FastQCFastQC Report
Tue 6 Dec 2016
B2_TGACCA_L004_R1_001_prinseq_good_nXrf.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameB2_TGACCA_L004_R1_001_prinseq_good_nXrf.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23019985
Sequences flagged as poor quality0
Sequence length15-50
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG18873958.198941050569756No Hit
AACATTCAACGCTGTCGGTGAGT11644255.058322149210784No Hit
TTCAAGTAATCCAGGATAGGCT10254894.454777012235238No Hit
TCACAGTGAACCGGTCTCTTT8335103.620810352395972No Hit
TGAGGTAGTAGGTTGTATAGTT7879533.422908398941181No Hit
AACATTCAACGCTGTCGGTGA5121472.2247929353559526No Hit
AACCCGTAGATCCGAACTTGTG4596451.996721544345055No Hit
TAAAGCTAGAGAACCGAAAGTA3498731.5198663248477355No Hit
TCCCTGAGACCCTTAACCTGT3479341.511443209020336No Hit
TCTTTGGTTATCTAGCTGTAT3389201.4722859289439154No Hit
TAAAGCTAGAGAACCGAAAGT3090591.342568207581369No Hit
TTAAAGGGAATTTGCGACTGTT2810831.2210390232660882No Hit
TCTTTGGTTATCTAGCTGTATGA2657831.1545750355614914No Hit
AGCTACATCTGGCTACTGGGTCTC2587601.1240667619896365No Hit
AACCCGTAGATCCGAACTTGT2409941.046890343325593No Hit
TCACAGTGAACCGGTCTCTT1921780.834831126084574No Hit
TCACAGTGAACCGGTCTCTTTT1802250.7829066786967933No Hit
TCCCTGAGACCCTTAACCTGTG1796870.7805695789984224No Hit
AACATTCATTGCTGTCGGTGGG1782050.774131694699193No Hit
TAGCTTATCAGACTGGTGTTGGC1726520.7500091768087598No Hit
TTCACAGTGGCTAAGTTCTG1697150.7372506976003678No Hit
TATTGCACTCGTCCCGGCCTCC1589100.6903132213161738No Hit
TTGCATAGTCACAAAAGTGATC1558780.6771420572168053No Hit
TGAGGTAGTAGGTTGTATAGT1536610.6675112950768647No Hit
TAACAGTCTACAGTCATGGCT1536250.6673549092234421No Hit
AAGCTGCCAGCTGAAGAACTGT1459560.6340403783929485No Hit
TTCACAGTGGCTAAGTTCTGC1451410.6304999764335206No Hit
ACCTTGGCTTTAGACTGCTTACT1403370.6096311531045742No Hit
AAGCTGCCAGCTGAAGAACT1399590.607989101643637No Hit
TGAGGTAGTAGTTTGTATAGTT1305650.5671810820033114No Hit
TGAGGTAGTAGTTTGTGCTGTT1275500.5540837667791704No Hit
TAAAGGGAATTTGCGACTGTT1263400.5488274644835781No Hit
AACCCGTAGATCCGAACTTGTGA1208610.5250264064029582No Hit
TCCAGCATCAGTGATTTTGTT1166710.5068248306851634No Hit
TCTTTGGTTATCTAGCTGTATG1103630.4794225539243401No Hit
TCCCTGAGACCCTTAACCTGTGA1090230.47360152493583296No Hit
AACATTCATTGCTGTCGGTGGGT1059890.4604216727334966No Hit
AGAATAATGCCAGCAGTCGGTC1045730.4542704958322084No Hit
ACCGTGGCTTTAGATTGTTACT1032650.44858847649118805No Hit
AGCTACATCTGGCTACTGGGTCT955920.4152565694547586No Hit
TGAGGTAGTTGGTTGTATAGTT934880.40611668513250554No Hit
CCCTGAGACCCTTAACCTGTGA895160.38886211263821413No Hit
TGCTCAGTAGTCAGTGTAGATC829530.36035210274898094No Hit
TGCTCAGTAGTCAGTGTAGATCC803260.34894027950061657No Hit
TAAAGCTAGAGAACCGAAAGTAA788400.34248501899545114No Hit
TCCCTGAGACCCTAACTTGT763300.3315814497707101No Hit
TTCCCTTTGTCATCCTATGCCTG732170.3180584175011409No Hit
TCCCTGAGACCCTAACTTGTGA698570.30346240451503337No Hit
TGAGATGAAGCACTGTAGCTCT690280.29986118583483No Hit
CCTGTCTGAGGGTCGCT678930.2949306874005348No Hit
TGAGATGAAGCACTGTAGCTC669510.29083859090264397No Hit
TATTGCACTTGTCCCGGCCTGT665490.2890922822060918No Hit
TCTTTGGTTATCTAGCTGTATGT661620.28741113428179904No Hit
TCCAGCATCAGTGATTTTGTTG633750.27530426279600095No Hit
TGAGGTAGTAGGTTGTATAGTTT619990.26932684795407125No Hit
TTCAAGTAATCCAGGATAGGC617740.26834943637018005No Hit
AGCTGGTGTTGTGAATCAGGCCG605080.262849867191486No Hit
AACATTCAACGCTGTCGGTGG588160.2554997320806247No Hit
AGCTACATTGTCTGCTGGGTTT580560.25219825295281467No Hit
