FastQCFastQC Report
Tue 6 Dec 2016
26_GGCTAC_L005_R1_001_prinseq_good_wANB.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename26_GGCTAC_L005_R1_001_prinseq_good_wANB.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24402770
Sequences flagged as poor quality0
Sequence length15-50
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG249792510.23623547654631No Hit
AACATTCAACGCTGTCGGTGAGT15172496.217527764266106No Hit
TTCAAGTAATCCAGGATAGGCT13771875.64356833261142No Hit
TCACAGTGAACCGGTCTCTTT9356193.8340688372672447No Hit
TGAGGTAGTAGGTTGTATAGTT9140073.7455051209350416No Hit
AACATTCAACGCTGTCGGTGA5756052.358769106949744No Hit
TAAAGCTAGAGAACCGAAAGTA3114551.2763100254602244No Hit
TAGCTTATCAGACTGGTGTTGGC2799071.1470296199980574No Hit
AACCCGTAGATCCGAACTTGTG2752011.127744924039361No Hit
TTAAAGGGAATTTGCGACTGTT2730501.118930350939668No Hit
TCCCTGAGACCCTTAACCTGT2513811.030133054567166No Hit
TATTGCACTCGTCCCGGCCTCC2491871.0211422719633878No Hit
TCCCTGAGACCCTTAACCTGTG2387410.9783356561570674No Hit
TCACAGTGAACCGGTCTCTT2299840.9424503857553876No Hit
TTGCATAGTCACAAAAGTGATC2281480.9349266497205031No Hit
AGCTACATCTGGCTACTGGGTCTC2280600.9345660349214455No Hit
TGAGGTAGTAGTTTGTATAGTT2225650.9120480994575617No Hit
AACATTCATTGCTGTCGGTGGG2167290.8881327816473293No Hit
TCTTTGGTTATCTAGCTGTATGA2123740.8702864469894196No Hit
AAGCTGCCAGCTGAAGAACTGT2032920.8330693605684928No Hit
TCTTTGGTTATCTAGCTGTAT1991330.8160262134175752No Hit
TAAAGCTAGAGAACCGAAAGT1933040.7921395808754499No Hit
TGAGGTAGTAGTTTGTGCTGTT1910480.7828947287541537No Hit
TGAGGTAGTAGGTTGTATAGT1777140.7282533909060325No Hit
TCCCTGAGACCCTTAACCTGTGA1760530.7214467865738192No Hit
TTCACAGTGGCTAAGTTCTG1740650.7133001704314715No Hit
AAGCTGCCAGCTGAAGAACT1630290.6680757963132874No Hit
ACCTTGGCTTTAGACTGCTTACT1615850.6621584352923868No Hit
TAACAGTCTACAGTCATGGCT1574420.6451808544685707No Hit
TTCACAGTGGCTAAGTTCTGC1564580.641148525351835No Hit
TCACAGTGAACCGGTCTCTTTT1547220.6340345788613342No Hit
AACATTCATTGCTGTCGGTGGGT1443090.5913631936046605No Hit
ACCGTGGCTTTAGATTGTTACT1306310.5353121797238592No Hit
TGAGGTAGTTGGTTGTATAGTT1265530.5186009621038923No Hit
TCCCTGAGACCCTAACTTGTGA1212540.4968862141470005No Hit
CCCTGAGACCCTTAACCTGTGA1205310.4939234357411064No Hit
AGCTACATCTGGCTACTGGGTCT1193160.4889444927768446No Hit
TCTTTGGTTATCTAGCTGTATG1134520.46491443389418496No Hit
TAAAGGGAATTTGCGACTGTT975280.399659546846526No Hit
AACATTCAACGCTGTCGGTGAGA974850.399483337342441No Hit
TCCAGCATCAGTGATTTTGTT925990.3794610202038539No Hit
AACCCGTAGATCCGAACTTGT914480.37474434254799766No Hit
AGAATAATGCCAGCAGTCGGTC906050.3712898166888431No Hit
AGACCTGTAGATGCTAACTTGT875240.3586642008263816No Hit
AGCTACATTGTCTGCTGGGTTT834540.3419857663699654No Hit
TGAGGTAGTAGGTTGTATAGTTT824660.3379370456714545No Hit
TTCCCTTTGTCATCCTATGCCTG804350.3296142200250218No Hit
TATTGCACTTGTCCCGGCCTGT780190.3197137046327118No Hit
TAAAGCTAGAGAACCGAAAGTAA749440.30711267614291327No Hit
TGCTCAGTAGTCAGTGTAGATCC739430.3030106828036326No Hit
TGCTCAGTAGTCAGTGTAGATC739170.3029041375220928No Hit
TGAGATGAAGCACTGTAGCTCT708890.2904957101181546No Hit
CCTTGGCTTTAGACTGCTTACT651110.266818070243665No Hit
CCTGTCTGAGGGTCGCT637490.2612367366491591No Hit
AGCTGGTGTTGTGAATCAGGCCG636420.26079826183666854No Hit
TCCAGCATCAGTGATTTTGTTG635820.26055238811003834No Hit
TTCCCTTTGTCATCCTATGCCT633060.2594213689675393No Hit
AACCCGTAGATCCGAACTTGTGA629300.2578805602806567No Hit
TTCAAGTAATCCAGGATAGGC619760.25397116802723624No Hit
TGAGGTAGTAGATTGAATAGTT593670.24327975881426575No Hit
TCTTTGGTTATCTAGCTGTATGT584110.23936217076995767No Hit
