FastQCFastQC Report
Tue 6 Dec 2016
74_GATCAG_L005_R1_001_prinseq_good_1F1j.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename74_GATCAG_L005_R1_001_prinseq_good_1F1j.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20337189
Sequences flagged as poor quality0
Sequence length15-50
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG19614529.644656397695867No Hit
AACATTCAACGCTGTCGGTGAGT10814575.317632638414286No Hit
TGAGGTAGTAGGTTGTATAGTT10150854.991274851209771No Hit
TTCAAGTAATCCAGGATAGGCT10111184.971768713955503No Hit
TCACAGTGAACCGGTCTCTTT5764312.834369095945364No Hit
AACATTCAACGCTGTCGGTGA4607802.2657015185333624No Hit
TAAAGCTAGAGAACCGAAAGTA2820951.3870894350246732No Hit
TCTTTGGTTATCTAGCTGTATGA2229201.0961200193399392No Hit
TTAAAGGGAATTTGCGACTGTT2154811.059541709525343No Hit
TCTTTGGTTATCTAGCTGTAT2128411.0465605644909923No Hit
TAGCTTATCAGACTGGTGTTGGC2093821.0295523142357579No Hit
AACCCGTAGATCCGAACTTGTG2086181.025795649536423No Hit
TGAGGTAGTAGGTTGTATAGT2018440.9924872114823735No Hit
TGAGGTAGTAGTTTGTGCTGTT1920050.9441078607274586No Hit
TGAGGTAGTAGTTTGTATAGTT1900200.9343474164497365No Hit
AACATTCATTGCTGTCGGTGGG1878450.9236527230975726No Hit
TAAAGCTAGAGAACCGAAAGT1840640.9050611665161788No Hit
TATTGCACTCGTCCCGGCCTCC1783380.876905849672735No Hit
TCCCTGAGACCCTTAACCTGT1755480.8631871395796145No Hit
TCCCTGAGACCCTTAACCTGTG1656220.8143800010906128No Hit
TTCACAGTGGCTAAGTTCTG1568420.7712078596506134No Hit
AGCTACATCTGGCTACTGGGTCTC1561700.7679035681873242No Hit
TCACAGTGAACCGGTCTCTT1445140.7105898460205096No Hit
TCCAGCATCAGTGATTTTGTT1414950.6957451199376669No Hit
TTGCATAGTCACAAAAGTGATC1385250.6811413317740225No Hit
TACCCTGTAGAACCGAATGTGT1259250.6191858668373491No Hit
AAGCTGCCAGCTGAAGAACTGT1189040.5846629049865248No Hit
TTCACAGTGGCTAAGTTCTGC1127110.5542113022601108No Hit
TCACAGTGAACCGGTCTCTTTT1087790.5348772635195552No Hit
TAACAGTCTACAGTCATGGCT1067130.5247185341100975No Hit
TGAGGTAGTTGGTTGTATAGTT1060270.5213454032413232No Hit
AACATTCATTGCTGTCGGTGGGT1045610.514136934066945No Hit
TCCCTGAGACCCTTAACCTGTGA1020880.5019769447980249No Hit
AAGCTGCCAGCTGAAGAACT976990.480395791178417No Hit
TACCCTGTAGAACCGAATTTGT973820.4788370703542166No Hit
TCTTTGGTTATCTAGCTGTATG970260.47708658261473597No Hit
ACCTTGGCTTTAGACTGCTTACT957770.4709451242253785No Hit
TAAAGGGAATTTGCGACTGTT943900.4641251059819526No Hit
TACCCTGTAGATCCGGATTTGT878280.43185909321096444No Hit
ACCGTGGCTTTAGATTGTTACT852440.4191533057985546No Hit
AGCTACATCTGGCTACTGGGTCT785390.3861841476715391No Hit
AACCCGTAGATCCGAACTTGT728950.3584320330602228No Hit
CCCTGAGACCCTTAACCTGTGA701270.34482149917572186No Hit
TGAGGTAGTAGGTTGTATAGTTT696300.3423777002809975No Hit
AGAATAATGCCAGCAGTCGGTC683020.33584779096068784No Hit
TCCAGCATCAGTGATTTTGTTG675330.332066540759394No Hit
TCCCTGAGACCCTAACTTGTGA657280.323191174552196No Hit
AACATTCAACGCTGTCGGTGG624740.30719092987728047No Hit
TGCTCAGTAGTCAGTGTAGATC619170.3044521049590482No Hit
TGCTCAGTAGTCAGTGTAGATCC598180.2941311112366611No Hit
TAAAGCTAGAGAACCGAAAGTAA591960.29107267479296184No Hit
TTCAAGTAATCCAGGATAGGC582300.28632275581448347No Hit
TCTTTGGTTATCTAGCTGTATGT581350.28585563127726255No Hit
TGAGGTAGTAGATTGAATAGTT564360.2775014777115952No Hit
TTCCCTTTGTCATCCTATGCCTG558120.2744332070671124No Hit
CTTTGGTTATCTAGCTGTATGA543740.26736241670370475No Hit
CCTGTCTGAGGGTCGCT529730.26047355905479364No Hit
TATTGCACTTGTCCCGGCCTGT529440.26033096314343146No Hit
TTCCCTTTGTCATCCTATGCCT523970.25764130922911715No Hit
TGAGATGAAGCACTGTAGCTCT498160.24495027311788273No Hit
TAAAGCTAGAGAACCGAAAGTAT491230.2415427225463657No Hit
TTCAAGTAATCCAGGATAGGTT486470.23920218275986913No Hit
AACCCGTAGATCCGAACTTGTGA461590.22696843698507205No Hit
