 0 0 yes blast cgcguaccaaaaguaauaauggc cauuauuacucacgguacgaguu cauuauuacucacgguacgaguuugaagugucacagcgcguaccaaaaguaauaauggc KI151451.1:4863..4922:-
RFE_69529_19325 2.4 15 15 0 0 yes blast auauauguauguguguaugugu acguauauacacauauauau acguauauacacauauauauauguauguauauacauacauacauauauauauauauguauguguguaugugu KI167930.1:1003..1075:+
RFE_148086_33774 2.4 30 30 0 0 yes blast uuggaggguggggggug ccccucagccuccuccc ccccucagccuccuccccacgucacccuuauucacagugaauuauuuggaggguggggggug AWHA01278271.1:2524..2586:-
RFE_64930_18206 2.4 40 40 0 0 yes blast ccuccccugcaaacgucca gagaagugaggggugggu gagaagugaggggugggucagcuugcccaguggcgagcagcccuccccugcaaacgucca AWHA01145299.1:5557..5617:-
RFE_128302_32754 2.4 4577 4577 0 0 yes blast ugagugugugugugugagugu gugcgugcgugcaugcuugcg gugcgugcgugcaugcuugcgugugcgugcgggugugcaugugcacgugagugugugugugugagugu AWHA01258377.1:14160..14228:-
RFE_23077_6819 2.4 22 22 0 0 yes blast cggcuccggcuccggcucc aggaggaacuugagcuggc cggcuccggcuccggcuccuuccgggggaggaggaggaggaacuugagcuggc KI140247.1:7017..7070:-
RFE_115444_29900 2.4 14 14 0 0 yes blast cgugguggucagugcgcucu agcucagguucugaccuguaaaac cgugguggucagugcgcucuccugagcucagguucugaccuguaaaac KI190556.1:1359..1407:+
RFE_70016_19432 2.4 207 111 0 96 yes blast uugggccccacccccggagacu uagaccugggguagggccuggg uugggccccacccccggagacugugaaucaguaaguagaccugggguagggccuggg KI168239.1:21218..21275:+
RFE_2013_629 2.4 363 363 0 0 yes blast caagucacuagugguuccguuuag aaaugguacccuagugacuacaa caagucacuagugguuccguuuaguagaugguugugcauuguuucaaaaugguacccuagugacuacaa KI127570.1:8161..8230:-
RFE_98220_26233 2.3 5165 5165 0 0 yes blast uaauacugucugguaaugccg ucuuaccagacacgguuaga ucuuaccagacacgguuagaccuggguccuucugucuaauacugucugguaaugccg KI182724.1:21632..21689:+
RFE_30259_8859 2.3 463 463 0 0 yes blast uugugcuugaucuaaccaugug caugguucugucaagcaccgcg uugugcuugaucuaaccaugugguggaacgauggaaacggaacaugguucugucaagcaccgcg KI144550.1:9540..9604:-
RFE_75797_20905 2.3 23 23 0 0 yes blast uauuccucucccuuccucucu ggggguggggggcacgguucagg uauuccucucccuuccucucucccaccaggcccagugcacaaaggcugggaagggggguggggggcacgguucagg KI171960.1:16080..16156:-
RFE_82748_22683 2.3 14 12 1 1 yes blast ccagcgccccucccuccccauu ccuggggugggaggggca ccagcgccccucccuccccauuccacgugaguucuuucccccaauuccuugagccuggggugggaggggca AWHA01183253.1:7195..7266:-
RFE_14413_4355 2.3 131952 131952 0 0 yes blast uuaaugcuaaucgugauagggguu cuccuacauguuagcauuaaca uuaaugcuaaucgugauagggguuuuuaccuccgacugacuccuacauguuagcauuaaca KI135010.1:6665..6726:-
RFE_99555_26531 2.3 25 25 0 0 yes blast uggagugugacaaugguguuu acgccauuaucacacuaaaua uggagugugacaaugguguuuguguccaaacuaucaaacgccauuaucacacuaaaua AWHA01212638.1:11744..11802:-
RFE_66484_18569 2.3 11 11 0 0 yes blast augaguuugaacugugcagguc ccugcacaguucaaacccaugc augaguuugaacugugcagguccacuuauacugaggggauuuuuuuucaagucagcauguaaguggaccugcacaguucaaacccaugc KI166011.1:64288..64377:-
RFE_58828_16607 2.3 12177 12177 0 0 yes blast auccugccgacuacgcca gggugucaggcggggucu auccugccgacuacgccaaaugcggggugucaggcggggucu AWHA01132164.1:698..740:-
RFE_107996_28396 2.3 13 13 0 0 yes blast ucccugcccuccaggagcuc cagccuggaggggcaggugaaa ucccugcccuccaggagcucacagccuggaggggcaggugaaa KI187264.1:1714..1757:+
RFE_28857_8497 2.3 13097 13097 0 0 yes blast acccugcucgcugcgcca guguggggaguaaugcggggugu acccugcucgcugcgccauguguuguguggggaguaaugcggggugu KI143701.1:14316..14363:-
RFE_48490_13751 2.3 12 7 5 0 yes blast ggagggccuguuaaaac uucuaacaaguucccag ggagggccuguuaaaacacauauugcugagcccuacccccagaguuucugauucaguugguguaggguggggcugagaauuugcauuucuaacaaguucccag KI155441.1:17091..17194:+
RFE_80039_22032 2.3 12 12 0 0 yes blast guagcucagucgguuagag cugggcaacggggcugcca guagcucagucgguuagagcgcaagcucugggcaacggggcugcca KI174241.1:1496..1542:+
RFE_41795_11871 2.2 488 488 0 0 yes blast ugagaacugaauuccauggguug accugugaaauucaguucuucag ugagaacugaauuccauggguugugucagcgucagaccugugaaauucaguucuucag KI151527.1:17946..18004:-
RFE_107249_28242 2.2 13097 13097 0 0 yes blast acccugcucgcugcgcca gcgucaugcggggucu acccugcucgcugcgccaugugucaugcagggcgucaugcggggucu AWHA01225592.1:1124..1171:+
RFE_150798_33990 2.2 2259 2259 0 0 yes blast ucuuugguuaucuagcuguauga auaaagcuagauaaccgaaagua ucuuugguuaucuagcuguaugagugguguggagucuucauaaagcuagauaaccgaaagua AWHA01280983.1:89..151:+
RFE_35955_10260 2.2 97 97 0 0 yes blast caggccaggcugagggacc uuuggggcugggugggg caggccaggcugagggacccugacugagcaggguucaguagaaugugagaaggcuguguguauggguuuggggcugggugggg KI147997.1:13633..13716:+
