FastQCFastQC Report
Tue 6 Dec 2016
B4_GCCAAT_L004_R1_001_prinseq_good_TNbM.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameB4_GCCAAT_L004_R1_001_prinseq_good_TNbM.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16449616
Sequences flagged as poor quality0
Sequence length15-50
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG172582210.49156405839504No Hit
AACATTCAACGCTGTCGGTGAGT10598336.442904199101061No Hit
TTCAAGTAATCCAGGATAGGCT6839224.157677601714228No Hit
TCACAGTGAACCGGTCTCTTT5833833.546484003030831No Hit
TGAGGTAGTAGGTTGTATAGTT4982403.028885294343649No Hit
AACATTCAACGCTGTCGGTGA4380422.6629314629593783No Hit
TTAAAGGGAATTTGCGACTGTT2271661.3809805651390281No Hit
TAAAGCTAGAGAACCGAAAGTA2211721.3445420245676252No Hit
TAGCTTATCAGACTGGTGTTGGC1941461.1802463960252931No Hit
TAAAGCTAGAGAACCGAAAGT1752661.0654716803115647No Hit
AACCCGTAGATCCGAACTTGTG1717181.0439027877611247No Hit
TCTTTGGTTATCTAGCTGTAT1699761.0333128749023686No Hit
AACATTCATTGCTGTCGGTGGG1648651.0022422407915175No Hit
TCCCTGAGACCCTTAACCTGTG1606790.9767948382503275No Hit
TACCCTGTAGAACCGAATGTGT1582890.9622656237081766No Hit
AGCTACATCTGGCTACTGGGTCTC1578230.9594327308309203No Hit
TCTTTGGTTATCTAGCTGTATGA1568600.9535784908292084No Hit
TGAGGTAGTAGTTTGTGCTGTT1514910.9209394310481169No Hit
TCCCTGAGACCCTTAACCTGT1467740.8922639896274783No Hit
TATTGCACTCGTCCCGGCCTCC1433880.871679922497887No Hit
TGAGGTAGTAGTTTGTATAGTT1332900.8102924712649827No Hit
AAGCTGCCAGCTGAAGAACTGT1317720.8010642923214742No Hit
TTCACAGTGGCTAAGTTCTG1263190.7679145823221648No Hit
TCACAGTGAACCGGTCTCTT1245980.7574523320179632No Hit
AACATTCATTGCTGTCGGTGGGT1119980.6808547992852843No Hit
TTCCCTTTGTCATCCTATGCCT1091030.6632556042645615No Hit
TCCCTGAGACCCTTAACCTGTGA1081650.657553343494462No Hit
TTCACAGTGGCTAAGTTCTGC942330.5728583573014714No Hit
TCTTTGGTTATCTAGCTGTATG938120.5702990270411176No Hit
TAAAGGGAATTTGCGACTGTT928310.5643353619926448No Hit
TCACAGTGAACCGGTCTCTTTT907360.5515995023835206No Hit
TTGCATAGTCACAAAAGTGATC895260.5442437075734777No Hit
TCCAGCATCAGTGATTTTGTT829150.5040543195658792No Hit
TGAGGTAGTAGGTTGTATAGT818700.4977015876844785No Hit
TGAGGTAGTTGGTTGTATAGTT812470.49391426523269605No Hit
AAGCTGCCAGCTGAAGAACT752900.45770065392407944No Hit
TAACAGTCTACAGTCATGGCT738980.4492384503078977No Hit
ACCTTGGCTTTAGACTGCTTACT704660.4283747413921395No Hit
CCTGTCTGAGGGTCGCT635410.38627649423548854No Hit
TATTGCACTTGTCCCGGCCTGT629710.3828113677547245No Hit
CCCTGAGACCCTTAACCTGTGA606280.3685678741680049No Hit
TCCCTGAGACCCTAACTTGTGA592010.35989289962756577No Hit
TTCCCTTTGTCATCCTATGCCTG574030.34896255328999776No Hit
AACCCGTAGATCCGAACTTGT542990.33009281189299494No Hit
AACATTCAACGCTGTCGGTGG532600.32377655502718117No Hit
TGAGATGAAGCACTGTAGCTCT502590.3055329680644217No Hit
TGAGATGAAGCACTGTAGCTC498490.30304050866597737No Hit
ACCGTGGCTTTAGATTGTTACT492950.29967264889344525No Hit
TCCAGCATCAGTGATTTTGTTG479270.2913563453396116No Hit
TGAGGTAGTAGATTGAATAGTT450480.2738544170271209No Hit
CATTATTACTTTTGGTACGCG443270.26947133598741757No Hit
TCTTTGGTTATCTAGCTGTATGT429920.2613556450193123No Hit
AGCTACATCTGGCTACTGGGTCT427910.2601337319971482No Hit
AGCTGGTGTTGTGAATCAGGCCG413420.25132501573289007No Hit
AGAATAATGCCAGCAGTCGGTC390350.23730037223969241No Hit
TGAGATGAAGCACTGTAGCT381690.23203581165663684No Hit
TTCAAGTAATCCAGGATAGGC381010.231622428146651No Hit
CTTTGGTTATCTAGCTGTATGA370040.22495357946349628No Hit
TAGCAGCACGTAAATATTGGAG356940.21698986772700346No Hit
