FastQCFastQC Report
Tue 22 Nov 2016
N1_24h_IFN_RNA.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameN1_24h_IFN_RNA.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences69043181
Sequences flagged as poor quality0
Sequence length15-51
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCC1513920.21927147302207875TruSeq Adapter, Index 4 (100% over 51bp)
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA1358080.19670009120813825No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG1286250.18629645699551417No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG814660.11799282538850578No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT765150.11082195068619449No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC202100.037.9465844
TCGTATG203950.037.69389743
GTATGCC215900.036.187845
CGTCTGA250450.031.83564816
GATCGGA264600.030.4716851
ATCGGAA267100.030.103732
ACACGTC266250.029.94938313
GACCAAT273150.029.45802135
TCTCGTA269500.028.8560841
CACACGT285050.027.96714612
ACCAATC287150.027.82671436
ACGTCTG301450.026.49228515
ATCTCGT299800.026.20460140
CACGTCT310400.025.71932814
TCGGAAG319650.025.244663
GCGTACG100100.025.237342
TGACCAA323750.024.8175134
GCACACG334350.024.1277911
CGTACGG105400.023.8634953
ACTGACC337000.023.8366832