RFE_107938_28378 2.2 73784 73782 0 2 yes blast caaagaauucuccuuuugggcuu cccaaaggugaauuuuuugggaa caaagaauucuccuuuugggcuuucugaguuuaucuuaagcccaaaggugaauuuuuugggaa KI187235.1:30781..30844:+
RFE_128532_32811 2.2 105 105 0 0 yes blast cagggcugggcugggcuggg cagcaaagcagacaguccugga cagggcugggcugggcuggggguucguacuuuggagagaaucugguaagcagaacuugcagcaaagcagacaguccugga KI195866.1:40240..40320:-
RFE_154888_34313 2.2 12 12 0 0 yes blast uggggcuggcugggggagaag ccuccucuucuagucccaga ccuccucuucuagucccagagccuagaaaggcaaacccacuggggcuggcugggggagaag AWHA01285073.1:5031..5092:+
RFE_13424_4079 2.2 24 24 0 0 yes blast acaggcagggcagggcuc gcagagccagccugggg gcagagccagccuggggacagagggacacaggcagggcagggcuc KI134405.1:5333..5378:+
RFE_46088_13049 2.2 694 694 0 0 yes blast augcaccugggcaaggauuc auccuugcugucugggugcuagu auccuugcugucugggugcuagugcugucucaaugcaaugcaccugggcaaggauuc KI154035.1:14813..14870:+
RFE_34892_10001 2.2 2259 2259 0 0 yes blast ucuuugguuaucuagcuguauga auaaagcuagauaaccgaaagua ucuuugguuaucuagcuguaugaguguauuggucuucauaaagcuagauaaccgaaagua KI147366.1:17910..17970:-
RFE_31286_9148 2.2 51556 51556 0 0 yes blast agcagcauuguacagggcu cuucuuuacagugcugccuug cuucuuuacagugcugccuuguugcauauggaucaagcagcauuguacagggcu KI145188.1:19513..19567:-
RFE_26810_7928 2.2 16 16 0 0 yes blast cugggcugggcugggcuggg cagcuaaguucccagcuuaaaa cugggcugggcugggcugggcuauggaaggggauggccagggacacgcacuucugccuucuuccucccagcuaaguucccagcuuaaaa KI142485.1:2913..3002:+
RFE_34287_9868 2.2 27 27 0 0 yes blast uuaaucugaggguccaggg cuggccccacagaugcgccccaca uuaaucugaggguccagggggucuggcauagaaccuggccccacagaugcgccccaca KI146985.1:4728..4786:+
RFE_30249_8845 2.1 58 58 0 0 yes blast acaguagucugcacauugguu ccaguguuuagacuaucuguuc ccaguguuuagacuaucuguucaggaucccaaauuguacaguagucugcacauugguu KI144542.1:186..244:+
RFE_35526_10148 2.1 12 12 0 0 yes blast aauauaacacagauggccugu agguugucugugaugaguucg agguugucugugaugaguucgcuuuauuaaugacgaauauaacacagauggccugu KI147725.1:13191..13247:-
RFE_22320_6582 2.1 23 23 0 0 yes blast ggaggaggaggaggagg accccucuuaccccga accccucuuaccccgauuucaaguggaggagcgcucccauccuagaaggaggaggaggaggagg KI139765.1:45166..45230:-
RFE_62133_17459 2.1 131 131 0 0 yes blast uuggcaccgugccuggu cagaggcugcccagc uuggcaccgugccugguacacaauaggugcucaguaaaugguuguggcuaccauuuauugcuguuguuguuccagaggcugcccagc AWHA01139243.1:5679..5766:-
RFE_70186_19460 2.1 13778 13778 0 0 yes blast acccugcucgcugcgcca guguaaugcagggucu acccugcucgcugcgccaaguguaaugcagggucu AWHA01157132.1:793..828:+
RFE_90712_24590 2.1 1060 1059 0 1 yes blast ugugcaaauccaugcaaaacuga uuaguuuugcagguuug uuaguuuugcagguuugcauuucagcguauauauguguauauggcugugcaaauccaugcaaaacuga AWHA01197304.1:4167..4235:-
RFE_50969_14426 2.1 53841 47357 0 6484 yes blast cucggcguggcgucggucgugg ucgaccggaccucgaccggcu ucgaccggaccucgaccggcucgucuguguugccaaucgacucggcguggcgucggucgugg AWHA01115401.1:11374..11436:-
RFE_116784_30200 2.1 17708 17708 0 0 yes blast uguguauguguguguauauaug uguauauacacacacacaga uguguauguguguguauauauguauguguguauauguauauacacacacacaga AWHA01241052.1:2170..2224:+
RFE_41420_11771 2.1 375 375 0 0 yes blast ucggauccgucugagcuugg aagcucagagggcucugauu aagcucagagggcucugauucagaaagaucaucggauccgucugagcuugg KI151297.1:3147..3198:+
RFE_43723_12428 2.1 11 11 0 0 yes blast acaagggcugcuccagcu cuggucuggccccagcau cuggucuggccccagcauaccccucuccagggucacagagcccugagcagccugggugaacaagggcugcuccagcu KI152650.1:61114..61191:-
RFE_23501_6922 2.1 40 40 0 0 yes blast uauauauauauauguacguaug uguguacauauauauguaugug uguguacauauauauguaugugugugucauacacacacgugaguauauauauauauguacguaug AWHA01054419.1:6987..7052:-
RFE_73909_20414 2.1 12 12 0 0 yes blast cugggcuggggaggggaggc caucuuuggcuuggau caucuuuggcuuggaucuggcaccaggcaguucugggcuggggaggggaggc KI170783.1:769..821:-
RFE_90712_24586 2.1 2521 2521 0 0 yes blast aauugcacgguauccaucugg ggguggauagcgaugcaauuuu ggguggauagcgaugcaauuuugaucaguauaacaggagaaaaauugcacgguauccaucugg AWHA01197304.1:3877..3940:-
RFE_75732_20884 2.1 14 14 0 0 yes blast ucugaacacgcucccugcccaca cagguggggagcagggcggggg cagguggggagcagggcgggggaauucuucuccucugaacacgcucccugcccaca KI171914.1:7277..7333:-
RFE_7460_2353 2.1 3024 3024 0 0 yes blast ugaccuaugaauugacagccagu uggcugccaauuccauaggucaca ugaccuaugaauugacagccagugcucucguguccccucuggcugccaauuccauaggucaca KI130835.1:4567..4630:-
RFE_20465_6083 2.1 522 522 0 0 yes blast ggggccaggguggggggag guuucuacccaaggaucccag ggggccaggguggggggagguugagccuguuucuacccaaggaucccag KI138669.1:1732..1781:-
RFE_118755_30635 2.1 65 65 0 0 yes blast aaucagggcugugggcauggg cgugggagucugggauguc cgugggagucugggaugucagaaucagggcugugggcauggg AWHA01244193.1:11549..11591:+
