FastQCFastQC Report
Wed 23 Nov 2016
N1_6h_mock_RNA.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameN1_6h_mock_RNA.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences71976311
Sequences flagged as poor quality0
Sequence length15-51
%GC54

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG2524520.3507431771544946No Hit
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA2058240.28596075172566154No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG1664750.2312913758528136No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTG1465080.20355030421050613No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT1433740.19919609383704037No Hit
CTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGC1325740.18419115700442054No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAG1178830.16378027487404848No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG1162940.16157260407524915No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA1159380.1610779968981739No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT1104460.1534477086495861No Hit
TGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCG1096550.15234873596119702No Hit
CTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCCC1071180.14882396515153437No Hit
CTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAG1008870.14016695020671455No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC1008410.1401030402905756No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT1004180.139515346931298No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG998160.13867896063747975No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAAC993540.13803708278408433No Hit
CTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTC974380.13537509584229732No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG968890.13461234488663917No Hit
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTG845700.11749699147543141No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT839220.11659669526547423No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG820850.11404446665792584No Hit
TGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCA810450.11259954681478465No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCG783180.10881080026454815No Hit
CTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCT776330.10785909825247922No Hit
GCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTC762370.1059195712322628No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCC744020.10337012131672044No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC738780.10264210401113778No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC72350.028.07634444
TCGTATG75300.027.54661843
GTATGCC77700.027.0119145
GCGTACG172350.025.4054152
CGTACGG180750.024.2369633
CGGGTTT92800.023.4254151
ATCACGA90550.022.48709734
GGCGTAC206750.021.5729061
AAGCCCG269800.021.15799944
AGCGCTG203550.020.7804342
CGGAGCG332000.020.76264839
CTAATAG402100.020.39192218
CGCTGAG204300.020.28670744
TAATAGG406750.020.22865919
TAGGGAA416300.019.83758422
GTACGGA223200.019.6570264
CGTCTGA102650.019.55309716
TACGGAA221700.019.5314755
GCGCTGA206500.019.47916443
AGCGTTG683500.019.434645