TTCAAGTAATCCAGGATAGGCTT460820.22658982025490346No Hit
AGCTACATTGTCTGCTGGGTTT451210.2218644867783842No Hit
TAAGGCACGCGGTGAATGCC437770.21525590385180568No Hit
AAGCTGCCAGTTGAAGAGCTGT426840.20988151312356884No Hit
TGAGATGAAGCACTGTAGCT421060.20703942909710876No Hit
TACCCTGTAGAACCGAATTTGC420670.20684766218182857No Hit
CCTTGGCTTTAGACTGCTTACT413460.20330243279934115No Hit
TACCCTGTAGAACCGAATTTGCG411020.20210266030374208No Hit
CATTATTACTTTTGGTACGCG409170.20119299673125915No Hit
TGAGGTAGTAGGTTGTGTGGTT397790.19559733648539138No Hit
ACCATCGACCGTTGACTGTGCC397410.19541048667050298No Hit
AACATTCAACGCTGTCGGTGAGA390890.19220453721504974No Hit
TAGCTTATCAGACTGGTGTTGG373120.18346684981882205No Hit
TGAGATGAAGCACTGTAGCTC372420.1831226527913961No Hit
TCCCTGAGACCCTAACTTGT369620.18174586468169224No Hit
AACATTCAACGCTGTCGGTG366940.18042808177668998No Hit
AGCTACATTGTCTGCTGGGTTTC360980.17749748994317752No Hit
TTTGGCAATGGTAGAACTCACA359650.17684351559106815No Hit
TAACGGAACCCATAATGCAGCTG355470.174788167627296No Hit
AGCTGGTGTTGTGAATCAGGCCG331470.16298712668697724No Hit
ACCATCGACCGTTGACTGTACC325950.16027288727070393No Hit
TGTAAACATCCTTGACTGGAAGCT325780.16018929656404335No Hit
CTGGACAACTCTTAGCGG323940.15928455009195222No Hit
TGAGGTAGTTGGTTGTATTGTT319940.15731770993523245No Hit
TGAGGTAGTAGTTTGTGCTGTTT316930.1558376627173008No Hit
TCCCTGAGACCCTAACTTGTG312440.15362988464138283No Hit
GTACAGTACTGTGATAACTGA306910.15091072812471773No Hit
TACAGTACTGTGATAACTGAAG306350.15063537050277698No Hit
TCACAGTGAACCGGTCTCT296430.14575760691411188No Hit
CAGGCTGGTTAGATGGTTGTCT292910.14402678757619847No Hit
TGAGGTAGTAGTTTGTATAGT288560.1418878489057657No Hit
AGCAGCATTGTACAGGGCTATGA286240.1407470816148682No Hit
TTCACAGTGGTTAAGTTCTG286030.14064382250664043No Hit
ACTGGACAACTCTTAGCGG281090.13821477491309148No Hit
TAACAGTCTACAGCCATGGTC280080.13771814777351973No Hit
TAGCAGCACGTAAATATTGGAG279960.13765914256881814No Hit
TACCCTGTAGATCCGGATTTGTG278520.136951080112399No Hit
AACATTCAACGCTGTCGGTGT277730.13656262918144688No Hit
TTGCATAGTCACAAAAATGAGC275280.13535793958545597No Hit
TAACAGTCTACAGCCATGGTCG266560.13107022804380683No Hit
ACCATCGACCGTTGACTGTGCCT254350.12506644846541967No Hit
CATTGCACTTGTCTCGGTCTGA247100.12150155068136506No Hit
TGAGGTAGTAGGTTGTGTGGTTT245330.12063122391201654No Hit
TATTGCACTCGTCCCGGCCTC244990.12046404249869537No Hit
TGAGGTAGTTGTTTGTACAGTT238030.11704174062600294No Hit
TCTTTGGTTATCTAGCTGTA236020.11605340344725125No Hit
TAAATCTAGAGAACCGAAAGTA234710.11540926329592552No Hit
TGATGTAGTAGGTTGTATAGTT231800.11397838708191185No Hit
TACGACCTCAGATCAGACGAGA226620.11143132907895972No Hit
TATGGCTTTTTATTCCTATCTG224170.11022663948296886No Hit
TTCACAGTGGCTAAGTTCTGCT221490.10890885657796659No Hit
CTACGCCTGTCTGAGGGTCGCT220040.10819587702115567No Hit
TCCCTGAGACCCTTAACCTGTGT217440.1069174309192878No Hit
AACAGTCAACGCTGTCGGTGAG217220.10680925471066822No Hit
TAGCAGCACGGAATGGTTTGT212960.10471456994376166No Hit
TATTGCACTCGTCCCGGCCT211110.10380490637127875No Hit
TGAGGTAGTTGGTTGTATAGT205120.10085956323659084No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATCACGA52.5900346E-45621.243744
CGTATAC950.02958.549344
TTGCGGA1450.02907.539844
AGTCACC258.094503E-102871.457543
GTTACAG750.02770.073541
AGTTTAC201.031367E-92703.695840
ACGCAGC950.02518.822543
CACTCAC451.8189894E-122498.330344
ACAAATT800.02459.29444
ACCCTCC700.02409.10444
GCTTGCG3300.02320.369943
GCCGTAA50.00155733372292.79936
TCCAGTC9950.02288.043744
CCAGTCA5450.02217.554744
GAACCCC1200.02193.474643
TCCAATC353.6379788E-122158.498841
CCGCTAC50.00186041392097.744135
CAGTCAC3200.02020.134444
CATTATG50.00206211581992.510434
CAAAGAA33150.01947.970739