RFE_2013_631 2.1 18 18 0 0 yes blast aacuguuugcagaggaaacugaga uccgucuccucugcaaagaagcaa aacuguuugcagaggaaacugagauuuucuagcuauaucuccgucuccucugcaaagaagcaa KI127570.1:9207..9270:-
RFE_3698_1214 2.1 15 15 0 0 yes blast auauauguauguguguaugugu guuuguacaugcauggguguaugu guuuguacaugcauggguguauguguauguauacauuuauacauauauguauguguguaugugu AWHA01008592.1:11483..11547:-
RFE_20618_6135 2.1 136 136 0 0 yes blast uggaagacuagugauuuuguuguu caacaagucacagcuucccca uggaagacuagugauuuuguuguucugauguacgaugacaacaagucacagcuucccca KI138771.1:12220..12279:-
RFE_66487_18572 2.0 17 15 2 0 yes blast cucucucagugucagccug ggcugaggagcuugggggac cucucucagugucagccugguggacauggggguauguauggcuuuggaggugggcauaggggcugaggagcuugggggac KI166014.1:12150..12230:+
RFE_74917_20710 2.0 12 12 0 0 yes blast auggggcccaggaaucugcauu uauagauucccaaguccacgucc uauagauucccaaguccacguccagagauuccagcauguuagcucugggauggggcccaggaaucugcauu KI171421.1:1605..1676:-
RFE_46845_13268 2.0 12 12 0 0 yes blast auggggcccaggaaucugcauu ugcaggguugcaggcuccccaucu ugcaggguugcaggcuccccaucugaggaccugugccagagguccaccauggggcccaggaaucugcauu KI154463.1:33059..33129:-
RFE_25573_7597 2.0 58 58 0 0 yes blast aacccguagauccgaacuuguga acaagcuugugucuacagguaug aacccguagauccgaacuugugaugauagucugcacaagcuugugucuacagguaug KI141748.1:11062..11119:-
RFE_159236_34836 2.0 27 27 0 0 yes blast ucucccuuccucucugu agaggagcaaggggcagc ucucccuuccucucugugcccagaggagcaaggggcagc AWHA01289421.1:7155..7194:+
RFE_35526_10150 2.0 36 36 0 0 yes blast aauguugcucggugaaccccu agguuacccgagcaacuuug agguuacccgagcaacuuugcaucuggacgacgaauguugcucggugaaccccu KI147725.1:13846..13900:-
RFE_15304_4581 2.0 11 11 0 0 yes blast aggacgaggacgaggacga gucaucgucuucaucugag gucaucgucuucaucugaggaagaggacgaggacgaggacga KI135555.1:12387..12429:+
RFE_21724_6369 2.0 12 12 0 0 yes blast aguggcagaguugggauuugaac uuuguccaacucuaaaacucu aguggcagaguugggauuugaaccggguuuuguccaacucuaaaacucu KI139417.1:5366..5415:-
RFE_48980_13874 2.0 44 42 0 2 yes blast cccucucccuuccucucug ggggggggggggggggu cccucucccuuccucucugguaaccacuacacuguuggggggggggggggggggu KI155757.1:421..476:+
RFE_27627_8161 2.0 11 10 1 0 yes blast acccaggacugucacag cugaagauuuccugguugg cugaagauuuccugguuggagggacggccccagggcauggaggaccccagccacccaggacugucacag KI142985.1:10491..10560:+
RFE_116417_30123 2.0 141 141 0 0 yes blast guguauguguguguauauaug cacacaaagacacauauaucu guguauguguguguauauauguguguguguauguccacacacacacacaaagacacauauaucu KI190977.1:16504..16568:-
RFE_39898_11253 2.0 695 695 0 0 yes blast ggcaguagguuguauaguua accacacaaccuacuaccuc ggcaguagguuguauaguuaucuucugagggggcaacaucacugcccugaaaccacacaaccuacuaccuc KI150394.1:8620..8691:-
RFE_44840_12693 2.0 15 15 0 0 yes blast uucaaacccaugcuguucaagg cugaacaauguggauuugaacu cugaacaauguggauuugaacugaguggaccaacuuauaugcaaauuuuaaguggacucaugcaguucaaacccaugcuguucaagg KI153310.1:35893..35980:+
RFE_71209_19694 2.0 153 153 0 0 yes blast cugcugcacuugacugg agcagugcagcaaga cugcugcacuugacuggcauauccuuugcuuguuacacuaauugcaacauccgcugaugacaaugccagcagugcagcaaga KI169028.1:1656..1738:+
RFE_90712_24591 2.0 162 162 0 0 yes blast caaagugcucauagugcagguag uacuguagugugggcacuuccag caaagugcucauagugcagguaguuuuggcauuacucuacuguagugugggcacuuccag AWHA01197304.1:4297..4357:-
RFE_70186_19459 2.0 13778 13778 0 0 yes blast acccugcucgcugcgcca guguaaugcagggucu acccugcucgcugcgccaaguguaaugcagggucu AWHA01157132.1:793..828:+
RFE_155011_34336 1.9 157 56 0 101 yes blast uagcaccauuugaaaucaguguu cugguuucacaugguggcuuagau cugguuucacaugguggcuuagauuuuuccaucuuuguaucuagcaccauuugaaaucaguguu AWHA01285196.1:794..858:+
RFE_18153_5425 1.9 13011 13011 0 0 yes blast acccugcucgcugcgcca acggggugucaugcggggucu acccugcucgcugcgccaugugucaugcaaggacucauacggggugucaugcggggucu KI137306.1:23390..23449:-
RFE_24864_7324 1.9 68 68 0 0 yes blast uuauggcccuucgguaauucacug gugaauucuaccagugccauacac uuauggcccuucgguaauucacugaccgagacuguucacagugaauucuaccagugccauacac KI141324.1:6741..6805:+
RFE_7698_2425 1.9 1915 1194 721 0 yes blast uccugccgacuacgcca cagugucacgcagggga cagugucacgcaggggauccugcucacagcgccaugugucgugcggggugucaugcggggucuccugccgacuacgcca KI130967.1:1..80:-
RFE_91648_24803 1.9 12924 12924 0 0 yes blast acccugcucgcugcgcca gcggggcgacaugcggggguc acccugcucgcugcgccaugugucgugcggggcgacaugcggggguc AWHA01198934.1:15..62:-
RFE_33174_9605 1.9 431 431 0 0 yes blast uucaacggguauuuauugagc ccaauaaaugucuguugaauu ccaauaaaugucuguugaauugagaugcguuacauucaacggguauuuauugagc AWHA01076331.1:10916..10971:+
