FastQCFastQC Report
Tue 6 Dec 2016
56_CAGATC_L005_R1_001_prinseq_good_CRFk.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename56_CAGATC_L005_R1_001_prinseq_good_CRFk.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24038395
Sequences flagged as poor quality0
Sequence length15-50
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG254170210.573509587474538No Hit
AACATTCAACGCTGTCGGTGAGT16285016.7745829120455No Hit
TTCAAGTAATCCAGGATAGGCT10255774.266412129428774No Hit
TGAGGTAGTAGGTTGTATAGTT8335813.4677065586117544No Hit
TCACAGTGAACCGGTCTCTTT6267672.60735793716677No Hit
AACATTCAACGCTGTCGGTGA5486162.2822488772648923No Hit
TAGCTTATCAGACTGGTGTTGGC3630811.510421140845718No Hit
TAAAGCTAGAGAACCGAAAGTA3530551.4687128653972115No Hit
AACCCGTAGATCCGAACTTGTG3300781.3731282808190814No Hit
TTAAAGGGAATTTGCGACTGTT3263011.357415917327259No Hit
TCCCTGAGACCCTTAACCTGT2581251.0738029722866274No Hit
TCTTTGGTTATCTAGCTGTATGA2441721.015758331619062No Hit
AGCTACATCTGGCTACTGGGTCTC2327710.9683300403375515No Hit
TAAAGCTAGAGAACCGAAAGT2259140.9398048413798009No Hit
TCTTTGGTTATCTAGCTGTAT2250740.9363104317072749No Hit
TCCCTGAGACCCTTAACCTGTG2160530.898782967831255No Hit
AACATTCATTGCTGTCGGTGGG2076030.8636308705302496No Hit
TGAGGTAGTAGTTTGTGCTGTT1908150.7937925972179091No Hit
AAGCTGCCAGCTGAAGAACTGT1758760.7316461851966406No Hit
TGAGGTAGTAGTTTGTATAGTT1758250.7314340246093801No Hit
TATTGCACTCGTCCCGGCCTCC1696910.7059165139769107No Hit
TACCCTGTAGAACCGAATTTGT1560620.6492197170401768No Hit
TTCACAGTGGCTAAGTTCTG1539600.640475372835832No Hit
AACATTCATTGCTGTCGGTGGGT1487750.618905713131014No Hit
TACCCTGTAGATCCGGATTTGT1448060.6023946274283287No Hit
TTGCATAGTCACAAAAGTGATC1438850.5985632568230949No Hit
TCCCTGAGACCCTTAACCTGTGA1422190.5916326776392516No Hit
TGAGGTAGTAGGTTGTATAGT1421840.5914870772362298No Hit
TCACAGTGAACCGGTCTCTT1405230.5845772981099612No Hit
TCTTTGGTTATCTAGCTGTATG1312420.545968231240064No Hit
TCCAGCATCAGTGATTTTGTT1310220.5450530287067834No Hit
TTCACAGTGGCTAAGTTCTGC1284940.5345365195970863No Hit
TAAAGGGAATTTGCGACTGTT1225510.509813571163965No Hit
TCACAGTGAACCGGTCTCTTTT1172260.48766150984705925No Hit
AACCCGTAGATCCGAACTTGT1159740.4824531754303896No Hit
AAGCTGCCAGCTGAAGAACT1153540.47987396829114426No Hit
TGAGGTAGTTGGTTGTATAGTT1141290.47477795418537716No Hit
TACCCTGTAGAACCGAATGTGT993310.41321810378771123No Hit
ACCTTGGCTTTAGACTGCTTACT949610.39503885346754636No Hit
CCCTGAGACCCTTAACCTGTGA918430.38206793756405116No Hit
TCCCTGAGACCCTAACTTGTGA894000.3719050294331215No Hit
TTCCCTTTGTCATCCTATGCCTG833970.3469324803091055No Hit
TAACAGTCTACAGTCATGGCT833890.3468992002169862No Hit
TGAGATGAAGCACTGTAGCTCT796730.3314405974275737No Hit
ACCGTGGCTTTAGATTGTTACT782550.32554170109942865No Hit
AGAATAATGCCAGCAGTCGGTC771260.32084504809909314No Hit
AGCTACATCTGGCTACTGGGTCT754900.3140392692606973No Hit
TGAGATGAAGCACTGTAGCTC744790.30983349761912143No Hit
TTCCCTTTGTCATCCTATGCCT730660.3039554013485509No Hit
TGAGGTAGTAGGTTGTATAGTTT719270.2992171482330663No Hit
TCCAGCATCAGTGATTTTGTTG713620.2968667417271411No Hit
CTGGACAACTCTTAGCGG679050.28248558192009077No Hit
TACCCTGTAGAACCGAATTTGC654980.2724724342036979No Hit
TACCCTGTAGAACCGAATTTGCG605820.25202181759639114No Hit
TATTGCACTTGTCCCGGCCTGT601360.25016645246074043No Hit
CCTGTCTGAGGGTCGCT594800.24743748490695822No Hit
AACCCGTAGATCCGAACTTGTGA588080.2446419571689374No Hit
TAGCTTATCAGACTGGTGTTGG581130.2417507491660737No Hit
CTTTGGTTATCTAGCTGTATGA574110.23883042108260558No Hit
TAAAGCTAGAGAACCGAAAGTAA573170.23843938000020384No Hit
TGAGATGAAGCACTGTAGCT572920.23833537971233104No Hit
TGAGGTAGTAGATTGAATAGTT556060.23132160029818963No Hit
