FastQCFastQC Report
Tue 6 Dec 2016
57_ACTTGA_L005_R1_001_prinseq_good_mlLi.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename57_ACTTGA_L005_R1_001_prinseq_good_mlLi.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences29120780
Sequences flagged as poor quality0
Sequence length15-50
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG26623809.142543571978498No Hit
AACATTCAACGCTGTCGGTGAGT16610765.7040917173235055No Hit
TTCAAGTAATCCAGGATAGGCT13825624.747681895883284No Hit
TCACAGTGAACCGGTCTCTTT10603913.6413550735934956No Hit
TGAGGTAGTAGGTTGTATAGTT9583873.291075994530366No Hit
AACATTCAACGCTGTCGGTGA6443052.212526587543328No Hit
TAGCTTATCAGACTGGTGTTGGC4456941.5305015868393634No Hit
TAAAGCTAGAGAACCGAAAGTA4171051.432327705507888No Hit
TTAAAGGGAATTTGCGACTGTT3620301.243201590067299No Hit
TAAAGCTAGAGAACCGAAAGT3294991.1314909834145925No Hit
AACATTCATTGCTGTCGGTGGG2861230.9825389292457138No Hit
AGCTACATCTGGCTACTGGGTCTC2531960.8694684689077697No Hit
AAGCTGCCAGCTGAAGAACTGT2382410.818113388446326No Hit
TCACAGTGAACCGGTCTCTT2329010.7997759675393311No Hit
TCTTTGGTTATCTAGCTGTATGA2262740.7770190221553132No Hit
AACCCGTAGATCCGAACTTGTG2236690.768073520008736No Hit
TTGCATAGTCACAAAAGTGATC2160050.7417555436358504No Hit
TCTTTGGTTATCTAGCTGTAT2140110.7349081995743246No Hit
TCCCTGAGACCCTTAACCTGT2128890.7310552807994841No Hit
TCCCTGAGACCCTTAACCTGTG1888350.6484544713431439No Hit
AACATTCATTGCTGTCGGTGGGT1859130.6384203994535861No Hit
ACCTTGGCTTTAGACTGCTTACT1837720.631068261221025No Hit
TGAGGTAGTAGTTTGTGCTGTT1809370.6213329450653451No Hit
TATTGCACTCGTCCCGGCCTCC1777130.6102618130420957No Hit
TGAGGTAGTAGTTTGTATAGTT1750170.6010038192658301No Hit
TTCACAGTGGCTAAGTTCTG1708630.5867390914666434No Hit
TCACAGTGAACCGGTCTCTTTT1693020.5813786581266024No Hit
TCCCTGAGACCCTTAACCTGTGA1680620.5771205304253526No Hit
TGAGGTAGTAGGTTGTATAGT1632730.5606752291662518No Hit
TCCAGCATCAGTGATTTTGTT1537150.5278533061271024No Hit
TTCACAGTGGCTAAGTTCTGC1356270.4657395852720978No Hit
TAAAGGGAATTTGCGACTGTT1352420.46441750530033876No Hit
TCTTTGGTTATCTAGCTGTATG1325280.455097699992926No Hit
TACCCTGTAGAACCGAATTTGT1319330.4530544854911166No Hit
AAGCTGCCAGCTGAAGAACT1302420.4472476355372349No Hit
TAGCAGCACGTAAATATTGGAG1261300.43312713464405833No Hit
TAACAGTCTACAGCCATGGTCG1215540.4174132698368656No Hit
AGCTACATCTGGCTACTGGGTCT1149020.39457047510403226No Hit
TGAGGTAGTTGGTTGTATAGTT1146130.3935780566317248No Hit
TACCCTGTAGATCCGGATTTGT1143180.39256503431570167No Hit
TAACAGTCTACAGTCATGGCT1090720.37455040696025316No Hit
TTCAAGTAATCCAGGATAGGTT1077020.36984586264516267No Hit
TGGACAACTCTTAGCGG1076340.36961235241638446No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT1021480.3507735713123069No Hit
AGCTGGTGTTGTGAATCAGGCCG997580.3425663735655432No Hit
TACCCTGTAGAACCGAATGTGT979500.33635774865920487No Hit
AACCCGTAGATCCGAACTTGT942150.3235318559461663No Hit
TGAGATGAAGCACTGTAGCTCT929150.3190676898077593No Hit
TCCAGCATCAGTGATTTTGTTG916230.31463099546097323No Hit
CCCTGAGACCCTTAACCTGTGA904660.310657887597791No Hit
TAGCTTATCAGACTGGTGTTGG889180.305342095919134No Hit
TCCCTGAGACCCTAACTTGTGA878570.3016986495554034No Hit
ACCGTGGCTTTAGATTGTTACT867240.2978079570670841No Hit
TATTGCACTTGTCCCGGCCTGT819660.2814691090005144No Hit
TTCCCTTTGTCATCCTATGCCT791020.2716342076002085No Hit
CCTGTCTGAGGGTCGCT775100.26616732106763624No Hit
TGAGATGAAGCACTGTAGCTC751010.2578948778157728No Hit
TTCAAGTAATCCAGGATAGGC714560.24537804275847008No Hit
CATTATTACTTTTGGTACGCG713630.2450586831808763No Hit
AGAATAATGCCAGCAGTCGGTC702810.24134312336414068No Hit
TGAGGTAGTAGGTTGTGTGGTT681520.234032192819011No Hit
