FastQCFastQC Report
Mon 21 Nov 2016
N3_6h_RVFV_RNA.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameN3_6h_RVFV_RNA.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences71684876
Sequences flagged as poor quality0
Sequence length51
%GC54

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA3497650.48792021346315784No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG2754560.38425957519965576No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG2629070.3667537905764111No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT1773270.24737017052244045No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT1387340.1935331519580225No Hit
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATG1352180.1886283516763006TruSeq Adapter, Index 16 (97% over 40bp)
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT1320590.18422156439246684No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC1320210.18416855460557677No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG1277830.17825656837294385No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA1223870.17072917863455606No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAA1200080.16741048697636027No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG1194980.16669903983652007No Hit
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG1149500.1603546053424156No Hit
GCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCAC1124630.15688525428990072No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCC1079380.15057290466680867No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT1059760.14783592567001164No Hit
GTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGC1048970.14633072672121245No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA1038160.14482273778362956No Hit
AGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGC1037770.14476833300234765No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG1014640.14154171097401352No Hit
TGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCA1010190.14092093846964315No Hit
GCCCTATCAACTTTCGATGGTAGTCGCCGTGCCTACCATGGTGACCACGGG973470.13579851906279367No Hit
GGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGA957660.133593032929289No Hit
GGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGAC948310.1322887131729153No Hit
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCG932840.13013065684873332No Hit
GTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATT902740.12593172372928427No Hit
GGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGG900810.12566248981165845No Hit
GGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTCTC857660.11964308901085355No Hit
CCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCC849950.1185675483347422No Hit
GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGG848990.11843362887312521No Hit
GGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGA844820.11785191621172646No Hit
GTACGGAAGACCCGCTCCCCGGCGCCGCTCGTGGGGGGCCCAAGTCCTTCT839990.11717813392046603No Hit
GTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGCCTACCCT819950.11438256515921155No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTC794360.11081277451048391No Hit
GGCGTACGGAAGACCCGCTCCCCGGCGCCGCTCGTGGGGGGCCCAAGTCCT781600.10903276166649153No Hit
GTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTC767280.1070351296973716No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGC762940.1064297021313115No Hit
GGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTC761400.1062148729949676No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCG738300.10299243594980899No Hit
GTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGG738040.10295616609562105No Hit
GCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGT735770.10263950236867259No Hit
GGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGC734130.10241072328841025No Hit
GTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGAT726900.10140214234310735No Hit
GTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGCGAT720660.10053166584259698No Hit
GGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGG717750.10012572247457051No Hit
GGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTG717290.1000615527325457No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCGTATG185750.036.95886245
CGTCTGA221650.034.01066616
CCGATCT209900.033.29588339
TCCCGAT216050.032.5359737
GTCCCGA222150.032.01503836
ACACGTC238800.031.62636413
TCTCGTA233200.030.2372243
CACACGT254900.029.68985212
CCCGATC247300.028.33385338
CACCCGT274350.028.1692331
CACGTCT270400.027.87259714
AGTCACC272800.027.50413728
GCGTACG145100.027.2890132
ATCTCGT256800.027.17955842
ATCGGAA285600.026.7247942
GTCACCC283050.026.51693329
GCACACG292000.026.26269711
GATCGGA297100.025.7266771
ACCCGTC308650.025.31415732
CGTACGG160250.024.7091523