FastQCFastQC Report
Tue 6 Dec 2016
B3_ACAGTG_L004_R1_001_prinseq_good_UrPF.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameB3_ACAGTG_L004_R1_001_prinseq_good_UrPF.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18455871
Sequences flagged as poor quality0
Sequence length15-50
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG214292111.61105319819368No Hit
AACATTCAACGCTGTCGGTGAGT11917156.457105167239195No Hit
TTCAAGTAATCCAGGATAGGCT7180023.890371795511575No Hit
AACATTCAACGCTGTCGGTGA5695823.086183253014718No Hit
TGAGGTAGTAGGTTGTATAGTT5379532.91480689261428No Hit
TCACAGTGAACCGGTCTCTTT5177772.8054866660045468No Hit
ACTGTATAAGGTACATATGGTTGAGTGTCGTA2679841.4520257537560812No Hit
TTAAAGGGAATTTGCGACTGTT2459211.3324811383868038No Hit
TAAAGCTAGAGAACCGAAAGTA2314801.2542350344776467No Hit
TAGCTTATCAGACTGGTGTTGGC2272211.2311583668958241No Hit
TCTTTGGTTATCTAGCTGTAT2266651.228145775401226No Hit
AACATTCATTGCTGTCGGTGGG2247991.218035171572233No Hit
TACCCTGTAGAACCGAATGTGT2130461.154353538773651No Hit
TAAAGCTAGAGAACCGAAAGT1983561.0747582706879562No Hit
AACCCGTAGATCCGAACTTGTG1822490.9874852289550571No Hit
TCCCTGAGACCCTTAACCTGT1806850.9790109607939934No Hit
TGAGGTAGTAGTTTGTGCTGTT1738660.9420633683449565No Hit
TCCCTGAGACCCTTAACCTGTG1685870.9134600041363532No Hit
AAGCTGCCAGCTGAAGAACTGT1397330.757119509558774No Hit
TCTTTGGTTATCTAGCTGTATGA1374620.7448144820691475No Hit
TGAGGTAGTAGTTTGTATAGTT1329170.7201881720998158No Hit
TATTGCACTCGTCCCGGCCTCC1281530.6943752478547341No Hit
AACATTCATTGCTGTCGGTGGGT1252260.678515795867884No Hit
TTCACAGTGGCTAAGTTCTG1201420.6509690060144006No Hit
TCTTTGGTTATCTAGCTGTATG1143300.619477671901803No Hit
TCACAGTGAACCGGTCTCTT1121360.6075898558241982No Hit
TGAGGTAGTAGGTTGTATAGT1111600.6023015657185727No Hit
TCCAGCATCAGTGATTTTGTT1064500.5767812312949089No Hit
AGCTACATCTGGCTACTGGGTCTC1015960.5504806573474641No Hit
TAAAGGGAATTTGCGACTGTT988370.5355314848050249No Hit
TCCCTGAGACCCTTAACCTGTGA974390.5279566594283196No Hit
TTCCCTTTGTCATCCTATGCCT942130.510477126763619No Hit
TGAGGTAGTTGGTTGTATAGTT851590.4614195667059008No Hit
TTCACAGTGGCTAAGTTCTGC833940.4518562142095597No Hit
TTGCATAGTCACAAAAGTGATC803140.4351677577286924No Hit
TAACAGTCTACAGTCATGGCT776350.42065205158835367No Hit
TCACAGTGAACCGGTCTCTTTT768470.41638240752766426No Hit
CCTGTCTGAGGGTCGCT742030.40205634293824444No Hit
TGAGATGAAGCACTGTAGCTC725220.39294813016410873No Hit
AAGCTGCCAGCTGAAGAACT671010.3635753630917771No Hit
AACATTCAACGCTGTCGGTGG668000.3619444457538742No Hit
TATTGCACTTGTCCCGGCCTGT660920.35810826809528523No Hit
ACCTTGGCTTTAGACTGCTTACT641020.3473257913430366No Hit
CCCTGAGACCCTTAACCTGTGA631000.3418966246567285No Hit
AACCCGTAGATCCGAACTTGT627620.3400652291078541No Hit
TGAGATGAAGCACTGTAGCTCT608560.3297378920778109No Hit
ACCGTGGCTTTAGATTGTTACT598030.32403239056016375No Hit
TTCCCTTTGTCATCCTATGCCTG568460.30801038867252595No Hit
TCCCTGAGACCCTAACTTGTGA566100.30673166278632963No Hit
TGAGGTAGTAGATTGAATAGTT497840.2697461420271089No Hit
AGCTGGTGTTGTGAATCAGGCCG492760.26699363037377105No Hit
TAGCTTATCAGACTGGTGTTGG481630.26096302905454855No Hit
TCCAGCATCAGTGATTTTGTTG478890.2594784066273545No Hit
TGAGATGAAGCACTGTAGCT474650.25718103469622217No Hit
AGAATAATGCCAGCAGTCGGTC466110.25255378085379987No Hit
CATTATTACTTTTGGTACGCG457200.2477260488004061No Hit
TTCAAGTAATCCAGGATAGGC419050.22705511975024098No Hit
ACCATCGACCGTTGACTGTACC413140.22385288670472392No Hit
AACATTCAACGCTGTCGGTG399470.21644602955883252No Hit
CTTTGGTTATCTAGCTGTATGA393920.21343885639426066No Hit
AACATTCAACGCTGTCGGTGAGA390700.2116941541258064No Hit
