FastQCFastQC Report
Wed 23 Nov 2016
N2_6h_mock_RNA.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameN2_6h_mock_RNA.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences69136745
Sequences flagged as poor quality0
Sequence length15-51
%GC54

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA3044430.44034905027709936No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG2761820.39947208969701997No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG1973380.2854314301316905No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT1660050.24011110155677706No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC1394620.201719071385267No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT1368320.19791501610323137No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT1213960.17558824905627246No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG1117200.16159279699962734No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAA1092200.15797677486841477No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG1086190.15710748314807127No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCC1076840.15575509087099776No Hit
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG1074940.1554802731890256No Hit
GGCGTACGGAAGACCCGCTCCCCGGCGCCGCTCGTGGGGGGCCCAAGTCCT1067730.1544374124063839No Hit
GCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTC1018930.14737893720625697No Hit
GCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCAC1017370.1471532974252693No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG1010600.14617407863213694No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA1008540.14587611840852502No Hit
GGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGAC1001900.14491570293047495No Hit
GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGG952860.13782251391788838No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT917450.1327007801712389No Hit
GTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATT898310.12993235362758257No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCG876040.1267112011130984No Hit
GCCCTATCAACTTTCGATGGTAGTCGCCGTGCCTACCATGGTGACCACGGG873890.12640022320981412No Hit
TGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCA858770.12421325302485675No Hit
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCG855910.12379958009304604No Hit
GTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGG848260.122693077320895No Hit
GGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGG843910.122063889470064No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA833300.12052924967757739No Hit
GGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTG829060.11991597232412372No Hit
GTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTC794640.11493743305387026No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC766180.11082095345969789No Hit
GTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGCCTACCCT744370.10766633575242804No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGC715570.10350067825727115No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTC711050.10284690145594792No Hit
GCTCTTTCTCGATTCCGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGG709100.10256485172971334No Hit
GGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGG701550.10147281304608714No Hit
GGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGA699570.1011864240932951No Hit
GGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGA697780.10092751690870029No Hit
GGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGC696360.10072212685164743No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC77250.031.25417544
TCGTATG80800.030.2494543
GCGTACG232050.029.562282
GTATGCC84700.029.20792645
CGTACGG243950.028.0931243
GGCGTAC255600.027.5200581
AAGCCCG253350.026.70825444
CTAATAG569950.023.88358518
TAGGGAA575400.023.74775922
TAATAGG575100.023.71699519
TAACGAG109950.023.06327818
AGCCCGG301700.022.90767345
ACTAATA596050.022.86087217
TTAACGA112000.022.66681317
ATAGGGA607750.022.52334421
CGTCTGA106500.022.36310416
AATAGGG611700.022.31082520
CACTAAT623200.021.85783416
CCACTAA628300.021.6349515
AACGTGA645250.021.20292527