TCTTTGGTTATCTAGCTGTATGT552580.2298739162910003No Hit
TTCAAGTAATCCAGGATAGGC538800.22414142042345175No Hit
AACATTCAACGCTGTCGGTGG529230.22016028940368107No Hit
AACATTCAACGCTGTCGGTGAGA527460.21942396736554168No Hit
TGCTCAGTAGTCAGTGTAGATCC505770.2104009023896978No Hit
TAAAGCTAGAGAACCGAAAGTAT503630.2095106599255067No Hit
TTCAAGTAATCCAGGATAGGTT488730.20331224276828797No Hit
TAAGGCACGCGGTGAATGCC486240.20227639990107493No Hit
TCCCTGAGACCCTAACTTGT482170.2005832752145058No Hit
ACCATCGACCGTTGACTGTGCC467290.19439317808031692No Hit
TACCCTGTAGATCCGGATTTGTG460170.19143124988169966No Hit
CATTATTACTTTTGGTACGCG457270.19022484654237523No Hit
AGCTGGTGTTGTGAATCAGGCCG451340.1877579597140325No Hit
AGCTACATTGTCTGCTGGGTTTC448570.1866056365244019No Hit
TGCTCAGTAGTCAGTGTAGATC439650.1828949062531005No Hit
TGAGGTAGTTGGTTGTATTGTT423930.17635536815165906No Hit
AGCTACATTGTCTGCTGGGTTT415010.17264463788035767No Hit
AACATTCAACGCTGTCGGTG410480.17076015266410258No Hit
TTCAAGTAATCCAGGATAGGCTT402980.16764014402791866No Hit
TCCCTGAGACCCTAACTTGTG388900.16178284781492275No Hit
TGAGGTAGTAGGTTGTGTGGTT385040.16017708337016678No Hit
ACCATCGACCGTTGACTGTACC381110.15854219884480641No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT360570.1499975351931774No Hit
CCTTGGCTTTAGACTGCTTACT356860.1484541709211451No Hit
TAAATCTAGAGAACCGAAAGTA356200.1481796101611609No Hit
ACTGGACAACTCTTAGCGG355710.14797576959693026No Hit
AGCAGCATTGTACAGGGCTATGA341090.14189383276212908No Hit
TGAGGTAGTAGTTTGTGCTGTTT341000.14185639265849487No Hit
AACAGTCAACGCTGTCGGTGAG337400.1403587885131266No Hit
TTCACAGTGGTTAAGTTCTG332520.1383287028938496No Hit
TGTAAACATCCTTGACTGGAAGCT331750.1380083820072014No Hit
ACCATCGACCGTTGACTGTGCCT322060.13397733084925179No Hit
GTACAGTACTGTGATAACTGA320540.1333450090989852No Hit
AAGCTGCCAGCTGAAGAACTGC318160.13235492635843615No Hit
AAGCTGCCAGTTGAAGAGCTGT308860.12848611564956813No Hit
AACATTCATTGCTGTCGGTGGGTT304600.12671395074421568No Hit
TCCCTGAGACCCTTAACCTGTGT303350.12619394930485167No Hit
TTTGGCAATGGTAGAACTCACA300500.1250083460231018No Hit
TAGCAGCACGTAAATATTGGAG292220.12156385648875476No Hit
TAACAGTCTACAGCCATGGTCG286600.11922593001737428No Hit
TGAGGTAGTTGTTTGTACAGTT282080.11734560481263412No Hit
TCACAGTGAACCGGTCTCT278860.11600608110483249No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT278680.11593120089756408No Hit
TCACAGTGAACCGGTCTCTTTG272480.11335199375831873No Hit
AACATTCAACGCTGTCGGTGAGTT272080.11318559329772226No Hit
TAACGGAACCCATAATGCAGCTG268530.11170878920992854No Hit
AACATTCAACGCTGTCGGTGT267850.11142590842691454No Hit
CAGGCTGGTTAGATGGTTGTCT264420.10999902447729976No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTG261230.10867198080404288No Hit
ACCATTGACCGTTGACTGTACC260130.10821437953740255No Hit
CTACGCCTGTCTGAGGGTCGCT259160.10781085842045612No Hit
TCCCTGAGACCCTTAACCTG254560.10589725312359664No Hit
AACTTTCAACGCTGTCGGTGAG248970.1035718066867609No Hit
TCTTTGGTTATCTAGCTGTA248550.10339708620313462No Hit
TAACAGTCTACAGCCATGGTC243100.10112987992750763No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CACTCAC51.984016E-46422.781244
CCACTCA201.0186341E-104817.08644
ACAAATT300.04281.85444
CATATAT58.604328E-43084.641837
CGCCCAT109.2795223E-42969.751243
ACGCAGC900.02969.75143
GCGCCCA100.00112764212694.060842
CAAAGAA27000.02550.274239
GGGCGAC50.00130544632504.314235
GTTACAG1050.02486.314741
CCAATCA600.02474.792543
TCCAGTC9800.02457.69744
TCCAATC550.02449.146242
CCAGTCA5900.02340.50544
CCAAAGA27100.02293.111338
CAAACTA100.00157440422280.068840
CACGGTT750.02262.070637
CCAAGCC102.0127209E-62212.951733
ACGACTT50.00167183582212.951733
AACTCCA34950.02205.246644