RFE_75903_20929 1.9 384 384 0 0 yes blast uggcaguguauuguuagcuggu cagcuaacaugcaacugcuauc uggcaguguauuguuagcugguugaauaugugaaugacaucagcuaacaugcaacugcuauc KI172025.1:2065..2127:-
RFE_62911_17686 1.9 956 956 0 0 yes blast uggacggagaacugauaagggc acuuaucacuuuuccagccagc acuuaucacuuuuccagccagcuuugcgacuccaaguguuggacggagaacugauaagggc AWHA01140926.1:8907..8968:-
RFE_10853_3374 1.9 9 9 0 0 yes blast cccgcggcucccgcuccc ggcgggugcugcggggg ggcgggugcugcggggggggcgccccccgcggcucccgcuccc KI132924.1:18295..18338:-
RFE_46207_13077 1.9 13778 13778 0 0 yes blast acccugcucgcugcgcca guguaaugcaggguau acccugcucgcugcgccaaguguaaugcaggguau KI154101.1:19346..19381:-
RFE_25573_7595 1.9 3062674 3062671 0 3 yes blast ugagguaguagguuguauaguu uacagccuccuagcuuuccu ugagguaguagguuguauaguucagaagugcaucaagggagauaacuguacagccuccuagcuuuccu KI141748.1:5751..5819:-
RFE_34048_9817 1.9 735 735 0 0 yes blast aguagugggaucgcgccug ggucaaagaucccgugcugg ggucaaagaucccgugcuggucaguagugggaucgcgccug KI146860.1:16125..16166:+
RFE_25565_7590 1.8 107 107 0 0 yes blast ugugugugugugugugugugu auauacacacauauauaugua ugugugugugugugugugugucuguauauacacacauauauaugua AWHA01059158.1:23206..23252:+
RFE_61228_17212 1.8 12 12 0 0 yes blast cucucccuuccucucug gagaggauaauggcgac gagaggauaauggcgacugaccaggaugggauuauuaaucucucgcuucccuuuccugucucccucucucccuuccucucug KI162834.1:16164..16246:-
RFE_41805_11873 1.8 25345 12119 13226 0 yes blast auccugccgacuacgcca auguagugcgggagac auguagugcgggagacccugcucgcugcgccaggugucgugcaggggauccugccgacuacgcca AWHA01095569.1:12..77:-
RFE_11639_3574 1.8 57 57 0 0 yes blast aucgaggcuagagucacgcuu gugugcuagaguccucgaaga aucgaggcuagagucacgcuuggguaucaacuauugccuuagugugcuagaguccucgaaga KI133380.1:26565..26627:+
RFE_90712_24595 1.8 356 356 0 0 yes blast aaaagugcuuacagugcagguag acugcaaugcaagcacuucuuac aaaagugcuuacagugcagguagcuuuuugagaucuacugcaaugcaagcacuucuuac AWHA01197304.1:4703..4762:-
RFE_116586_30148 1.8 1118091 1118089 2 0 yes blast aucccggacgagccccca gguguaggccgggauca aucccggacgagcccccagaugauguagaugauguuggaucugcuggcaguuucuggguguaggccgggauca KI191050.1:5955..6028:+
RFE_120311_30986 1.8 12158 12158 0 0 yes blast auccugccgacuacgcca gcgugcagggucc auccugccgacuacgccaagcgucaugcaggacggcgugcagggucc AWHA01246618.1:20655..20702:+
RFE_29768_8737 1.8 2297 2297 0 0 yes blast ugaggggcagagggcgagaa cucaagaggcccucucugcucagu cucaagaggcccucucugcucagucgagaacuuagagcugagugcaaagcaugaggggcagagggcgagaa KI144246.1:10929..11000:+
RFE_160428_35063 1.7 2411341 2411324 0 17 yes blast aacauucauugcugucgguggg cucacugaucaaugaaugaa aacauucauugcugucgguggguuugagucugaaucaacucacugaucaaugaaugaa AWHA01290613.1:11095..11153:-
RFE_74278_20500 1.7 51561 51556 1 4 yes blast agcagcauuguacagggcu agcuucuuuacagugcugccuug agcuucuuuacagugcugccuuguagcauucaggucaagcagcauuguacagggcu KI171025.1:21379..21435:-
RFE_80379_22153 1.7 216 216 0 0 yes blast ggggguaaaaaaaaaaaaaa uuuuuuuuuucccccccccc ggggguaaaaaaaaaaaaaauuuuuuuggguuuuuuuuuuuucccccccccc KI174406.1:24299..24351:-
RFE_110009_28776 1.7 80 80 0 0 yes blast gcccaagaagcaggccaaggaga ucaguggcagggucuggggaa ucaguggcagggucuggggaaggggcggccagaaggagccccugaagcagcccaagaagcaggccaaggaga AWHA01230251.1:2815..2887:-
RFE_41697_11837 1.7 14 14 0 0 yes blast ugccccccucccuccacagg ugccugggcggggcaga ugccccccucccuccacaggccaauacaaaaugagacccccucuuaccuggaggccgggagccucgccugccugggcggggcaga KI151457.1:940..1025:-
RFE_68048_18949 1.7 11 11 0 0 yes blast cccgccucccccgcccccc caggcggggggggcgggcu caggcggggggggcgggcucggcccgccucccccgcccccc KI167005.1:5382..5423:+
RFE_6086_1927 1.7 10 9 0 1 yes blast gggugggggugggggggugg ucccuuccccuccccca ggguggggguggggggguggccucuucccuuccccuccccca KI130028.1:12048..12090:-
RFE_8928_2759 1.7 19 19 0 0 yes blast uuagcucaguugguagagc gguacuaauaacaccaagcuugcc uuagcucaguugguagagcaugguacuaauaacaccaagcuugcc KI131745.1:3553..3598:-
RFE_48493_13754 1.6 81 81 0 0 yes blast uggcugugucugagcacc agcuccaggaccagcucagc uggcugugucugagcaccucccggagaaguuggacacaggagcuccaggaccagcucagc KI155442.1:2295..2355:+
RFE_160407_35053 1.6 40025 40022 0 3 yes blast agcagcauuguacagggcu agcuucuuuacaguguugccuug agcuucuuuacaguguugccuuguggcauggaguucaagcagcauuguacagggcu AWHA01290592.1:1689..1745:+
RFE_42358_12022 1.6 2393132 2393120 0 12 yes blast aacauucauugcugucgguggg cucacugaacaaugaaugca aacauucauugcugucgguggguugaacuguguggacaagcucacugaacaaugaaugca KI151850.1:14743..14803:+
RFE_22458_6626 1.6 12 12 0 0 yes blast uuuugcgauguguuccuaauau auugggagcauuuugcaugcau uuuugcgauguguuccuaauauguaauauaaauauauugggagcauuuugcaugcau KI139862.1:8985..9042:+
