FastQCFastQC Report
Wed 23 Nov 2016
N3_24h_mock_RNA.prinseq.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameN3_24h_mock_RNA.prinseq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences70653822
Sequences flagged as poor quality0
Sequence length15-51
%GC55

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTA4734440.6700897228178258No Hit
GTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG4603720.6515882467051818No Hit
CTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTG4122080.5834192522521995No Hit
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTT2773580.3925590890185671No Hit
GTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTG2680020.37931705945079663No Hit
AGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCAT2469730.3495536306585085No Hit
CTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCCC2418040.34223767823911916No Hit
GTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGAC2384400.33747643545737693No Hit
GCCCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCG2371150.33560109458763604No Hit
GTTGGTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTC2162600.3060839369737139No Hit
GTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGCCTACCCT2082460.2947413092528809No Hit
CCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA2067650.29264517353357045No Hit
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGT2049420.29006498756712695No Hit
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCT1990710.28175545832467497No Hit
GTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAA1941570.2748004205632358No Hit
GGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGG1909890.2703165866950552No Hit
GCCCTATCAACTTTCGATGGTAGTCGCCGTGCCTACCATGGTGACCACGGG1900440.26897907943324No Hit
TGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCA1894960.26820346675654716No Hit
CTCGGATCGGCCCCGCCGGGGTCGGCCCACGGCCCTGGCGGAGCGCTGAGA1644100.2326979565238523No Hit
GTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATT1604470.2270889181338272No Hit
GTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGC1601780.2267081885534798No Hit
CTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAG1561770.22104536680266212No Hit
GTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCC1550820.21949555680087626No Hit
CTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAAC1482100.20976926060701998No Hit
CCTTCGTCCTGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCTCGCC1462610.20701074033900105No Hit
GCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGG1454600.2058770437075577No Hit
CAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAG1450110.20524155083924545No Hit
GTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGG1448210.20497263403528262No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAA1289190.182465712895192No Hit
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTC1275810.18057197245465362No Hit
CTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGC1266830.17930098671802921No Hit
GGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAA1266370.1792358805444382No Hit
GCTCTTTCTCGATTCCGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGG1246430.1764136694544281No Hit
CTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTG1245330.1762579807784496No Hit
GTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGG1241700.1757442081477206No Hit
CTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGC1209240.17114997685475528No Hit
GGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGC1118240.15827027729653464No Hit
GTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGC1103900.15624066310241505No Hit
GGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCG1103790.1562250942348172No Hit
CTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAG1097610.15535040694613803No Hit
GTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGGATTATGA1092330.15460310130144128No Hit
GGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGAC1082730.15324436376562897No Hit
GCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCAC1070580.15152471157186656No Hit
CCTGCCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAGT1068470.15122607238430782No Hit
GGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCAGG1013350.1434246543661856No Hit
GCCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAGTGAG1003250.1419951492503831No Hit
CTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGGCT1000330.14158186658324018No Hit
GGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGG993010.1405458292121833No Hit
CTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTC976460.1382034223145069No Hit
GTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCC960480.13594169045801938No Hit
GGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGC943770.1335766379347461No Hit
TGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAAGGTG935580.13241746497450627No Hit
GGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTG929260.13152296276342984No Hit
GGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTC920660.130305760387598No Hit
AGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGC916080.12965752935488753No Hit
GTACGTAGCAGAGCAGCTCCCTCGCTGCGATCTATTGAAAGTCAGCCCTCG912880.12920461684295012No Hit
GGCGGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAACGCGACCGATCCCG911450.1290022215641781No Hit
GGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGA910560.1288762552717955No Hit
GTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCC895360.1267249208400927No Hit
CGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGAC887160.12556433252825303No Hit
CGTTGATTAAGTCCCTGCCCTTTGTACACACCGCCCGTCGCTACTACCGAT885490.12532796881108568No Hit
GTATGTGCTTGGCTGAGGAGCCAATGGGGCGAAGCTACCATCTGTGGGATT882650.12492600895674122No Hit
GTCCACTTTAAATCCTTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCC878810.1243825139424163No Hit
GTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCAT834450.11810401424568369No Hit
CATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATC833330.11794549486650559No Hit
CTTGCGTTGATTAAGTCCCTGCCCTTTGTACACACCGCCCGTCGCTACTAC831890.11774168423613375No Hit
CCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTG829640.11742323012617775No Hit
CAGGTGTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGA818690.11587342012439185No Hit
GTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCT809290.11454298962057566No Hit
GTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCG808860.11448212950178407No Hit
GTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTC807780.11432927152900518No Hit
GTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGA805480.11400374066105015No Hit
GCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAACGAACG801090.113382401308736No Hit
GTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGAAAATCCG789570.11175191626576124No Hit
GCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTC785800.11121832871263497No Hit
GGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCGTGA774060.10955670593446452No Hit
GTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGAT772100.10927929702090286No Hit
GGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTC769300.1088829985729576No Hit
GGTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGG767300.10859992825299672No Hit
GTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGG761010.1077096720967197No Hit
GCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATTTGG756660.10709399415080474No Hit
GTTGACGCGATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAA747870.10584990009457663No Hit
GTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTG747000.10572676450539364No Hit
GTTTTCGGAACTGAGGCCATGATTAAGAGGGACGGCCGGGGGCATTCGTAT739620.10468223502473795No Hit
GTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAACA736790.10428169052199326No Hit
GTTCCTTTGGTCGCTCGCTCCTCTCCTACTTGGATAACTGTGGTAATTCTA733700.10384434687765369No Hit
TGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCA725550.10269083532381305No Hit
GTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAG724050.10247853258384237No Hit
GGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAA719920.10189399237312315No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCTGAG317250.034.65892444
ACGTCCG50800.032.00538632
AGCGCTG360900.031.9162942
GCTGAGA302950.031.59179745
TCGTATG53100.030.0010345
GAGCGCT386300.029.59645541
GCGCTGA369150.029.4159243
AGTCACG57000.028.39550628
TAGGGAA824300.027.6912422
TAATAGG824850.027.64363519
CGGGTTT61900.027.2242321
AAGCCCG318600.027.14928644
CTAATAG851200.026.79595218
ATAGGGA862200.026.50915721
AGCCCGG331950.026.49959445
ACTAATA877950.025.98363717
CGGAGCG554050.025.9437939
GGAGCGC444100.025.77000840
CTGGCGG476800.025.68920935
CCCTGGC491800.025.43786233