TGAGGTAGTAGGTTGTATAGTTT668210.22946157348807278No Hit
TAAGGCACGCGGTGAATGCC641750.2203752784094382No Hit
TTCCCTTTGTCATCCTATGCCTG608320.20889550348582694No Hit
TGAGGTAGTAGATTGAATAGTT604750.20766957478474132No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCC592990.20363122141645928No Hit
TGAGATGAAGCACTGTAGCT588750.20217521646054812No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTC565390.19415345330722597No Hit
TGCTCAGTAGTCAGTGTAGATCC562970.19332243161069174No Hit
AGCTACATTGTCTGCTGGGTTT553930.19021811915752257No Hit
TAAAGCTAGAGAACCGAAAGTAA539100.18512553578578597No Hit
CTTTGGTTATCTAGCTGTATGA529470.18181861886941217No Hit
TACCCTGTAGAACCGAATTTGC522870.17955219606068243No Hit
CCTTGGCTTTAGACTGCTTACT520740.17882075960877422No Hit
TACCCTGTAGAACCGAATTTGCG519900.17853230579675405No Hit
CTGGACAACTCTTAGCGG515340.176966413674359No Hit
TAAAGCTAGAGAACCGAAAGTAT514450.17666078999257576No Hit
AACATTCAACGCTGTCGGTGAGA507900.17441153705360915No Hit
TGCTCAGTAGTCAGTGTAGATC488470.16773932566366698No Hit
TACTGCATCAGGAACTGATTGGC482130.1655621861777054No Hit
TCTTTGGTTATCTAGCTGTATGT480680.16506425995457538No Hit
TCACAGTGAACCGGTCTCTTTG474860.1630656871141501No Hit
TGTAAACATCCTTGACTGGAAGCT469080.1610808501695353No Hit
AACATTCAACGCTGTCGGTG467490.1605348483110686No Hit
AACATTCAACGCTGTCGGTGG467020.16037345153529542No Hit
AGCTACATTGTCTGCTGGGTTTC445150.15286335050091376No Hit
TCACAGTGAACCGGTCTCT443800.15239976401730998No Hit
TACCCTGTAGATCCGGATTTGTG436360.14984488739656013No Hit
TCCCTGAGACCCTAACTTGT431040.14801801325376585No Hit
TGAGGTAGTTGGTTGTATTGTT430870.1479596356965713No Hit
GAATACCAGGTGCTGTAAGCTT422210.14498581425360174No Hit
ATAAAGCTAGAGAACCGAAAGT416850.143145204214997No Hit
TAGCAGCACGGAATGGTTTGT416190.142918561934124No Hit
TTCAAGTAATCCAGGATAGGCTT413980.14215965369059483No Hit
TAAATCTAGAGAACCGAAAGTA413600.14202916268039525No Hit
AAGCTGCCAGTTGAAGAGCTGT411510.1413114621242975No Hit
AACCCGTAGATCCGAACTTGTGA402010.13804918686930776No Hit
TGAGGTAGTTGTTTGTACAGTT401440.1378534503540084No Hit
TTCACAGTGGTTAAGTTCTG393860.13525049809792183No Hit
ACCATCGACCGTTGACTGTGCC391850.13456026933344506No Hit
TAACACTGTCTGGTAACGATG371550.1275893022096249No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCT366580.12588261715517235No Hit
AGCAGCATTGTACAGGGCTATGA362860.12460517884479742No Hit
GTACAGTACTGTGATAACTGA342540.11762734377307202No Hit
AACAGTCAACGCTGTCGGTGAG341110.11713628549784724No Hit
AACATTCATTGCTGTCGGTGGGTT340490.11692337911278475No Hit
TTCAAGTAATCCAGGATAGG338060.1160889234422979No Hit
TCCCTGAGACCCTAACTTGTG335110.11507590112627478No Hit
AAGCTGCCAGCTGAAGAACTGC334630.11491107037654898No Hit
TTGCATAGTCACAAAAATGAGC325950.11193038098567415No Hit
TAAATCTAGAGAACCGAAAGT315290.1082697647521804No Hit
GGACAACTCTTAGCGG312190.10720523282686796No Hit
TAACGGAACCCATAATGCAGCTG312050.10715715719153128No Hit
ACCATCGACCGTTGACTGTACC309340.10622655025037105No Hit
TGTAAACATCCTACACTCTCAGCT294600.10116487264420802No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATCCAC56.9876283E-43423.029338
ACTCGAT107.8548404E-43228.017844
ACCCTCC1400.02997.445344
CGTATAC800.02824.515644
GCTTGCG3500.02663.874843
GTTACAG1500.02636.890141
CTTATGC251.265189E-62582.414344
CAAAGAA34850.02496.832839
CCAATCA451.8189894E-122343.223442
ACGCAGC2000.02330.890643
TCTCCTA100.00151212262326.66841
GGTGATA1150.02245.577644
CCAAAGA35500.02208.09538
TCATTAT302.1859942E-62152.01244
TCAAAAG1650.02118.991543
CGTTTGC1100.02118.991243
CGTATGC8450.02101.076744
GCCAAAG34450.02068.531737
AAGCATA1000.02053.817938
TTCAAAA1550.02040.87242