TCTTTGGTTATCTAGCTGTATGT388650.21058339647042398No Hit
TAGCAGCACGTAAATATTGGAG386440.20938594553462148No Hit
CTGGACAACTCTTAGCGG386000.20914753901346622No Hit
TAAAGCTAGAGAACCGAAAGTC367080.19889605860379062No Hit
TACCCTGTAGAACCGAATTTGT360600.195384980746777No Hit
ACCATCGACCGTTGACTGTGCC359840.19497318766478156No Hit
TTCAAGTAATCCAGGATAGGTT354780.19223151267149624No Hit
TCCCTGAGACCCTAACTTGTG348870.18902927962597918No Hit
TGAGGTAGTTGGTTGTATTGTT334410.18119437440801356No Hit
TGAGGTAGTAGGTTGTATAGTTT308990.16742097948127183No Hit
AGCTACATCTGGCTACTGGGTCT303290.16433253136630613No Hit
ACCATTGACCGTTGACTGTACC299660.16236567756677536No Hit
ATTCGATCTTCTAAGGCTACTCTAGCTTGGCGGTTC298530.1617534062738085No Hit
TATGGCTTTTTATTCCTATCTG296830.16083229016934503No Hit
TTTGGCAATGGTAGAACTCACA296250.1605180270278222No Hit
TCTTTGGTTATCTAGCTGTA296220.16050177203774343No Hit
CTGTATAAGGTACATATGGTTGAGTGTCGTA286900.1554518884532732No Hit
TACCCTGTAGATCCGGATTTGT277970.15061331973982697No Hit
TACCCTGTAGAACCGAATGTGTG272420.1476061465752551No Hit
TCCCTGAGACCCTAACTTGT265640.1439325188174538No Hit
TTTGGCAATGGTAGAACTCACT261210.14153219861582259No Hit
TGAGGTAGTAGTTTGTGCTGT252680.13691036310342655No Hit
AAGCTGCCAGTTGAAGAGCTGT248350.13456422620205785No Hit
TGAGGTAGTAGGTTGTGTGGTT248200.13448295125166404No Hit
CTGTCTGAGGGTCGCT248000.13437458465113894No Hit
AACATTCATTGCTGTCGGTGGGTT245930.133252990335704No Hit
TGTAAACATCCTTGACTGGAAGCT240880.13051673367244493No Hit
GGACAACTCTTAGCGG237780.1288370513643057No Hit
CCTTGGCTTTAGACTGCTTACT236770.12828980003165388No Hit
CAGGCTGGTTAGATGGTTGTCT235310.12749872384782057No Hit
TTCACAGTGGTTAAGTTCTG234500.12705983911569385No Hit
TTTGGCAATGGTAGAACTCACACT230450.12486541545506036No Hit
TAAGGCACGCGGTGAATGCC227400.12321282479705238No Hit
AGCAGCATTGTACAGGGCTATGA226120.12251927855369167No Hit
CTACGCCTGTCTGAGGGTCGCT224620.12170652904975332No Hit
TGCTCAGTAGTCAGTGTAGATC223320.12100214614634011No Hit
TATTGCACTCGTCCCGGCCTC218410.1183417461034486No Hit
TTCAAGTAATCCAGGATAGGCTT217050.11760485321987783No Hit
TCACAGTGAACCGGTCTCT213060.11544293953940185No Hit
ACTTTATAAGGTACATATGGTTGAGTGTCGTA210100.1138391138516302No Hit
TTTGGCAATGGTAGAACTCACAC208040.11272293786622155No Hit
TGCTCAGTAGTCAGTGTAGATCC206310.11178556677167932No Hit
TGAGGTAGTTGTTTGTACAGTT205910.1115688335706291No Hit
AACATTCAACGCTGTCGGTGAGTT204070.11057186084579808No Hit
TAAAGCTAGAGAACCGAAAGTAA203620.11032803599461656No Hit
TAACAGTCTACAGCCATGGTCG202770.10986747794238484No Hit
AACATTCAACGCTGTCGGTGT201370.10910891173870904No Hit
TACCCTGTAGAACCGAATTTGC200830.10881632191729125No Hit
TTTGGCAATGGTAGAACTCACTC198370.10748341273083238No Hit
ACCATCGACCGTTGACTGTGCCT198000.10728293451986093No Hit
TAACGGAACCCATAATGCAGCTG197860.10720707789949332No Hit
TTTGGCAATGGTAGAACTCAC195540.10595002533340203No Hit
TGAGGTAGTAGTTTGTGCTGTTT191390.10370141837250596No Hit
AACAGTCAACGCTGTCGGTGAG189740.10280739391817378No Hit
TCCCTGAGACCCTTAACCTG189350.10259607904714982No Hit
AAGCCCTTACCCCAAAAAGCAT188140.1019404611139729No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATTATG102.8520735E-61970.082644
CCATCCG50.0021092891970.082644
CATATAT50.00225248071906.433743
ACCCTCC7750.01792.139844
CACCCTC8050.01669.609743
TGCGTCC1000.01529.258241
GTTACAG11700.01485.918741
CAGACAA450.01482.781943
CCAGGTA50.00389900571448.996639
GCTTGCG8250.01409.605643
CACATGC350.01407.20244
GCTTCCA3450.01399.044244
AGACAAT500.01379.057944
CCAGTTA50.00434506031372.598538
TGCTTCC3150.01361.738543
CGTATAC2750.01325.328444
GGTTACA13000.01316.197840
AATAGCG50.0049150561290.545737
TCCAATC500.01287.796441
TCAAAAG2850.01270.955943