RFE_60292_16983 1.6 20 20 0 0 yes blast uucaaacccaugcuguucaagg cugaacaauguggguuucaacu cugaacaauguggguuucaacugcacgcaauucaaacccaugcuguucaagg KI162299.1:51210..51262:+
RFE_35001_10033 1.6 1869 1869 0 0 yes blast gggagagaacgcagucugagugg auuggugaucauucuucucuuccuu auuggugaucauucuucucuuccuuugggagaguaagagggagagaacgcagucugagugg KI147414.1:15231..15292:+
RFE_13294_4049 1.6 13042 13042 0 0 yes blast acccugcucgcugcgcca gggcagccgguggggucu acccugcucgcugcgccauuugucacgcggggcagccgguggggucu KI134332.1:11..58:-
RFE_22458_6624 1.5 12 12 0 0 yes blast uuuugcgauguguuccuaauau auugggaacauuuugcauucau uuuugcgauguguuccuaauauguaauauaaauguauugggaacauuuugcauucau KI139862.1:8851..8908:+
RFE_73233_20269 1.5 764 764 0 0 yes blast ugagugugugugugugagu gagcauacacauuuucaag ugagugugugugugugaguaugacuguguguauguguguguacacaugugcgcaugcaggagcauacacauuuucaag KI170376.1:33321..33399:-
RFE_62669_17607 1.5 49 48 1 0 yes blast ugaguguguguguguga acacucgugcacuuaug ugagugugugugugugaauguguucaaguaaacaggugcuugugugugaguguguguguguguaacuaugcacacucgugcacuuaug AWHA01140371.1:6219..6307:-
RFE_60188_16965 1.5 13312 13312 0 0 yes blast acccugcucgcugcgcca gggcggccuguggggucu acccugcucgcugcgccaguugucacguggggcggccuguggggucu AWHA01135117.1:3..50:-
RFE_35479_10135 1.5 586 586 0 0 yes blast gcccagugcucugaauguc cauucagagcagaaucugguaaa gcccagugcucugaaugucccccuuuucauguuuucaagggcucuuuggcucuuggcauucagagcagaaucugguaaa KI147696.1:44857..44936:-
RFE_61462_17280 1.5 64 64 0 0 yes blast ggaauccccaaagcagcua gccggggaaauuauuccaa ggaauccccaaagcagcuaaaaauagccggggaaauuauuccaa KI162984.1:4174..4218:+
RFE_80228_22090 1.5 rRNA 12 10 0 2 yes blast gucuauggccauaccacccug ugggcugggguuagacc gucuauggccauaccacccugaaugcaccugaucucuucugaucuuggaagcuaagcaggguugggcugggguuagacc AWHA01178687.1:580..659:+
RFE_133_53 1.5 56 56 0 0 yes blast gagagcuuguuuggagguu uguccauauagguucuucaa uguccauauagguucuucaagaauuuucucaauuaugguuugggaccuugagagcuuguuuggagguu KI126507.1:33677..33745:+
RFE_64207_18018 1.5 38685 38685 0 0 yes blast gggagaggacgcagucugagugau caaugauuguucucuuccug caaugauuguucucuuccugggagaauaagagggagaggacgcagucugagugau KI164624.1:5599..5654:-
RFE_92060_24869 1.4 rRNA 187 183 0 4 yes blast aaaaaaaaaaaaaaaaaaaaa uuuuuuuuuuuuuuuuuuu uuuuuuuuuuuuuuuuuuuggaaaauuuuaaaaaaaaaaaaaaaaaaaaa KI179809.1:16340..16390:+
RFE_3588_1179 1.4 23 23 0 0 yes blast ggcagcggcaguggugucug guaugacugcauaacugccau guaugacugcauaacugccaucaauaauaaccguggcagcggcaguggugucug KI128490.1:1286..1340:+
RFE_50087_14206 1.4 61 59 2 0 yes blast ugugugugugugugugugu acauauguuauauauauaug acauauguuauauauauauguauguguguguguauguauaugugugugugugugugugu KI156394.1:6142..6201:-
RFE_36071_10307 1.4 9 9 0 0 yes blast accugggguagggccugggg ugagguaggaccugggguag ugagguaggaccugggguagggccugggguagggccugagguaggaccugggguagggccugggg KI148071.1:7957..8022:+
RFE_17628_5309 1.4 24347 24347 0 0 yes blast ucccuguucgggcgcca guguccuucaccgaguccacu guguccuucaccgaguccacuguuucaagucccuguucgggcgcca AWHA01041030.1:109..155:+
RFE_112715_29342 1.4 13780 13780 0 0 yes blast acccugcucgcugcgcca ggcggccugcagggucu acccugcucgcugcgccaagugucacacagggcggccugcagggucu KI189388.1:24678..24725:+
RFE_79721_21940 1.4 177 175 2 0 yes blast ugugugugugugugugugugu ccgcgcgugcgugcaugcgua ccgcgcgugcgugcaugcguaugcguaugcgugugugugugugugugugugugu KI174087.1:16618..16672:-
RFE_6140_1963 1.4 10 10 0 0 yes blast gccagggcugcagucaucug cauggcuguuggcag gccagggcugcagucaucuggagacuugacuggggcuggagcauccauucccagcucacucccauggcuguuggcag KI130068.1:84424..84501:-
RFE_2691_873 1.3 750 750 0 0 yes blast ccccacguugggcgcca gucccaaaauggggcc gucccaaaauggggccccagaauugggccccacguugggcgcca AWHA01006279.1:364..408:+
RFE_19958_5950 1.2 6542 6507 0 35 yes blast ucagugcaucacagaacuuugucu gaaguucuguuauacacucaggcu gaaguucuguuauacacucaggcuguggcucucugaaagucagugcaucacagaacuuugucu KI138369.1:25132..25195:-
RFE_51192_14502 1.2 21376 21376 0 0 yes blast aucccacuccugacacca guuucaggggaugccaauuca guuucaggggaugccaauucaugaaggugaggccacuuuagaucccacuccugacacca KI157044.1:3042..3101:-
RFE_16814_5105 1.2 25 24 0 1 yes blast gagcacuguucgugaccuguu uuccauuccagugccacag gagcacuguucgugaccuguuaaucuggcuauggcuaacagguuccauuccagugccacag KI136489.1:4815..4876:-
RFE_11835_3624 1.2 438 438 0 0 yes blast uccuggacgagccccca uggguauccaggugu uccuggacgagcccccaaauaauguggguauccaggugu KI133483.1:15285..15324:+
RFE_94963_25518 1.2 12092 12092 0 0 yes blast auccugccgacuacgcca ugauugucaugcaggagau ugauugucaugcaggagauccugcuggggauccugccgacuacgcca KI181204.1:19..66:-
RFE_30352_8894 1.1 48 48 0 0 yes blast ugugugugugugugugugu acacacacacauauaugua acacacacacauauauguacaugugugugugugugugugu KI144624.1:1639..1679:+
