FastQCFastQC Report
Tue 6 Dec 2016
B1_TTAGGC_L004_R1_001_prinseq_good_RTwd.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameB1_TTAGGC_L004_R1_001_prinseq_good_RTwd.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17780025
Sequences flagged as poor quality0
Sequence length15-50
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG197955411.13358389541072No Hit
AACATTCAACGCTGTCGGTGAGT11141616.266363517486617No Hit
TTCAAGTAATCCAGGATAGGCT9177775.161843135766119No Hit
TCACAGTGAACCGGTCTCTTT5946163.344292260556439No Hit
AACATTCAACGCTGTCGGTGA5229492.941216336872417No Hit
TGAGGTAGTAGGTTGTATAGTT4635432.6070998212882155No Hit
TAGCTTATCAGACTGGTGTTGGC3360911.8902729326871026No Hit
TTAAAGGGAATTTGCGACTGTT2607591.4665839896175623No Hit
TCTTTGGTTATCTAGCTGTAT2176521.2241377613361062No Hit
AGCTACATCTGGCTACTGGGTCTC2028951.1411401277557258No Hit
AACATTCATTGCTGTCGGTGGG1916191.077720644374797No Hit
TCTTTGGTTATCTAGCTGTATGA1854381.042956913727624No Hit
TTCACAGTGGCTAAGTTCTG1826271.0271470371948297No Hit
TCACAGTGAACCGGTCTCTT1569930.8829740115663504No Hit
TCCAGCATCAGTGATTTTGTT1351630.7601957815019945No Hit
AAGCTGCCAGCTGAAGAACT1301650.7320855848065456No Hit
TAACAGTCTACAGTCATGGCT1290690.7259213640025816No Hit
TAAAGGGAATTTGCGACTGTT1241590.6983061047439472No Hit
AAGCTGCCAGCTGAAGAACTGT1213350.6824231124534414No Hit
TCCCTGAGACCCTTAACCTGTG1193110.671039551406705No Hit
TATTGCACTCGTCCCGGCCTCC1168190.6570238230823635No Hit
TTGCATAGTCACAAAAGTGATC1150650.6471588200803992No Hit
TTCACAGTGGCTAAGTTCTGC1106950.6225806769113092No Hit
TGAGGTAGTAGTTTGTATAGTT1081390.6082049940874661No Hit
TAAAGCTAGAGAACCGAAAGTA1058560.5953647421755593No Hit
TCACAGTGAACCGGTCTCTTTT1019770.5735481249323328No Hit
AACATTCATTGCTGTCGGTGGGT1016340.5716189937865667No Hit
TGAGGTAGTAGGTTGTATAGT929430.5227382976120675No Hit
TCCCTGAGACCCTTAACCTGTGA902870.5078001858827533No Hit
TAAAGCTAGAGAACCGAAAGT849810.47795770815845307No Hit
ACCTTGGCTTTAGACTGCTTACT839560.4721928118773736No Hit
TCTTTGGTTATCTAGCTGTATG820990.46174850710277404No Hit
ACCGTGGCTTTAGATTGTTACT796440.4479408774734569No Hit
AGCTACATCTGGCTACTGGGTCT737400.4147350748944391No Hit
TGAGGTAGTTGGTTGTATAGTT716640.4030590508168577No Hit
CCTGTCTGAGGGTCGCT710060.39935826861885737No Hit
TCCAGCATCAGTGATTTTGTTG693850.3902412960611698No Hit
TATTGCACTTGTCCCGGCCTGT678380.3815405208935308No Hit
AGAATAATGCCAGCAGTCGGTC670990.3773841712820989No Hit
AACCCGTAGATCCGAACTTGTG644270.3623560709279093No Hit
TGAGGTAGTAGTTTGTGCTGTT612180.34430772735133947No Hit
AACATTCAACGCTGTCGGTGG605810.34072505522348817No Hit
AGCTGGTGTTGTGAATCAGGCCG599820.3373561060797159No Hit
TTCCCTTTGTCATCCTATGCCTG597460.3360287738628039No Hit
TTCCCTTTGTCATCCTATGCCT588330.33089379795585216No Hit
TTCAAGTAATCCAGGATAGGC566930.31885781937876917No Hit
AACATTCAACGCTGTCGGTGAGA518540.2916418846430193No Hit
CCCTGAGACCCTTAACCTGTGA514960.2896283891614326No Hit
TGCTCAGTAGTCAGTGTAGATC511330.2875867722345722No Hit
TCCCTGAGACCCTTAACCTGT498320.28026957217439236No Hit
TGAGATGAAGCACTGTAGCTCT497810.27998273343260205No Hit
TGCTCAGTAGTCAGTGTAGATCC496380.27917846009777825No Hit
TAACGGAACCCATAATGCAGCTG494500.2781210937554925No Hit
AGCTACATTGTCTGCTGGGTTT493730.2776880234982797No Hit
TGAGATGAAGCACTGTAGCTC486390.27355979533212127No Hit
TCCCTGAGACCCTAACTTGTGA478560.26915597700228205No Hit
AAGCTGCCAGTTGAAGAGCTGT459180.2582561048142508No Hit
TCTTTGGTTATCTAGCTGTATGT440020.24747996698542327No Hit
