FastQCFastQC Report
Tue 9 Feb 2016
mono6_n6_can.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamemono6_n6_can.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13573620
Sequences flagged as poor quality0
Sequence length20-321
%GC51

[FAIL]Per base sequence quality

Per base quality graph

[WARN]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GATAACGAACGAGACTCTGGCATGCTAACTAGTTACGCGACCCCCGAGCG433240.319177934847152No Hit
GACCATAAACGATGCCGACCGGCGATGCGGCGGCGTTATTCCCATGACCC316640.2332760162727408No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTAATA7601.236449E-666460.01300-304
GCGTAAT7358.094624E-59817.223295-299
AGCGTAA12801.5898333E-46963.6406295-299
CGCTACG24502.826563E-45154.0415285-289
AAAATCT140454.2224774E-43596.2695300-304
GGGCAGC495650.03057.174305
GTACTAG15258.760174E-43011.005285-289
AATAGCG108458.391244E-42794.4458295-299
GCTACGG23950.00103529682750.818285-289
ATTAGCA48000.0010848362630.7087285-289
GATGCAA113050.00136765132233.9502290-294
AAATCTG143250.00146398472115.5857300-304
CTACGCT17400.00195020092025.2449275-279
TCGACTA9450.0020639321979.6045270-274
AGTACTA35700.00230008081845.437285-289
AGTCGAT10250.00242810461825.0989270-274
AGAACCT148600.00236289651699.5159290-294
AAGTACT75100.0026552761681.4119285-289
ATAGCGT105400.00285280521597.3945295-299
GTCATAG35500.00315517651580.8955280-284