RFE_49970_14159 1.1 4452 4443 1 8 yes blast uagcagcacauaaugguuug caggccauauugugcugcc uagcagcacauaaugguuuguggguuuugaaaaggugcaggccauauugugcugcc KI156316.1:3360..3416:-
RFE_146150_33641 1.1 10992 10992 0 0 yes blast cuacugcauuugacuag ggucauaaugacgggcuuu cuacugcauuugacuagauguuaaauaucuggucauaaugacgggcuuu AWHA01276335.1:344..393:-
RFE_48141_13609 1.1 17708 17708 0 0 yes blast uguguauguguguguauauaug uauauauauacuuaauuauaua uguguauguguguguauauauguauauuuauauauauauacuuaauuauaua AWHA01109292.1:665..717:-
RFE_12067_3690 1.1 72 72 0 0 yes blast auuuccagaggauggggcccag uggccaucagaauccuuugggagagc uggccaucagaauccuuugggagagcuuaauaaaaaugcagauuuccaagcugcacaucagaauuuccagaggauggggcccag KI133636.1:62315..62399:-
RFE_14481_4371 1.0 10 10 0 0 yes blast caggacccaggacccaggaccca ggaccugaaaccuagggcccagg ggaccugaaaccuagggcccaggaccaggacccaggacccaggaccca KI135063.1:28921..28969:+
RFE_55968_15840 0.9 15 15 0 0 yes blast uucuggaggcucugagagaga uugucuuuuccgagcuucucuuggu uucuggaggcucugagagagaauauuuucuugucuuuuccgagcuucucuuggu KI159829.1:14199..14253:+
RFE_11063_3425 0.9 64 64 0 0 yes blast uuugggggcucguccgggauug ugcccaccuaugggccuucaucau uuugggggcucguccgggauugaaggagaggucaauauuauuugugccuuucuacuugcccaccuaugggccuucaucau KI133023.1:3380..3460:-
RFE_47630_13462 0.9 rRNA 1037 1037 0 0 yes blast ccugguuaguacuuggaug ucuuggaagcuaagcagggu ucuuggaagcuaagcaggguugggccugguuaguacuuggaug KI154934.1:8333..8376:+
RFE_28600_8440 0.9 8 8 0 0 yes blast gguagcucaguugguuagagu ucuggacaacggggcugccag gguagcucaguugguuagagugcgagcucuggacaacggggcugccag KI143552.1:25859..25907:+
RFE_160319_35039 0.9 10 10 0 0 yes blast accgaugagagucugaggagc uguggaagcucuucaucggagg uguggaagcucuucaucggagguuugggccuuaaaacaaccgaugagagucugaggagc AWHA01290504.1:17890..17949:+
RFE_10959_3393 0.9 17 17 0 0 yes blast ccuuuugacuuggaucaag ugaggccaacaaauuggcu ccuuuugacuuggaucaagaaugaggccaacaaauuggcu KI132967.1:16497..16537:-
RFE_35467_10127 0.9 77 77 0 0 yes blast cuggagguuagaagucugaga ugaggcuucucuccuuug cuggagguuagaagucugagaucaagagguuggcagcguugauuucuucugaggcuucucuccuuug AWHA01081468.1:2728..2795:-
RFE_16617_5045 0.9 14 14 0 0 yes blast ggacagugccaggugggga cacuacacuguacuccug ggacagugccagguggggacuagauuuaugggguggggggaucacuucguaagguauaugaaugucuagccacuacacuguacuccug KI136379.1:12337..12425:-
RFE_86858_23674 0.9 226 211 0 15 yes blast cagugcaauaguauugucaaagc gcucugacuuuauugcacuacu gcucugacuuuauugcacuacuguacuuuacagcuagcagugcaauaguauugucaaagc KI177406.1:15840..15900:-
RFE_37581_10706 0.9 25 24 1 0 yes blast acaggcagggcagggcuc gcccacaucccucugccugcga gcccacaucccucugccugcgaggacccuguuucuuucuuuauucuuugcacaggcagggcagggcuc KI148962.1:26992..27060:-
RFE_126778_32366 0.9 998 998 0 0 yes blast cacuagauugugaacuccuga agcacuucucacaaucugccuug agcacuucucacaaucugccuuguauuaacauuauguuaauaggcaucucuuuuacacuagauugugaacuccuga KI195264.1:4292..4368:-
RFE_9979_3064 0.9 16 16 0 0 yes blast gaacuugacuaucuagaggaa ucucagauaaucaaucaucac gaacuugacuaucuagaggaauuuucuugggauuucaucaauuauuucucagauaaucaaucaucac AWHA01023308.1:10059..10126:+
RFE_84395_23060 0.8 8 8 0 0 yes blast uggggcaggggcaggggcagg ggccugaacccugaacccagg ggccugaacccugaacccaggcaggccuggggcaggggcaggggcagg KI176270.1:16141..16189:-
RFE_135219_33091 0.8 70 70 0 0 yes blast auuugggggcucguccgggau cccaccuacgggccuucaucagu auuugggggcucguccgggauugaaagagagguaaauauuaucuguaccuuucuacuugcccaccuacgggccuucaucagu AWHA01265404.1:1087..1169:-
RFE_116417_30124 0.8 141 141 0 0 yes blast guguauguguguguauauaug uaauacauacauauauauau uaauacauacauauauauauguguggggggggggggguguauguguguguauauaug KI190977.1:16547..16604:-
RFE_99035_26425 0.8 12 12 0 0 yes blast gcggcgguggcggcggc cgucgcgcaugugcuaaccg gcggcgguggcggcggcagcccggaccguggaggcuaguggaaguagaggaaaagggagcagagccgucgcgcaugugcuaaccg KI183114.1:765..850:-
RFE_63237_17763 0.8 45 44 0 1 yes blast ccugcauguuagucuuagguucu ugacuggugugcagacacuu ccugcauguuagucuuagguucugauggaaaugacaugcaauugugcugccauuuuuuacuauaggacuugacuggugugcagacacuu KI164049.1:39455..39544:-
RFE_156317_34463 0.8 12 12 0 0 yes blast auaauggacaacucuca agagaugucuaauuu auaauggacaacucucaacucagcagagaugucuaauuu AWHA01286502.1:6340..6379:-
RFE_159891_34925 0.8 12 12 0 0 yes blast gaagaugaagaagaagaugaug uccuuucuccuuccucuuccu uccuuucuccuuccucuuccucgcgcuuucuggggacaguagugaugaagaugaagaagaagaugaug AWHA01290076.1:3285..3353:+
RFE_23457_6906 0.8 95 95 0 0 yes blast cugguuaguacuuggau ccuucauuaacacaacu cugguuaguacuuggauaggagaaauauuaaaauuugcuucuuuccuucauuaacacaacu KI140455.1:15333..15394:+
