FastQCFastQC Report
Wed 23 Nov 2016
N3_24h_RVFV_RNA.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameN3_24h_RVFV_RNA.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences66212342
Sequences flagged as poor quality0
Sequence length15-51
%GC54

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG2239830.3382798330861035No Hit
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA1972070.29784024253363517No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG1675980.25312199347970504No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT1059650.16003813911309767No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT1039880.15705229094599918No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTG1030870.15569151745153495No Hit
CTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGC1005870.15191578633481959No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG1000630.15112439309275602No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT991500.1497454960889316No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAAC986950.14905831302568937No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA982650.14840888727361431No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAG954870.14421329485672021No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC905130.1367011002269033No Hit
CTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAG876090.13231521096172674No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG859080.12974620350991362No Hit
CTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCCC839190.12674223183345487No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA819660.12379263068507682No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG788890.11914546082662353No Hit
TGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCG766430.11575334399136644No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT751920.11356190965122483No Hit
CTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTC740590.11185074830912943No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC739230.11164534853638011No Hit
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTG735160.11103065951057886No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG699010.10557095231580843No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGC688990.10405763928422891No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCG680210.10273160251603848No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTC676560.10218034577299803No Hit
CTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCT669300.10108387345670389No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCGTATG55500.027.09592845
GCGTACG147650.026.0818732
CGTACGG154800.024.820233
GGCGTAC175200.022.6099821
CTAATAG367650.022.41889618
TAATAGG373700.022.17920119
CGGGTTT86700.021.572711
TAGGGAA388950.021.33301422
ACTAATA397800.020.82602517
AAGCCCG205500.020.68684844
ATAGGGA405550.020.46529821
AACGTGA413650.020.0525827
AATAGGG414450.020.02451320
GTACGGA193300.019.9794224
TACGGAA195100.019.6820855
GAACGTG421350.019.68118926
GGAACGT422250.019.61936425
CCACTAA422500.019.56342715
ACGTGAG427000.019.46223828
CACTAAT428400.019.32461516