FastQCFastQC Report
Tue 6 Dec 2016
B3_ACAGTG_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameB3_ACAGTG_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18743522
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA200844210.71539276343048RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC11019025.878841767304992RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA6642313.5437896890456337RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA5119982.731599749502788RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG5105142.723682347426487RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG4782282.551430835677521RNA PCR Primer, Index 1 (100% over 29bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA2567331.3697158943767345No Hit
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2334021.2452408890922422RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA2333791.2451181800304127RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2130761.1367980894945997RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG2123661.13301011410769RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA2110841.1261704177048475RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2026391.0811148513070274RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1725880.9207874592619252RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1671740.8919028131425887RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1655580.8832811677549183RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1575600.8406104252978709RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1558250.831353893894648RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1330460.7098239060940628RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1313880.7009781832891385RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1266540.6757214572586732RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA1212400.6468368111393366RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC1167320.6227858350207608RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA1065150.5682763356854704RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1030160.5496085527575874RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG995400.5310634788915338RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT971590.5183604234038832RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC937260.5000447621316848RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC922330.4920793434659719RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG915620.48849943996651213RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA892980.47642060014121146RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT885240.47229117345181976RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA811310.43284821283854763RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA768550.4100349976914691RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG766170.40876522566036416RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA722090.38524776720191645RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG680870.3632561692514353RNA PCR Primer, Index 1 (100% over 29bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA631530.3369324079007136RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG627860.3349743980880434RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA626580.33429149548307946RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG621900.3317946328336798RNA PCR Primer, Index 1 (100% over 29bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC600730.32050006396876746RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA581240.31010180477287036RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG576430.3075355848276541RNA PCR Primer, Index 1 (100% over 29bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA571820.30507606841446344RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA567810.30293666259734964RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC561590.2996181827513527RNA PCR Primer, Index 1 (100% over 33bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT537880.2869684790297149RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC537190.2866003518442265RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA502360.268017931741964RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA473570.2526579583068753RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC465360.2482777783172234RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA456680.2436468450273113RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA449940.24005093599804775RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA443630.23668443956263932RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG426340.22745991921902403RNA PCR Primer, Index 1 (100% over 29bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA397150.21188653871988414RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA394180.2103019912693036RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT378780.2020858193033305RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC371340.19811644791197727RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC367540.1960890808034904RNA PCR Primer, Index 1 (100% over 27bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA366930.19576363503081223RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG345900.18454375863831782RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA343390.18320462931139622RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA339050.18088916266644017RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA336730.17965140169494292RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA317890.1695999289781291RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGCAATGGTAGAACTCACATGGAATTCTCGGGTGCCAAGGAACTCCA300510.1603273920451023RNA PCR Primer, Index 1 (100% over 28bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA297730.15884421294994613RNA PCR Primer, Index 1 (100% over 32bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC289120.15425062589624297RNA PCR Primer, Index 1 (100% over 27bp)
ACCATTGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA287030.1531355739865752RNA PCR Primer, Index 1 (100% over 28bp)
ATTCGATCTTCTAAGGCTACTCTAGCTTGGCGGTTCTGGAATTCTCGGGT283760.15139097123795625No Hit
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA282710.1508307776948217RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT282140.15052667262854869RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC280700.14975840719796418RNA PCR Primer, Index 1 (100% over 27bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA271350.14477001707576623No Hit
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA264360.14104072863147066RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG257010.13711937382952893RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC256940.13708202759331997RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGCAATGGTAGAACTCACTTGGAATTCTCGGGTGCCAAGGAACTCCA250400.13359282209608206RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA235860.12583547531781913RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA235700.12575011249219864RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGGAATTCTCGGGTGCCAAGGAACTCCAGT234940.12534463907050128RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG234460.12508855059363977RNA PCR Primer, Index 1 (100% over 29bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA225680.12040426553771484RNA PCR Primer, Index 1 (100% over 28bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA224080.11955063728150984RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC222710.1188197180871343RNA PCR Primer, Index 1 (100% over 26bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC219820.11727785204936403RNA PCR Primer, Index 1 (100% over 26bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC217210.11588537095642965RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT214330.11434884009526064RNA PCR Primer, Index 1 (100% over 30bp)
TTTGGCAATGGTAGAACTCACACTTGGAATTCTCGGGTGCCAAGGAACTC214070.11421012550362733RNA PCR Primer, Index 1 (100% over 26bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA213740.11403406467578506RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA212530.11338850830703003RNA PCR Primer, Index 1 (100% over 28bp)
ACTTTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA201900.10771721557986808No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC200940.10720503862614507RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTCGTCCCGGCCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG197030.10511898457504412RNA PCR Primer, Index 1 (100% over 29bp)
TTTGGCAATGGTAGAACTCACACTGGAATTCTCGGGTGCCAAGGAACTCC196850.10502295139622105RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA196210.10468150009373905RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC195820.10447342820628909RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC193540.10325700794119697RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA192770.1028461993428983RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT192670.10279284757688549RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA189760.10124031118591266RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGCAATGGTAGAACTCACTCTGGAATTCTCGGGTGCCAAGGAACTCC187700.10014126480604871RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAAGTTA850.044.042451
ATAGGTC454.765752E-1044.0424461
ACGTTAT1750.044.0424461
CAATTTA207.8223395E-444.0424461
AACATTC4745600.044.024351
ACGGTCA1050.043.998862
TACGCCG207.860576E-443.9988562
GCGGCAT351.4479701E-743.9988562
AAATGCG207.860576E-443.9988562
CGTAATA900.043.9987411
CTAGTGC1200.043.99873711
CGCTATC351.4480611E-743.99850510
AGGCGTT900.043.9983863
TTATCTT207.860989E-443.9983868
CCTAAAA900.043.9983868
CACGATA254.4465596E-543.9981547
GTACGCA551.8189894E-1243.9980315
ATAGGCA7450.043.9979216
TCCGCGT207.861402E-443.99791716
TAAACGC1350.043.9976846