FastQCFastQC Report
Tue 6 Dec 2016
26_GGCTAC_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename26_GGCTAC_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24573483
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA23517399.570230642518197RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC14142335.7551182304926005RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA12867535.236347651653614RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA8748973.5603296447638293RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG8733533.5540464491745025RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG5180952.108349882676379RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA3026051.2314290163913677RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2678331.0899268939612672RNA PCR Primer, Index 1 (100% over 27bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2610831.0624582603939376RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA2606211.0605781850297737RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA2362070.9612271894871395RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG2342210.9531453070775517RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA2247620.9146525952385341RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC2212060.9001817121325455RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA2209250.8990382030907055RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2132700.8678867379117563RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC2077630.8454764023480107RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA2041780.8308875058533622RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1951480.7941405782810683RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG1913800.7788069766097057RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1822600.7416938005898472RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1747140.7109859029751704RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1698390.6911474453987658RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1671500.6802047556709808RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1665080.6775921834116881RNA PCR Primer, Index 1 (100% over 29bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC1532110.6234810099976467RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA1469120.5978476880953343RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG1468310.5975180644925263RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC1356470.5520055907418578RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT1350540.5495924204151279RNA PCR Primer, Index 1 (100% over 30bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG1295640.5272512651137RNA PCR Primer, Index 1 (100% over 29bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA1288840.5244840546209912RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1260400.5129106036779564RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1212090.49325120089813884RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA1189540.4840746425730532RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA1181670.4808720033704624RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA1039740.4231146231895576RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC1031850.41990384513257645RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC934370.38023506883415753RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG913770.37185204881212813RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG870120.35408899910525504RNA PCR Primer, Index 1 (100% over 29bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA865300.352127535197188RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG843260.34315851765905553RNA PCR Primer, Index 1 (100% over 29bp)
AGACCTGTAGATGCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA841400.3424016042007557RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA794900.3234787677432621RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC778550.3168252542791756RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC773970.3149614566237924RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA740260.30124341754890827RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA724950.2950131245131185RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC724720.2949195276876298RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC720890.29336093707188354RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA680290.2768390626595343RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA635490.25860802882521783RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC611030.24865420990585665RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA610780.24855247422597765RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC604720.24608640134571075RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA596640.24279830417202153RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA568200.2312248532289867RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC562900.22906805681555195RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC540620.22000137302473563RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG540290.21986708192729534RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC527890.21482099220529707RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG511570.20817968702279607RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC487240.198278770656972RNA PCR Primer, Index 1 (100% over 33bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA484990.19736314953806103RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA477850.19445757852071682RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA477450.19429480143291042RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG471330.19180431198947256RNA PCR Primer, Index 1 (100% over 29bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA467110.19008701371311507RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA458730.18667683372357105RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA450130.18317712633573352RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA446930.18187490963328234RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA446810.18182607650694044RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA435410.1771869295044581RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA431740.1756934497238344RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA430840.17532720127627002RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA375290.15272153320715667RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA373470.15198089745763757RNA PCR Primer, Index 1 (100% over 28bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC358700.14597035349038637RNA PCR Primer, Index 1 (100% over 27bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA358050.14570584072270099RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC352190.14332115638633727RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC348830.1419538288487635RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG342390.13933311773508053RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA340160.1384256354705599RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT335910.1366961289126169RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA327320.13320049095197453RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC327200.1331516578256326RNA PCR Primer, Index 1 (100% over 31bp)
TGAGGTAGTAGTTTGTGCTGTTTTGGAATTCTCGGGTGCCAAGGAACTCC316110.12863866306620028RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT314520.12799162414216983RNA PCR Primer, Index 1 (100% over 30bp)
TAACAGTCTACAGCCATGGTCTGGAATTCTCGGGTGCCAAGGAACTCCAG314270.12788988846229085RNA PCR Primer, Index 1 (100% over 29bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC308510.12554589839787872RNA PCR Primer, Index 1 (100% over 27bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT293440.11941327161477272RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATTGTCTGCTGGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG286840.11672744966596718RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG282560.11498573482643872RNA PCR Primer, Index 1 (100% over 29bp)
ATTGCACTCGTCCCGGCCTCCCTGGAATTCTCGGGTGCCAAGGAACTCCA279490.11373642067752462RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA278850.1134759773370344RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTACTGTGATAACTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA278150.1131911174333732RNA PCR Primer, Index 1 (100% over 28bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA277490.11292253523849266RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT275420.11208016380909454RNA PCR Primer, Index 1 (100% over 30bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA273340.11123372295250128RNA PCR Primer, Index 1 (100% over 32bp)
TAGCAGCACGGAATGGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG272160.11075353054347242RNA PCR Primer, Index 1 (100% over 29bp)
CCTTGGCTTTAGACTGCTTACTGTGGAATTCTCGGGTGCCAAGGAACTCC270980.11027333813444355RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTCGTCCCGGCCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG268700.10934550873394708RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTGGCATTCTCGGGTGCCAAGGAACTCCAGT267030.10866591439235536RNA PCR Primer, Index 1 (96% over 30bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG262940.10700151866953496RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTGTGGTTTTGGAATTCTCGGGTGCCAAGGAACTCC262110.10666375621233667RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC260780.10612252239538042RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC258540.10521097070366459RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA258320.10512144330537107RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG255760.10407966994341014RNA PCR Primer, Index 1 (100% over 29bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA254830.10370121321426028RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG253930.10333496476669587RNA PCR Primer, Index 1 (100% over 29bp)
CTTTTTGCGGTCTGGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG247150.10057589312837745RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC247120.10056368484679197RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCTAG254.4266653E-544.031661
TTACATA302.517343E-644.031661
CCGTTGC900.044.031661
ATCGATT207.831832E-444.0316541
AACATTC5593400.044.0056761
CCCTATA254.446282E-543.9986883
CCCTAGC254.446282E-543.99868810
GTCCTTA351.4480429E-743.9986883
ATGCTAC1400.043.99868811
CGACACG207.860776E-443.9986883
ACCTATA207.860776E-443.9986883
AGTGCCC254.446282E-543.9986883
TCCACCG454.802132E-1043.9986889
GGTATAC207.860776E-443.99868811
ATGCGAA254.446282E-543.99868810
ATTTCGT302.5303525E-643.9986883
CCTTAAA1650.043.99868411
CGTTCAA24500.043.9986843
CTAGTGC2200.043.99868411
TAATACG254.4463355E-543.99859612