FastQCFastQC Report
Tue 6 Dec 2016
28_CTTGTA_L005_R1_001_prinseq_good_JLWg.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename28_CTTGTA_L005_R1_001_prinseq_good_JLWg.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20920195
Sequences flagged as poor quality0
Sequence length15-50
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG253897012.13645475101929No Hit
AACATTCAACGCTGTCGGTGAGT15027927.18345120588025No Hit
TTCAAGTAATCCAGGATAGGCT10800375.1626526425781405No Hit
TCACAGTGAACCGGTCTCTTT7008893.350298599033135No Hit
TGAGGTAGTAGGTTGTATAGTT6819853.259936152602784No Hit
AACATTCAACGCTGTCGGTGA5813902.7790849941886298No Hit
AACCCGTAGATCCGAACTTGTG2559191.2233107769788953No Hit
TCCCTGAGACCCTTAACCTGTG2391551.1431776807051752No Hit
TATTGCACTCGTCCCGGCCTCC2385011.140051514816186No Hit
TAGCTTATCAGACTGGTGTTGGC2341491.1192486494509253No Hit
TCCCTGAGACCCTTAACCTGT2332401.1149035656694406No Hit
TTAAAGGGAATTTGCGACTGTT2157881.031481781121065No Hit
TAAAGCTAGAGAACCGAAAGTA2156781.0309559734027336No Hit
AACATTCATTGCTGTCGGTGGG2071410.9901485143900428No Hit
AGCTACATCTGGCTACTGGGTCTC1920590.9180554961366278No Hit
TCACAGTGAACCGGTCTCTT1908290.9121760098316483No Hit
AAGCTGCCAGCTGAAGAACTGT1835150.8772145766327705No Hit
AAGCTGCCAGCTGAAGAACT1699990.8126071482603293No Hit
TTGCATAGTCACAAAAGTGATC1642180.7849735626269259No Hit
TCCCTGAGACCCTTAACCTGTGA1590010.7600359365675129No Hit
TGAGGTAGTAGTTTGTATAGTT1498160.7161309920868328No Hit
TCTTTGGTTATCTAGCTGTAT1452740.6944199133899086No Hit
TCTTTGGTTATCTAGCTGTATGA1411680.6747929452856438No Hit
TGAGGTAGTAGGTTGTATAGT1405360.6717719409403211No Hit
TGAGGTAGTAGTTTGTGCTGTT1385350.6622070205368545No Hit
TAAAGCTAGAGAACCGAAAGT1378960.6591525557003651No Hit
ACCTTGGCTTTAGACTGCTTACT1376110.6577902357028699No Hit
TAACAGTCTACAGTCATGGCT1296460.6197169768255028No Hit
TTCACAGTGGCTAAGTTCTG1278380.6110746099641996No Hit
AACATTCATTGCTGTCGGTGGGT1254850.5998271048620722No Hit
ACCGTGGCTTTAGATTGTTACT1145260.5474423159057552No Hit
TCCCTGAGACCCTAACTTGTGA1115810.533365009264971No Hit
TCACAGTGAACCGGTCTCTTTT1115590.5332598477213046No Hit
TTCACAGTGGCTAAGTTCTGC1091600.5217924593915114No Hit
CCCTGAGACCCTTAACCTGTGA988820.47266289821868296No Hit
AGCTACATCTGGCTACTGGGTCT966880.4621754242730529No Hit
AACATTCAACGCTGTCGGTGAGA947450.452887747939252No Hit
TGAGGTAGTTGGTTGTATAGTT880430.42085171768236385No Hit
TCTTTGGTTATCTAGCTGTATG861440.41177436443589555No Hit
AACCCGTAGATCCGAACTTGT838770.4009379453681No Hit
AGAATAATGCCAGCAGTCGGTC830150.3968175248844478No Hit
TAAAGGGAATTTGCGACTGTT804370.38449450399482415No Hit
AACATTCAACGCTGTCGGTGG735140.35140207823110636No Hit
AGCTACATTGTCTGCTGGGTTT723540.3458571968377924No Hit
CCTGTCTGAGGGTCGCT673750.32205722747804216No Hit
TTCCCTTTGTCATCCTATGCCTG664050.3174205594163917No Hit
AGACCTGTAGATGCTAACTTGT654050.3126404892497417No Hit
TATTGCACTTGTCCCGGCCTGT587650.28090082334318583No Hit
TTCCCTTTGTCATCCTATGCCT568100.2715557861673852No Hit
TGAGGTAGTAGGTTGTATAGTTT561980.2686303832253954No Hit
CCTTGGCTTTAGACTGCTTACT560280.26781777129706485No Hit
TGAGATGAAGCACTGTAGCTCT558260.2668521971234016No Hit
AACCCGTAGATCCGAACTTGTGA525620.25125004809945606No Hit
TGCTCAGTAGTCAGTGTAGATCC524410.25067165960929144No Hit
TCCAGCATCAGTGATTTTGTT523310.2501458518909599No Hit
TGCTCAGTAGTCAGTGTAGATC517980.24759807449213547No Hit
TAAAGCTAGAGAACCGAAAGTAA500510.23924729191099797No Hit
AGCTGGTGTTGTGAATCAGGCCG483590.2311594131890262No Hit
TTCAAGTAATCCAGGATAGGC482070.23043284252369542No Hit
AGCTACATTGTCTGCTGGGTTTC459970.21986888745539895No Hit
TGAGGTAGTAGGTTGTGTGGTT458800.21930961924590092No Hit