ACCATCGACCGTTGACTGTGCC429830.24174881643867205No Hit
AACATTCAACGCTGTCGGTG422780.2377836926551003No Hit
TAGCTTATCAGACTGGTGTTGG399120.22447662475165248No Hit
TGAGATGAAGCACTGTAGCT388530.21852050264271283No Hit
TTCAAGTAATCCAGGATAGGTT387820.21812117811982829No Hit
AGCTACATTGTCTGCTGGGTTTC386950.2176318649720684No Hit
CTTTGGTTATCTAGCTGTATGA378590.21292995932232942No Hit
CCTTGGCTTTAGACTGCTTACT374750.21077023232532016No Hit
ACCATCGACCGTTGACTGTACC361100.2030930777656387No Hit
TTCACAGTGGTTAAGTTCTG358700.20174324839250787No Hit
TGAGGTAGTAGATTGAATAGTT354550.19940916843480253No Hit
TAAGGCACGCGGTGAATGCC335940.1889423665039841No Hit
TTCAAGTAATCCAGGATAGGCTT333790.1877331443572211No Hit
TCACAGTGAACCGGTCTCT326140.18343056323036666No Hit
TGAGGTAGTAGGTTGTATAGTTT311760.17534283556969127No Hit
AACATTCAACGCTGTCGGTGT298680.16798626548612838No Hit
TACCCTGTAGAACCGAATTTGT297280.16719886501846876No Hit
TGAGGTAGTTGGTTGTATTGTT292030.1642461132647451No Hit
CATTATTACTTTTGGTACGCG288900.16248571079062038No Hit
CAGGCTGGTTAGATGGTTGTCT285320.1604722153090336No Hit
AGCAGCATTGTACAGGGCTATGA285180.16039347526226763No Hit
TTGCATAGTCACAAAAATGAGC278360.15655771012695427No Hit
TCCCTGAGACCCTAACTTGTG271400.15264320494487493No Hit
ACCATTGACCGTTGACTGTACC269370.15150147426676847No Hit
TAACAGTCTACAGCCATGGTCG254480.1431269078643028No Hit
GTACAGTACTGTGATAACTGA247760.13934738561953652No Hit
TCTTTGGTTATCTAGCTGTA241040.13556786337477028No Hit
TAACAGTCTACAGCCATGGTC239480.13469047428223527No Hit
TGTAAACATCCTTGACTGGAAGCT236790.13317754052651784No Hit
TACAGTACTGTGATAACTGAAG236730.13314379479218955No Hit
ACCATCGACCGTTGACTGTGCCT235380.13238451576980348No Hit
CTGTCTGAGGGTCGCT234030.13162523674741738No Hit
TATTGCACTCGTCCCGGCCTC232580.1308097148344842No Hit
TACCCTGTAGAACCGAATGTGT231120.1299885686324963No Hit
CTACGCCTGTCTGAGGGTCGCT230080.1294036425708063No Hit
TACCCTGTAGATCCGGATTTGT229660.12916742243050838No Hit
TTTGGCAATGGTAGAACTCACA220700.12412805943748673No Hit
TAATACTGTCTGGTAATGCCG216110.12154651076137406No Hit
AAGCTGCCAGCTGAAGAACTGC214520.12065224880167492No Hit
TTCACAGTGGCTAAGTTCTGCT211980.11922367938177814No Hit
TGAGGTAGTTGTTTGTACAGTT211620.11902120497580852No Hit
TGAGGTAGTAGGTTGTGTGGTT204470.11499983830168968No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT200870.11297509424199348No Hit
TATTGCACTCGTCCCGGCCT193820.10900997045842173No Hit
AACATTCATTGCTGTCGGTGGGTT187700.1055679055569382No Hit
ATAGCTCTTTAAATGGTACTGC187280.10533168541664031No Hit
CTTTTTGCGGTCTGGGCTTGC185840.10452178779276182No Hit
AGCAGCATTGTACAGGGCTATGT184440.10373438732510219No Hit
AACATTCAACGCTGTCGGTGAT184390.10370626587982863No Hit
AACCCGTAGATCCGAACTTGT184220.10361065296589853No Hit
AGCTACATTGTCTGCTGGGTT181930.10232269077236957No Hit
TGTAAACATCCTACACTCTCAGCT181610.10214271352261878No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCCTCC12450.01505.283144
ACACTAT202.3646862E-111434.172741
ACATCGA1500.01375.469844
GCGTCCC350.01358.620442
CACCCTC13350.01358.327943
CGTATAC4150.01346.468844
ACGCAGC4150.01302.850843
ACAAATT750.01260.847344
AACATCG1650.01260.333643
GTTACAG10250.01217.297741
TTTCACC12750.01197.768240
GGTTACA10700.01141.797740
GGTTCAC50.0064831321123.653637
GCTTGCG10150.01114.55743
GAGTTTC450.01109.093543
TTTTCAC13000.01064.997839
TTCACCC14900.01058.785241
GAAGTTA1300.01058.053744
GGGTCAA50.00733307841056.515736
AGCTTGC10600.01054.212642