FastQCFastQC Report
Wed 23 Nov 2016
N2_6h_RVFV_RNA.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameN2_6h_RVFV_RNA.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences70259875
Sequences flagged as poor quality0
Sequence length15-51
%GC53

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG1727500.24587291110324347No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG1693210.24099245835549807No Hit
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA1406900.20024231469241868No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG907850.12921315331118935No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT777270.11062786547798441No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA774810.11027773675942348No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA757130.10776136450570116No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAAC724770.10315560624040393No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC89350.030.43873244
TCGTATG92000.029.7095843
GTATGCC103300.027.13131345
AGTCACG105000.025.91776528
GCGTACG136950.024.9090352
GTCACGA114050.023.5565929
CGTACGG144700.023.529173
CTAATAG363450.023.37155518
TAATAGG374950.022.72388819
TAGGGAA387700.022.02405422
CGTCTGA125850.021.53619816
ACTAATA398850.021.30212417
AACGTGA408000.020.91455327
AATAGGG408550.020.89634320
ATAGGGA409400.020.8809621
ACGTGAG418550.020.44518328
GAACGTG419450.020.36759626
ACACGTC135950.020.02562913
CCACTAA429150.019.90155615
CACTAAT429300.019.84051916