CTTTGGTTATCTAGCTGTATGA561220.24379685738283494No Hit
AGCTACATTGTCTGCTGGGTTTC560210.24335810818295495No Hit
TGAGATGAAGCACTGTAGCT545970.23717217886979508No Hit
CCTTGGCTTTAGACTGCTTACT544890.23670302130952736No Hit
ACCATCGACCGTTGACTGTGCC534310.23210701483949706No Hit
TAAAGCTAGAGAACCGAAAGTC513470.22305401154692323No Hit
TACCCTGTAGAACCGAATTTGT508970.221099188379141No Hit
TTCCCTTTGTCATCCTATGCCT495640.21530856775102158No Hit
AACATTCAACGCTGTCGGTGAGA488820.21234592463896043No Hit
TGAGGTAGTAGATTGAATAGTT481020.20895756448147124No Hit
AAGCTGCCAGTTGAAGAGCTGT480930.2089184680181156No Hit
TCCCTGAGACCCTAACTTGTG476220.20687241976917012No Hit
TACAGTACTGTGATAACTGAAG468760.20363175736213554No Hit
TAAGGCACGCGGTGAATGCC447500.1943963039072354No Hit
TCACAGTGAACCGGTCTCT423580.1840053327576017No Hit
TAAAGCTAGAGAACCGAAAGTAT420860.18282375075396443No Hit
TTCAAGTAATCCAGGATAGGCTT415020.18028682468733145No Hit
GTACAGTACTGTGATAACTGA404270.17561696934207385No Hit
TAGCTTATCAGACTGGTGTTGG395880.17197231014703093No Hit
TTCAAGTAATCCAGGATAGGTT392860.17066040659887485No Hit
AACATTCAACGCTGTCGGTG392520.17051270884842018No Hit
AGCAGCATTGTACAGGGCTATGA385320.1673849917799686No Hit
ACCATCGACCGTTGACTGTACC385310.1673806477284846No Hit
TAACAGTCTACAGCCATGGTCG382830.16630332296046238No Hit
TGAGGTAGTTGGTTGTATTGTT379370.16480028114701203No Hit
CTGGACAACTCTTAGCGG361730.1571373743293056No Hit
TTGCATAGTCACAAAAATGAGC354450.1539749048489823No Hit
TGAGGTAGTAGGTTGTGTGGTT345210.14996100127780276No Hit
TCCCTGAGACCCTTAACCTGTGT339480.14747185977749333No Hit
TCCCTGAGACCCTTAACCTG332650.1445048726139483No Hit
CATTATTACTTTTGGTACGCG331790.14413128418632767No Hit
TACCCTGTAGATCCGGATTTGT322630.1401521330270198No Hit
CAGGCTGGTTAGATGGTTGTCT316230.13737194007728504No Hit
ACCATCGACCGTTGACTGTGCCT312330.1356777599985404No Hit
TAGCAGCACGTAAATATTGGAG303700.13192884356788243No Hit
TTCACAGTGGTTAAGTTCTG299680.13018253487133027No Hit
TAACAGTCTACAGCCATGGTC291790.1267550782504854No Hit
TCTTTGGTTATCTAGCTGTA285390.12397488530075064No Hit
ACCATTGACCGTTGACTGTACC279890.12158565698457231No Hit
ACTGGACAACTCTTAGCGG278060.12079069556300755No Hit
ATAAAGCTAGAGAACCGAAAGT271210.11781502029649454No Hit
TCTTTGGTTATCTAGCTGTAA270530.11751962479558524No Hit
AACATTCAACGCTGTCGGTGT269400.1170287469778977No Hit
TGTAAACATCCTTGACTGGAAGCT263930.11465255081617126No Hit
AGCAGCATTGTACAGGGCTATGT263120.11430068264597044No Hit
TCCCTGAGACCCTAACTTGTGAA262890.11420076946183937No Hit
TAAATCTAGAGAACCGAAAGTA261630.11365341897486031No Hit
TAACGGAACCCATAATGCAGCTG254590.11059520673015208No Hit
AACCCGTAGATCCGAACTTG253170.10997835141942967No Hit
TGAGGTAGTAGTTTGTGCTGTTT253150.10996966331646175No Hit
CTGTCTGAGGGTCGCT252850.10983934177194293No Hit
CATTGCACTTGTCTCGGTCTGA250320.10874029674650093No Hit
TATTGCACTCGTCCCGGCCTC243560.10580371794334358No Hit
ACCTTGGCTCTAGACTGCTTACT242900.10551701054540219No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCCTCC11350.01670.099644
CGTATAC2800.01470.223944
CACCCTC12400.01454.321343
GCAAAGT50.0039324971442.843839
ACAAATT800.01436.032644
AAGTTTA50.00446086561354.6938
GTTACAG11650.01346.419341
TTTCACC11350.01332.514240
ACGCAGC5850.01314.435343
TATACTC11800.01314.33544
ACATCGA1650.01276.473544
TTGCGGA3800.01259.677744
CTTTCAC5900.01259.431339
GGTTACA12250.01240.914240
CATCGAT550.01218.45244
CGGTTAC11800.01204.407639
AAAAACG300.01202.369639
ATTACTA1450.01188.440844
TGCGTCC600.01188.31741
TTCACCC13250.01177.853941