FastQCFastQC Report
Tue 6 Dec 2016
75_TAGCTT_L005_R1_001_prinseq_good_Y_k_.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filename75_TAGCTT_L005_R1_001_prinseq_good_Y_k_.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences25251035
Sequences flagged as poor quality0
Sequence length15-50
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG24996899.899352640396721No Hit
AACATTCAACGCTGTCGGTGAGT13046975.166905039734015No Hit
TTCAAGTAATCCAGGATAGGCT12662195.014523167070181No Hit
TGAGGTAGTAGGTTGTATAGTT12113464.797213262743488No Hit
TCACAGTGAACCGGTCTCTTT6815732.6991883699024615No Hit
AACATTCAACGCTGTCGGTGA5613912.2232395622595273No Hit
TAGCTTATCAGACTGGTGTTGGC3478881.3777177846373425No Hit
TAAAGCTAGAGAACCGAAAGTA3380821.3388837328846124No Hit
AACCCGTAGATCCGAACTTGTG2910421.1525943392023337No Hit
TCTTTGGTTATCTAGCTGTATGA2575491.0199542315790224No Hit
TCTTTGGTTATCTAGCTGTAT2490160.9861615573381447No Hit
TTAAAGGGAATTTGCGACTGTT2444840.9682137781679048No Hit
TCCCTGAGACCCTTAACCTGTG2380750.9428326403254361No Hit
AACATTCATTGCTGTCGGTGGG2301090.9112854185976932No Hit
TGAGGTAGTAGGTTGTATAGT2265520.8971988672939545No Hit
TGAGGTAGTAGTTTGTATAGTT2168610.8588202424177861No Hit
TATTGCACTCGTCCCGGCCTCC2151330.8519769585682329No Hit
TAAAGCTAGAGAACCGAAAGT2104970.8336173150922329No Hit
TGAGGTAGTAGTTTGTGCTGTT2080320.8238553389989757No Hit
TCCCTGAGACCCTTAACCTGT2073210.8210396128317118No Hit
TTGCATAGTCACAAAAGTGATC1952790.7733504785051385No Hit
TTCACAGTGGCTAAGTTCTG1930620.7645706403717709No Hit
AGCTACATCTGGCTACTGGGTCTC1811680.7174676206341641No Hit
TCACAGTGAACCGGTCTCTT1692990.6704636067392881No Hit
TCCCTGAGACCCTTAACCTGTGA1458310.5775248420510288No Hit
TTCACAGTGGCTAAGTTCTGC1427220.5652124754490262No Hit
TACCCTGTAGAACCGAATTTGT1407840.5575375425205342No Hit
AAGCTGCCAGCTGAAGAACTGT1391120.5509160317586982No Hit
TCCAGCATCAGTGATTTTGTT1377870.5456687220939657No Hit
TAACAGTCTACAGTCATGGCT1334340.5284298247576783No Hit
TGAGGTAGTTGGTTGTATAGTT1326470.5253131208285126No Hit
AACATTCATTGCTGTCGGTGGGT1278430.5062881580893615No Hit
TCTTTGGTTATCTAGCTGTATG1240890.4914214407449042No Hit
AAGCTGCCAGCTGAAGAACT1233650.48855423153942007No Hit
TCACAGTGAACCGGTCTCTTTT1210680.4794575747093139No Hit
TACCCTGTAGATCCGGATTTGT1156760.45810399454913436No Hit
ACCTTGGCTTTAGACTGCTTACT1135270.44959345230799447No Hit
TAAAGGGAATTTGCGACTGTT1063340.4211074912374879No Hit
AGAATAATGCCAGCAGTCGGTC1054110.41745219552386664No Hit
TACCCTGTAGAACCGAATGTGT974280.3858376498230667No Hit
AGCTACATCTGGCTACTGGGTCT964450.3819447400868915No Hit
ACCGTGGCTTTAGATTGTTACT951740.37691128304245747No Hit
CCCTGAGACCCTTAACCTGTGA937570.3712996318764756No Hit
TCCCTGAGACCCTAACTTGTGA921170.3648048485933349No Hit
AACCCGTAGATCCGAACTTGT882410.34945498273635117No Hit
TAAAGCTAGAGAACCGAAAGTAA806610.31943641122037175No Hit
TGAGGTAGTAGGTTGTATAGTTT757150.2998490952945097No Hit
TCCAGCATCAGTGATTTTGTTG753410.2983679678872569No Hit
TGCTCAGTAGTCAGTGTAGATC717040.2839645978867797No Hit
TTCAAGTAATCCAGGATAGGC703080.27843611162869164No Hit
TCTTTGGTTATCTAGCTGTATGT680540.26950974484808243No Hit
TAAGGCACGCGGTGAATGCC680490.2694899436795363No Hit
TGAGGTAGTAGATTGAATAGTT678510.26870581740510835No Hit
TGAGATGAAGCACTGTAGCTCT676810.26803257767453886No Hit
TGCTCAGTAGTCAGTGTAGATCC670330.26546634623095644No Hit
CTTTGGTTATCTAGCTGTATGA656020.2597992517930453No Hit
TACCCTGTAGAACCGAATTTGC621160.24599387708266218No Hit
TAGCTTATCAGACTGGTGTTGG620000.24553448997239125No Hit
TAACGGAACCCATAATGCAGCTG619520.2453443987543481No Hit
CATTATTACTTTTGGTACGCG616420.2441167263044861No Hit
AACCCGTAGATCCGAACTTGTGA613130.2428138094141488No Hit
TTCCCTTTGTCATCCTATGCCT610850.24191087612844384No Hit
TTCAAGTAATCCAGGATAGGTT608110.24082577209211423No Hit
AGCTACATTGTCTGCTGGGTTT607070.2404139077863541No Hit