RFE_108369_28459 0.8 102 102 0 0 yes blast cugcacaguagaaucaccuggg ugggugucagucucucugagcc ugggugucagucucucugagccuaaaaggaggcaacugaaaauaaauuucaggcauucuccuuccuugcugcacaguagaaucaccuggg KI187439.1:697..787:+
RFE_88553_24066 0.8 30 30 0 0 yes blast ggagguuagaagucugaga ucagcagggcuucuaucuucuga ggagguuagaagucugagaucaaggugucagcagggcuucuaucuucuga KI178218.1:4389..4439:+
RFE_73585_20354 0.8 5025 5025 0 0 yes blast ugagugugugugugugagugu acgugugcauauauuuaug ugagugugugugugugagugugagugcauguaucgcucgggugugugugcacgugugcauauauuuaug KI170596.1:6137..6206:+
RFE_59441_16750 0.8 9 9 0 0 yes blast caggcuggguggggugggg uggccuuguaucccagccugac uggccuuguaucccagccugaccacuuuaucaggcuggguggggugggg KI161807.1:1849..1898:-
RFE_80519_22197 0.8 6232 6232 0 0 yes blast cuccuggcuggcucgcca cacagccaacccgggauuu cacagccaacccgggauuuccccuauggaugccuuuuucccaaggcccauuucuugggucuccuggcuggcucgcca AWHA01179226.1:8951..9028:+
RFE_79792_21985 0.8 11 10 1 0 yes blast uauauauauauauguacguau auguacauguauguauaaaac uauauauauauauguacguauauauguauguauguauguacauguauguauaaaac AWHA01177897.1:9424..9480:-
RFE_110009_28778 0.8 9 9 0 0 yes blast ugggggaggggacggggga ccugacucccugcagacuucaga ccugacucccugcagacuucagaaggugggggaggggacggggga AWHA01230251.1:8442..8487:-
RFE_93934_25302 0.7 8 8 0 0 yes blast ugggccggggcuggggc cccugccacggccaga ugggccggggcuggggcucagaccaggagggggagcucccugccacggccaga KI180711.1:851..904:+
RFE_6090_1929 0.7 69 69 0 0 yes blast acggagcucacagucuacugag caagagaccuacuguguaguucucuga caagagaccuacuguguaguucucugauucccagggcugcaaagcuccugaccucacggagcucacagucuacugag KI130031.1:17590..17667:+
RFE_92879_25065 0.7 345 345 0 0 yes blast ugagugugugugugugag cauauacacaucuuuauu cauauacacaucuuuauuuuaugccuauccaucuacauauacagguauauauguaugugugugagugugugugugugag KI180195.1:2648..2727:+
RFE_15490_4650 0.7 10 10 0 0 yes blast acggauguuugagcaugugcu uaaaacgcucagaccccuggggugg uaaaacgcucagaccccugggguggcugcuuauguaccacggauguuugagcaugugcu KI135653.1:31498..31557:-
RFE_30909_9045 0.7 15 15 0 0 yes blast uucuggaggcucugagagaga ucucuuaccuucuaguagcu uucuggaggcucugagagagaauccauuccaggcuuuucucuuaccuucuaguagcu AWHA01071227.1:2364..2421:-
RFE_95661_25682 0.7 849 849 0 0 yes blast auuuauuuuuggagcagggaga uuucuggagagaaacagaaggu uuucuggagagaaacagaagguaccgccacuggcuacauuuauuuuuggagcagggaga KI181535.1:5932..5991:-
RFE_18330_5480 0.7 15 15 0 0 yes blast guaugugugugucuauaug gggggauacacacacacac guaugugugugucuauauguauguaugaacacagggggauacacacacacac KI137394.1:41014..41066:+
RFE_9854_3020 0.6 8 8 0 0 yes blast gguagcucaguugguuagagu ucugggcaacaggguugcugg gguagcucaguugguuagagugugagcucugggcaacaggguugcugg AWHA01023035.1:10628..10676:+
RFE_44743_12673 0.6 9 9 0 0 yes blast ucuuggacggugggaccucuucaga uagagagguucuauuugucccuuuuu ucuuggacggugggaccucuucagagaagaucuauuaagguagguucuuuagagagguucuauuugucccuuuuu KI153246.1:19766..19841:-
RFE_46442_13144 0.6 11 11 0 0 yes blast aaacugcggcucgcgggcca gcccgcaauccccccuuaauugg aaacugcggcucgcgggccaacugcggcccgcaauccccccuuaauugg KI154240.1:6661..6710:+
RFE_79721_21939 0.6 194 192 2 0 yes blast ugugugugugugugugugugu ccgcgcgugcgugcaugcgua ccgcgcgugcgugcaugcguaugcguaugcgugugugugugugugugugugugu KI174087.1:16618..16672:-
RFE_33885_9787 0.5 12 11 0 1 no blast cucuuccugggcaggggcauc guucccgcugucccacug guucccgcugucccacuggaaagugugcucuuccugggcaggggcauc KI146761.1:354..402:+
RFE_94742_25466 0.5 8 8 0 0 yes blast uggggugggugugggcuggg uaugcccccaucccccacccccuu uggggugggugugggcugggugagaccuaugcccccaucccccacccccuu KI181092.1:3882..3933:+
RFE_41194_11703 0.4 118 118 0 0 yes blast uuguggaaggucugauu ucaccuucucauugaau ucaccuucucauugaauggcagcccaucccuggucuaacauuuguggaaggucugauu AWHA01094201.1:1286..1344:+
RFE_92_33 0.4 298 298 0 0 yes blast aaaaaaaaaaaaaaaaaaaaaa uuuguuuuuuuuuuuuuuag uuuguuuuuuuuuuuuuuagcaucaggugucuuuccucacuggaaaugguucuggugguaaaaaaaaaaaaaaaaaaaaaa KI126472.1:57406..57487:+
RFE_6058_1912 0.4 19 19 0 0 yes blast gagggacugggggcgggggg uucugagcaagucaggcca gagggacugggggcggggggcacuguggagacauugcaggcucuucugagcaagucaggcca KI130002.1:26705..26767:+
RFE_6455_2060 0.3 14 14 0 0 yes blast gguuaggguuaggguuagggc uuuaauuuuauauuuaaaguu uuuaauuuuauauuuaaaguuaggguuaguauuaauuuaguuuagcguuaggguuaggguuaggguuagggc KI130242.1:4064..4136:-
RFE_126322_32259 0.3 80 80 0 0 yes blast ugaguguguguaugugagugugugu auguacuagggugccaaaaaaaaugua auguacuagggugccaaaaaaaauguauacauuuuuguauaugaguguguguaugugagugugugu AWHA01255607.1:13014..13080:+
RFE_6878_2141 0.3 375 375 0 0 yes blast ggggguaaaaaaaaaaaaaaaaaa uuuuuuuuauuuuuuuuuucagu uuuuuuuuauuuuuuuuuucaguuuugggggggcggggguaaaaaaaaaaaaaaaaaa KI130466.1:866..924:+