AACATTCAACGCTGTCGGTGAGA356220.21655216753995957No Hit
ACCATCGACCGTTGACTGTACC347210.21107483603264662No Hit
TAGCTTATCAGACTGGTGTTGG346390.21057634415295773No Hit
ACCATCGACCGTTGACTGTGCC343260.20867356417316973No Hit
TCCCTGAGACCCTAACTTGTG342060.20794406386142997No Hit
TTCAAGTAATCCAGGATAGGTT325080.19762163445031178No Hit
TGAGGTAGTAGGTTGTATAGTTT320110.19460028732585613No Hit
TAAAGCTAGAGAACCGAAAGTC309760.18830834713710035No Hit
TGAGGTAGTTGGTTGTATTGTT305980.18601042115511998No Hit
AACATTCAACGCTGTCGGTG305120.18548761259837312No Hit
TGCTCAGTAGTCAGTGTAGATCC293400.17836282622038108No Hit
TAAAGCTAGAGAACCGAAAGTAA274270.16673337541739577No Hit
AAGCTGCCAGTTGAAGAGCTGT270550.16447192445100237No Hit
TATTGCACTCGTCCCGGCCTC268060.1629582113041423No Hit
TGCTCAGTAGTCAGTGTAGATC262030.1592924722376498No Hit
TCACAGTGAACCGGTCTCT260320.15825293429342058No Hit
TACCCTGTAGAACCGAATGTGTG256140.1557118415408603No Hit
TGTAAACATCCTTGACTGGAAGCT252320.15338959888182194No Hit
CCTTGGCTTTAGACTGCTTACT246370.1497724931694454No Hit
CAGGCTGGTTAGATGGTTGTCT245570.14928615962828554No Hit
TCACAGTGAACCGGTCTCTTTG244800.14881806359491917No Hit
ACCATTGACCGTTGACTGTACC243160.14782107983554146No Hit
TACCCTGTAGAACCGAATTTGT240200.14602164573324994No Hit
TGAGGTAGTTGTTTGTACAGTT236120.14354134467333463No Hit
TTCAAGTAATCCAGGATAGGCTT235060.1428969527312978No Hit
AGCAGCATTGTACAGGGCTATGA234320.14244709420572493No Hit
TATTGCACTCGTCCCGGCCT232270.14120086450650277No Hit
AACATTCATTGCTGTCGGTGGGTT231480.1407206101346074No Hit
TTCACAGTGGTTAAGTTCTG228720.13904275941760585No Hit
TAAGGCACGCGGTGAATGCC222640.13534662450479087No Hit
TCCCTGAGACCCTAACTTGT220470.13402744477439474No Hit
AGCTACATTGTCTGCTGGGTTT219470.1334195278479449No Hit
TGAGGTAGTAGTTTGTGCTGT213050.12951670118013697No Hit
CTGTCTGAGGGTCGCT208990.12704855845875065No Hit
ACCATCGACCGTTGACTGTGCCT208080.1264953540556813No Hit
TAAAGCTAGAGAACCGAAAGTAT206270.1253950244188071No Hit
AGCTACATTGTCTGCTGGGTTTC205820.12512146180190467No Hit
TAACAGTCTACAGCCATGGTCG201810.12268371492684085No Hit
TGAGGTAGTAGTTTGTGCTGTTT201700.12261684406493137No Hit
AACATTCAACGCTGTCGGTGAGTT195130.11862282985815595No Hit
TCCCTGAGACCCTTAACCTGTGT188030.11430661968036214No Hit
CTACGCCTGTCTGAGGGTCGCT187280.11385068198552478No Hit
AAGCTGCCAGCTGAAGAACTGC183700.11167433938883436No Hit
CTGGACAACTCTTAGCGG183350.11146156846457693No Hit
TCCCTGAGACCCTTAACCTGTGG181960.11061656393681164No Hit
TAACGGAACCCATAATGCAGCTG176210.10712104160972512No Hit
TTGCATAGTCACAAAAATGAGC175540.10671373726900371No Hit
AACATTCAACGCTGTCGGTGT175220.1065192038525398No Hit
TGAGGTAGTAGGTTGTGTGGTT170800.10383221103763152No Hit
AACCCGTAGATCCGAACTTGTGA167600.10188687687299204No Hit
TCCCTGAGACCCTTAACCTG167190.10163763093314762No Hit
CTTTTTGCGGTCTGGGCTTGC166770.1013823058240387No Hit
AACAGTCAACGCTGTCGGTGAG164700.10012391778628754No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTAAGTG50.00241083161842.721143
TACGCCG50.00272354441733.705142
ACCCTCC9200.01713.429244
CACCCTC9150.01671.539443
TCCGTTA50.00334442221564.514641
GCAATCC50.00353914991520.861840
CGTATAC1800.01477.173144
GAAATTA1150.01356.812742
GTTACAG10350.01352.889441
TTGCGGA2400.01345.282744
CACATGC650.01314.846444
CCCCTTT50.00475883161311.542138
CGACGCG50.00475883161311.542138
GCTTGCG8350.01291.008243
GGTTACA10450.01288.002740
TTTCACC9900.01282.747240
CCGGTTA800.01229.570738
CCACTCA450.01228.480743
CGGTTAC10300.01209.875439
ACGCAGC4350.01207.343