TGAGATGAAGCACTGTAGCT596460.23621209982085883No Hit
TAAAGCTAGAGAACCGAAAGTAT594480.23542797354643089No Hit
TTCCCTTTGTCATCCTATGCCTG576050.2281292628203161No Hit
TACCCTGTAGAACCGAATTTGCG575310.22783620552583292No Hit
AAGCTGCCAGTTGAAGAGCTGT551870.21855341771139283No Hit
CCTGTCTGAGGGTCGCT538880.2134090741231003No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT534830.21180517947086128No Hit
TATTGCACTTGTCCCGGCCTGT524370.2076627750110045No Hit
TTCAAGTAATCCAGGATAGGCTT517330.20487477047970512No Hit
TGAGATGAAGCACTGTAGCTC506780.20069672391646523No Hit
CCTTGGCTTTAGACTGCTTACT499940.19798792405935042No Hit
AACATTCAACGCTGTCGGTGG493630.19548901658882498No Hit
TGAGGTAGTAGGTTGTGTGGTT490710.1943326283457292No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT484570.19190104484826068No Hit
AACATTCAACGCTGTCGGTGAGA476640.1887605795168396No Hit
AGCTACATTGTCTGCTGGGTTTC476380.18865761344039958No Hit
TTCACAGTGGTTAAGTTCTG472650.18718044626685598No Hit
TGAGGTAGTTGGTTGTATTGTT460800.18248756932141594No Hit
ACCATCGACCGTTGACTGTGCC430490.17048410094873337No Hit
AACATTCAACGCTGTCGGTG427250.16920098522694219No Hit
TCCCTGAGACCCTAACTTGTG425410.16847230222444348No Hit
TTGCATAGTCACAAAAATGAGC417200.1652209503491639No Hit
TGTAAACATCCTTGACTGGAAGCT404850.16033006171826225No Hit
TCCCTGAGACCCTAACTTGT404830.16032214125084376No Hit
ACCATCGACCGTTGACTGTACC390050.1544689158285987No Hit
AGCTGGTGTTGTGAATCAGGCCG376160.1489681512064753No Hit
TACCCTGTAGATCCGGATTTGTG373520.14792264950723802No Hit
TTTGGCAATGGTAGAACTCACA372220.14740781912503784No Hit
TAACAGTCTACAGCCATGGTC363920.1441208251463752No Hit
AGCAGCATTGTACAGGGCTATGA360100.14260801586944852No Hit
TCACAGTGAACCGGTCTCT355710.1408694732710956No Hit
GTACAGTACTGTGATAACTGA348860.13815671318027162No Hit
TACAGTACTGTGATAACTGAAG346730.13731318340020518No Hit
TAAATCTAGAGAACCGAAAGTA339610.1344934969992319No Hit
CAGGCTGGTTAGATGGTTGTCT337000.13345987600112233No Hit
TGATGTAGTAGGTTGTATAGTT334180.13234309009511885No Hit
TGAGGTAGTAGTTTGTGCTGTTT328350.13003427384263655No Hit
AACAGTCAACGCTGTCGGTGAG327440.12967389257509643No Hit
TAGCAGCACGTAAATATTGGAG326540.12931747154126552No Hit
AACATTCAACGCTGTCGGTGT325790.12902045401307313No Hit
TGAGGTAGTAGTTTGTATAGT318920.12629977345483065No Hit
CTGGACAACTCTTAGCGG315720.12503249866787639No Hit
TAACAGTCTACAGCCATGGTCG296580.11745261134840611No Hit
AACTTTCAACGCTGTCGGTGAG294830.1167595704492905No Hit
TGAGGTAGTTGTTTGTACAGTT293790.11634770614353035No Hit
TATGGCTTTTTATTCCTATCTG289630.1147002489204898No Hit
ACCATCGACCGTTGACTGTGCCT288520.11426066297876503No Hit
CATTGCACTTGTCTCGGTCTGA287300.11377751446623871No Hit
TATTGCACTCGTCCCGGCCT281430.11145285727891946No Hit
TATTGCACTCGTCCCGGCCTC274530.1087202960195493No Hit
TCTTTGGTTATCTAGCTGTA272300.10783716390239052No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT271720.10760747034725508No Hit
TGAGGTAGTAGGTTGTGTGGTTT270340.10706095809538103No Hit
TCCCTGAGACCCTTAACCTGTGT262360.10390069159541382No Hit
ACTGGACAACTCTTAGCGG261830.1036907992088245No Hit
CAAGCTCGTATCTATAGGTATG257930.10214630806222398No Hit
TCCCTGAGACCCTTAACCTG257870.10212254665996859No Hit
AGCTACATTGTCTGCTGGGTT253870.10053845317627576No Hit
TTCACAGTGGCTAAGTTCTGCT253720.10047904967063727No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC52.4178841E-45818.345743
GCCAATT53.6382064E-44743.4741
GCTTGCG3350.03647.32143
TCCAGTC9900.03589.02444
CGTATAC1050.03579.16444
GGCAATC56.3963735E-43577.615538
TTCAAAA1150.03238.491742
ACGCAGC1000.03200.0943
CAACTAC58.0777146E-43183.62337
TCAAAAG1200.03151.603843
CCAGTCA4400.03028.238844
AAGCATA250.02862.092338
ACTCCAC800.02826.815240
ACAAATT500.02733.1844
CATACTC251.0666918E-62733.1844
CAAAGAA30100.02730.059339
CTTCTGC1800.02660.189542
AATCACT650.02628.057644
AGCTTGC4300.02598.324742
CCAAAGA30150.02527.469538