FastQCFastQC Report
Mon 21 Nov 2016
N2_24h_RVFV_RNA.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameN2_24h_RVFV_RNA.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences68564186
Sequences flagged as poor quality0
Sequence length51
%GC54

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA2905340.4237401724567984No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG2864930.4178464249542757No Hit
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG1936660.28245941693233256No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG1687590.2461328717590259No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT1533350.2236371624101247No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT1360800.19847096266846953No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG1350630.1969876810030239No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT1338770.19525791497036077No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC1313160.1915227287902171No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT1176970.17165958916219032No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA1125450.1641454621805034No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA1114070.16248570354207953No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG1106570.16139183800709017No Hit
GGCGTACGGAAGACCCGCTCCCCGGCGCCGCTCGTGGGGGGCCCAAGTCCT1106360.1613612097721105No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC1006630.14681571513151195No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG976710.14245192089059439No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAG955660.13938180495572428No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAA950260.13859422177053193No Hit
GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGG940440.13716198716338585No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCC911410.13292799829928703No Hit
GGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGAC906350.1321900036850142No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGC898420.13103342319268546No Hit
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCG886990.12936637211736168No Hit
GTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATT875420.12767890221871808No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCG869230.1267760985305069No Hit
GCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCAC864470.12608185853763362No Hit
CTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCCC863510.12594184374915499No Hit
GCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTC862940.1258587099684958No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAAC856780.12496028174242453No Hit
CTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAG850640.12406477049111324No Hit
TGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCA848830.12380078427533582No Hit
GTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTC838660.12231750260989024No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTC834420.12169910396077625No Hit
GGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAA808600.1179332895456529No Hit
GGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTG804920.11739656618981811No Hit
GTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGG803160.11713987241094061No Hit
GCCCTATCAACTTTCGATGGTAGTCGCCGTGCCTACCATGGTGACCACGGG789410.11513445226346011No Hit
GGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGA788320.11497547713904166No Hit
GTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGCCTACCCT729420.1063849864709252No Hit
GTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCC708980.1034038382662342No Hit
GGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGC698850.10192639055030858No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTG695730.10147134248775301No Hit
CCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCC694250.10125548635551511No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCGTATG76500.030.60425843
CGTATGC76050.030.34194644
GTATGCC80700.028.89909645
GCGTACG201450.027.8814982
CGTACGG211950.026.5108473
GGCGTAC222600.025.882731
TAATAGG549750.025.13852319
CTAATAG550300.025.13788418
TAGGGAA568850.024.36111622
ACTAATA579500.023.90660317
ATAGGGA591100.023.45928821
TAACGAG108600.023.3015818
TTAACGA109550.023.1411317
AAGCCCG238800.023.05390244
AATAGGG601650.023.0229320
CGTCTGA102750.022.66851616
CACTAAT616200.022.4790516
CCACTAA617950.022.46440115
AACGTGA618950.022.30283527
GAACGTG625400.022.10495626