FastQCFastQC Report
Mon 21 Nov 2016
N2_24h_mock_RNA.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameN2_24h_mock_RNA.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences67214554
Sequences flagged as poor quality0
Sequence length51
%GC53

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG2539570.3778303728683523No Hit
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA1670730.24856670178902027No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG1467440.2183217640631819No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAG1281310.19062984483985418No Hit
CTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGC1230180.18302286138802618No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAAC1084290.16131774079762548No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTG1012190.1505908973226245No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA1009810.15023680734383807No Hit
CTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCCC999010.14863001248211807No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT990940.14742937965488845No Hit
CTCGGATCGGCCCCGCCGGGGTCGGCCCACGGCCCTGGCGGAGCGCTGAGA963160.14329634620501983No Hit
CTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAG953940.1419246194804774No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG951810.14160772382719372No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG902420.13425961288086505No Hit
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTG880960.13106685197970666No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT872180.12976058726804912No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT861510.1281731334555906No Hit
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCC826170.12291534360251799TruSeq Adapter, Index 12 (100% over 51bp)
CTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTC810090.12052300458617936No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC780350.11609836762436897No Hit
CTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCT741020.11024695633627205No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT714090.10624038359311287No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTC712650.10602614427821688No Hit
TGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCG709080.10549500931003723No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG687110.10222637198485315No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA684730.10187228200606673No Hit
CGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGAC682530.10154497194164228No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGC678840.10099598369722128No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC678150.10089332735883363No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC117300.034.39773644
TCGTATG123950.032.86154643
GTATGCC126650.031.8934445
CGTCTGA148450.027.62950916
ACACGTC157800.026.16493213
GCGTACG116800.025.1522052
CGTACGG119800.024.42873
TCTCGTA168400.024.20097241
CACACGT177700.023.27220712
GTAATCT175750.023.15134237
ATCGGAA186000.022.1484762
TAATCTC186250.022.0629938
CGCTGAG246250.021.65869744
CGGAGCG380750.021.57873739
CGGGTTT87600.021.543151
AGTCACC194200.021.2678628
GCGCTGA245000.021.19354643
CACGTCT196300.021.09049614
AGCGCTG249200.020.94451142
CTAATAG332550.020.94148418