RFE_110768_28942 0.3 10 10 0 0 yes blast uugagaaccacugaucuagu uggaagcagucucaaaa uugagaaccacugaucuaguagagcaauuacucuggaagcagucucaaaa AWHA01231469.1:3224..3274:+
RFE_5751_1833 0.3 26 26 0 0 yes blast ggaggaggaggaggagg uucuuuucuucuuucuu ggaggaggaggaggaggauuuaugcuucuucuuuucuucuuucuu KI129798.1:64287..64332:-
RFE_51001_14440 0.3 16 16 0 0 yes blast guguguguguguggguaug uauguacacauacauauag uauguacacauacauauagguaugcacguguguguguguguggguaug KI156933.1:3638..3686:-
RFE_92918_25080 0.3 7 7 0 0 yes blast ccccugccccugccccugccc gcagggggcugagagggccaggaacg gcagggggcugagagggccaggaacgguguccccugccccugccccugccc KI180216.1:2871..2922:-
RFE_11033_3417 0.2 8 8 0 0 yes blast aggacacggggggggggggg cccugcccccuuacucuugu cccugcccccuuacucuuguucaagcuguugauuuucaguccaguuguguaggacacggggggggggggg KI133005.1:1899..1969:+
RFE_73376_20302 0.2 10 10 0 0 yes blast ugggggaggggacggggga ccuuggcgugcuuuggg ccuuggcgugcuuuggggagccugggggaggggacggggga KI170468.1:30966..31007:-
RFE_65311_18301 0.2 11 11 0 0 yes blast uagagcagggaucagcaaacu uuugcaaauccuugcuauuuu uuugcaaauccuugcuauuuucugugcaucugaaguuuucuguuacuagaacauuuuuuguucauaacguagagcagggaucagcaaacu KI165296.1:37126..37216:+
RFE_53835_15257 0.2 51 27 24 0 yes blast uuucucucucugugccucu aagcccugggagaagauca aagcccugggagaagaucagaaaagagaagacaggcuagagugucucucucucucucucucucuuucucucucugugccucu KI158574.1:9109..9191:+
RFE_67646_18859 0.1 32 24 0 8 yes blast aagggggaaaaaaaaaaaaaaaa uuuuuuuuuuuuuuuuuuuuuuu uuuuuuuuuuuuuuuuuuuuuuuaaaagggggaaaaaaaaaaaaaaaa AWHA01151414.1:41523..41571:+
RFE_47476_13419 0.1 7 7 0 0 yes blast aguggcucaguugguugga ugggcaacagggcugccgg aguggcucaguugguuggagcgcaagcucugggcaacagggcugccgg AWHA01107873.1:4126..4174:-
RFE_112652_29326 0.1 8 6 0 2 yes blast accaccauuugaucuauuuuug aauuaaaucaaauggua accaccauuugaucuauuuuugauuaaaauguaaaaauuaaaaauuaaaucaaauggua AWHA01234535.1:2204..2263:+
RFE_127188_32455 0.1 3451 3451 0 0 yes blast gcauuugacuaggcucuuu auagccugguuuugggcuu auagccugguuuugggcuuaggaaauaugguuaucuuauugaugugccaggcauuugacuaggcucuuu KI195416.1:7894..7963:+
RFE_23591_6942 0.1 8 8 0 0 yes blast uccgccaccgccaccgccaccgc gcaccugguccggaggggagc uccgccaccgccaccgccaccgccugaggucauacccaggcaccugguccggaggggagc KI140536.1:174..234:+
RFE_41420_11774 0.1 7 7 0 0 yes blast ucuuggaguaggucauugggu uggauggcuccuccaugucu ucuuggaguaggucauuggguggauccuuuauuucccuaugugggccacuggauggcuccuccaugucu KI151297.1:4633..4702:+
RFE_17927_5374 0.1 8 8 0 0 yes blast gugugcgugcgugugugagug cgugcaugugugugcaugcau cgugcaugugugugcaugcaugugugugauugugugcgugcgugugugagug KI137151.1:29419..29471:-
RFE_4435_1417 0.1 10 10 0 0 yes blast cacagacuguguggugaugagaga uuugaaacaaccaauaagagucugaggag uuugaaacaaccaauaagagucugaggagccauucuaagcaauggggaugcucacagacuguguggugaugagaga KI128990.1:5606..5682:+
RFE_122887_31517 0.1 7 7 0 0 yes blast cccagggcuguggccucccc ggaagcacagcaggcc ggaagcacagcaggccugccagcgcccgagacugugugaagccaaggcccagggcuguggccucccc AWHA01250608.1:14583..14650:+
RFE_84893_23162 0 7 5 0 2 no blast acucacucucucucuuucu cggggggggggggggggggg acucacucucucucuuucuacacacacacggggggggggggggggggg KI176503.1:28786..28834:+
RFE_9601_2947 0 9 7 2 0 yes blast cuccuccuccuccuccu guggggagcauggaagc cuccuccuccuccuccugcggaaaccuucucucuaacccggguggggagcauggaagc KI132142.1:654..712:-
RFE_34293_9874 0 7 5 0 2 yes blast gcuggccccggcuccuccuc gcccugggcugugagcug gcccugggcugugagcuggccccacacagccgcuggccccggcuccuccuc KI146989.1:2081..2132:-
RFE_83475_22857 0 10 10 0 0 yes blast gcccaagaagcaggccaag uggcaugguauggggaa uggcaugguauggggaagggguaguagcaagaagcucccuaaacagcccaagaagcaggccaag KI175858.1:28481..28545:+
RFE_4352_1394 0 36 36 0 0 no blast uaggucgcugguucgauucc gguuacccugguggcucagg gguuacccugguggcucagguauuuggagugcugugcuccuaaugccuaggucgcugguucgauucc KI128954.1:771..838:-
RFE_16538_4988 0 7 7 0 0 yes blast gccagccagcccgccagcc cauugcgagcuguuggacgg cauugcgagcuguuggacgggcaccacacaccucccgccagccagcccgccagcc KI136311.1:7426..7481:-
RFE_97121_25953 0 9 9 0 0 yes blast agggaaagguugggggaggg cucccccuuuccggcgauuuuu cucccccuuuccggcgauuuuucgucucucaaaaaggaaaaaaaagaggagggggaagggaaagguugggggaggg KI182211.1:16854..16930:+
RFE_20090_6012 0 7 7 0 0 yes blast gccagcguugggccccag ugggcccaaugcagaggg ugggcccaaugcagagggugacuccuccacggggcauggccagcguugggccccag KI138462.1:1580..1636:-
RFE_8176_2561 0 64 64 0 0 yes blast uuugggggcucguccggga ccaccuaugggccuuccucau uuugggggcucguccgggauugaaggagagguaaauauuaucugugccuuucuacuugcccaccuaugggccuuccucau KI131283.1:79099..79179:-