TTCAAGTAATCCAGGATAGGCTT574840.23556342169352087No Hit
AACATTCAACGCTGTCGGTGG574480.2354158974575427No Hit
AGCTACATTGTCTGCTGGGTTTC551340.2259333674005041No Hit
TAGCAGCACGTAAATATTGGAG510930.20937377191195916No Hit
TGAGATGAAGCACTGTAGCTC498540.20429647945704524No Hit
TACCCTGTAGAACCGAATGTGT497360.20381292779467247No Hit
TAGCTTATCAGACTGGTGTTGG496850.2036039351270368No Hit
TAACAGTCTACAGCCATGGTCG488430.20015350716332614No Hit
TGAGGTAGTAGGTTGTGTGGTT479860.19664161076795791No Hit
ACCATCGACCGTTGACTGTACC473170.19390011871603102No Hit
TGAGGTAGTTGGTTGTATTGTT470990.19300677750927456No Hit
TTCAAGTAATCCAGGATAGGTT466410.19112994139599726No Hit
AAGCTGCCAGTTGAAGAGCTGT454610.1862944247722697No Hit
AAGCTGCCAGCTGAAGAACTGC447260.18328247162104958No Hit
TCACAGTGAACCGGTCTCT444160.18201212403346015No Hit
CTTTGGTTATCTAGCTGTATGA439530.18011479844296366No Hit
TCCCTGAGACCCTAACTTGT436910.17904114983667838No Hit
TCCCTGAGACCCTAACTTGTG426830.1749104712292908No Hit
AACATTCAACGCTGTCGGTG424470.17394336790454526No Hit
TGAGATGAAGCACTGTAGCT415970.1704601567772839No Hit
ACCATCGACCGTTGACTGTGCC394750.16176442264546198No Hit
TAAGGCACGCGGTGAATGCC385520.15798206515080052No Hit
TTGCATAGTCACAAAAATGAGC380730.15601917323320263No Hit
CTGGACAACTCTTAGCGG379260.1554167826029586No Hit
CAGGCTGGTTAGATGGTTGTCT374360.15340881383547852No Hit
TAAAGCTAGAGAACCGAAAGTAT371900.15240073155629463No Hit
TGTAAACATCCTTGACTGGAAGCT367630.15065093020177625No Hit
AGCAGCATTGTACAGGGCTATGA366300.15010591010774596No Hit
TTCACAGTGGCTAAGTTCTGCT355690.145758043041835No Hit
TGAGGTAGTTGTTTGTACAGTT342220.14023817787898668No Hit
TAACAGTCTACAGCCATGGTC334900.13723851841409807No Hit
TGAGGTAGTAGTTTGTGCTGTTT331860.13599275819917164No Hit
TAACGGAACCCATAATGCAGCTG322130.13200550593231833No Hit
AGCTACATTGTCTGCTGGGTT307170.12587505434833832No Hit
TGAGGTAGTAGTTTGTATAGT300070.12296554858321411No Hit
TATTGCACTCGTCCCGGCCTC296850.12164602625029863No Hit
AACAGTCAACGCTGTCGGTGAG295080.1209206987567395No Hit
ATTGCACTCGTCCCGGCCTCCC294520.12069121661188464No Hit
TAGCAGCACGGAATGGTTTGT290000.11883896787127034No Hit
TACAGTACTGTGATAACTGAAG282620.11581472103371872No Hit
TAAATCTAGAGAACCGAAAGTA280670.11501563142217051No Hit
GTACAGTACTGTGATAACTGA280290.11485991139530473No Hit
ACCATCGACCGTTGACTGTGCCT276220.11319206794966309No Hit
AACATTCAACGCTGTCGGTGT275960.11308552266812333No Hit
TGAGGTAGTAGGTTGTGTGGTTT275760.1130035647592466No Hit
CCTTGGCTTTAGACTGCTTACTG274920.11265934154196429No Hit
TATTGCACTCGTCCCGGCCT274330.11241756571077792No Hit
TCCCTGAGACCCTTAACCTGTGT273240.1119708951073997No Hit
CATTATTACTTTTGGTACGCG270300.11076611384691164No Hit
AACATTCATTGCTGTCGGTGGGTT266500.10920891357825362No Hit
AAGCCCTTACCCCAAAAAGCAT265680.108872886151859No Hit
CTTTTTGCGGTCTGGGCTTGC263880.10813526497196835No Hit
CATTGCACTTGTCTCGGTCTGA262410.10753287434172433No Hit
TCCCTGAGACCCTTAACCTGTGG253920.10405376110990679No Hit
TGAGGTAGTAGTTTGTGCTGTTA253400.10384067054682727No Hit
AACATTCAACGCTGTCGGTGAT249290.10215643551941031No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AACCCCA850.04310.26944
CGTATAC650.04227.379444
ACCCTCC800.03434.745644
CATACTC4200.03343.879444
ACGCAGC750.03054.57643
GTCGCAT108.779644E-43053.107244
CATTATG108.779644E-43053.107244
GCATACT4300.02996.858643
GTAACAA800.02873.339642
TCATTAT109.980014E-42863.66543
CTCCACT1150.02768.982441
TCCAGTC6750.02713.87344
AGAACCC1050.02675.702442
TGCGGAT4350.02596.895844
TGCATAC4350.02583.436842
TAACAAC1000.02577.298343
CACCCTC1000.02577.298343
GATTTAT251.8189894E-122489.401438
TCCACTC1450.02466.007842
AACTCCA39100.02459.664344