AAGCTGCCAGCTGAAGAACTGC452870.21647503763707748No Hit
TTCAAGTAATCCAGGATAGGCTT439270.2099741422104335No Hit
AACATTCAACGCTGTCGGTG437210.2089894477561036No Hit
TCCCTGAGACCCTAACTTGTG428770.20495506853545103No Hit
ACCATCGACCGTTGACTGTACC427460.2043288793436199No Hit
TGAGATGAAGCACTGTAGCTC406700.19440545367765452No Hit
TAGCTTATCAGACTGGTGTTGG401460.19190069691032996No Hit
TCTTTGGTTATCTAGCTGTATGT398450.19046189579016828No Hit
TACCCTGTAGAACCGAATGTGT397460.18998866884366994No Hit
TAACAGTCTACAGCCATGGTCG394140.18840168554834216No Hit
TCCCTGAGACCCTAACTTGT389990.18641795642918244No Hit
TAACGGAACCCATAATGCAGCTG380680.18196771110403132No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT379370.18134152191220015No Hit
TGAGGTAGTAGATTGAATAGTT379010.18116943938620075No Hit
TCACAGTGAACCGGTCTCT376180.17981667952903882No Hit
TCCAGCATCAGTGATTTTGTTG365170.17455382227555719No Hit
TGAGATGAAGCACTGTAGCT364670.17431481876722468No Hit
TAGCAGCACGTAAATATTGGAG355260.16981677274040705No Hit
TAAGGCACGCGGTGAATGCC353110.16878905765457733No Hit
AAGCTGCCAGTTGAAGAGCTGT352190.1683492911992455No Hit
TAACAGTCTACAGCCATGGTC345540.16517054453842328No Hit
TGAGGTAGTTGGTTGTATTGTT345140.16497934173175727No Hit
ACCATCGACCGTTGACTGTGCC337400.16127956742277022No Hit
AACAGTCAACGCTGTCGGTGAG330330.15790005781494867No Hit
TTCAAGTAATCCAGGATAGGTT308980.14769460800915096No Hit
AGCAGCATTGTACAGGGCTATGA307570.14702061811565334No Hit
AGCTACATTGTCTGCTGGGTT293710.14039544086467645No Hit
CTTTGGTTATCTAGCTGTATGA290030.13863637504334925No Hit
CAGGCTGGTTAGATGGTTGTCT280990.1343151916126977No Hit
TCCCTGAGACCCTTAACCTGTGG278630.1331870950533683No Hit
TAAAGCTAGAGAACCGAAAGTAT273230.1306058571633773No Hit
AACTTTCAACGCTGTCGGTGAG270390.1292483172360487No Hit
AACATTCAACGCTGTCGGTGT263430.12592138840006034No Hit
TATTGCACTCGTCCCGGCCTC261640.12506575584022997No Hit
TTCACAGTGGCTAAGTTCTGCT260650.12459252889373162No Hit
TATTGCACTCGTCCCGGCCT252710.12079715318141154No Hit
CTACGCCTGTCTGAGGGTCGCT251480.1202092045509136No Hit
TTGCATAGTCACAAAAATGAGC247340.11823025550192051No Hit
ATTGCACTCGTCCCGGCCTCCC246600.11787653030958842No Hit
TGTAAACATCCTTGACTGGAAGCT246290.11772834813442226No Hit
AACATTCATTGCTGTCGGTGGGTT244170.11671497325909247No Hit
TCCCTGAGACCCTTAACCTG242770.11604576343576148No Hit
ACCATCGACCGTTGACTGTGCCT238230.11387561158010238No Hit
TCCCTGAGACCCTTAACCTGTGT237080.11332590351093763No Hit
TGAGGTAGTAGTTTGTGCTGTTT234530.11210698561844189No Hit
AACATTCAACGCTGTCGGTGAGTT233020.11138519502327776No Hit
AACATTCAACGCTGTCGGTGAT231830.1108163666734464No Hit
TGAGGTAGTAGGTTGTGTGGTTT231810.11080680653311309No Hit
CTTTTTGCGGTCTGGGCTTGC231750.11077812611211321No Hit
CTGGACAACTCTTAGCGG227360.10867967530895385No Hit
TAGCAGCACGGAATGGTTTGT219670.10500380135080004No Hit
CCTTGGCTTTAGACTGCTTACTG218640.10451145412363509No Hit
TGAGGTAGTAGTTTGTATAGT212440.1015478106203121No Hit
AAGCCCTTACCCCAAAAAGCAT210500.10062047700798199No Hit
CTGTCTGAGGGTCGCT210150.10045317455214925No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCAATTA52.2616673E-46015.39842
TTCATAT52.2616673E-46015.39842
CGTATAC500.05019.176344
GAAGATA151.9930485E-74780.16844
ACCCTCC900.04780.16844
GTGTAAC800.04087.99940
TCAAAAG900.04010.26542
GCTCATA202.7102942E-103773.537640
TAACAAC1150.03701.356443
TTCAAAA850.03693.736641
CATACTC3400.03690.570844
CCTCTTG106.3656404E-43585.126244
CACCCTC1100.03571.938543
GTAACAA1100.03554.552742
GTTACAG1400.03550.824541
TAAGCAT200.03532.95237
CCCACGA57.6065207E-43280.598136
CGCCAAA154.765752E-103280.59836
TCCATTC400.03274.277343
CCACTCA304.783942E-103274.276943