FastQCFastQC Report
Mon 5 Dec 2016
JG10_3_GTAGAG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG10_3_GTAGAG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9932004
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4602394.6338986573102465RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG3932863.959784953771666RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3498973.5229244772756836RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3283783.306261254022854RNA PCR Primer, Index 1 (100% over 33bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG2970442.990776081040644No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2179112.1940285162994297RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA1777801.7899710874059256RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1484891.4950557812904628RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1208261.216531930514728RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1079471.0868602147159827RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1021461.028453069491313RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA926010.9323496043698735No Hit
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA883440.889488163718017RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC877490.8834974291190378RNA PCR Primer, Index 1 (100% over 27bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG757670.7628571232955605RNA PCR Primer, Index 6 (100% over 34bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA695500.7002614980823608RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG643640.6480464566868882No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC625190.6294701451992971No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC583690.5876860299291059RNA PCR Primer, Index 1 (100% over 26bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC527870.531483877775321No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA525080.5286747770137828RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT473160.4763993248492449RNA PCR Primer, Index 1 (97% over 35bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG470380.47360029254921765No Hit
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA443890.44692893800687156RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT441570.4445930549363452RNA PCR Primer, Index 1 (100% over 30bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG413890.4167235534742032RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG402810.40556769812013765RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC377010.3795910674220429RNA PCR Primer, Index 1 (100% over 26bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC374470.37703367819827704RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG372010.3745568366665982RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA342630.34497569674760503RNA PCR Primer, Index 1 (100% over 28bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT338280.3405959159903681No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT335890.3381895536892655No Hit
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC335010.33730352907630723RNA PCR Primer, Index 1 (100% over 26bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG320540.32273446527005023Illumina Small RNA Adapter 2 (100% over 21bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC315390.31754920759194216RNA PCR Primer, Index 1 (100% over 27bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA312890.3150320922142198RNA PCR Primer, Index 1 (100% over 32bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG303140.3052153422411026RNA PCR Primer, Index 6 (100% over 34bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC298920.30096645148350726No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA296340.29836878841369774RNA PCR Primer, Index 1 (100% over 32bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT293940.29595235765108435RNA PCR Primer, Index 1 (100% over 30bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC292860.2948649638079082RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG287020.2889849822855488RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTA286150.2881090261341014RNA PCR Primer, Index 3 (97% over 36bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA284150.28609533383192354RNA PCR Primer, Index 1 (100% over 22bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC274020.27589598232139256RNA PCR Primer, Index 1 (100% over 27bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG272370.2742346861720958RNA PCR Primer, Index 1 (100% over 29bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA271510.2733687984821593No Hit
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC270260.2721102407932981No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT269070.27091209387350224No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA269060.2709020254119914No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC267980.26981463156881536No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG267660.26949244080046686No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC242130.24378765856316612No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA241930.24358628933294832RNA PCR Primer, Index 1 (100% over 28bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA241320.24297211318078404No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA240130.24177396626098824RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC229870.23144372475081562RNA PCR Primer, Index 1 (100% over 27bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT229410.23098057552131476No Hit
TTTGTTCGTTCGGCTCGCGTTATGGAATTCTCGGGTGCCAAGGAACTCCA226410.2279600370680479RNA PCR Primer, Index 1 (100% over 28bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA226200.2277485993763192No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG225420.2269632593784698RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA216150.21762979555787534RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG214170.21563624017871924RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC208860.21028988711643692RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC207090.20850776942900948RNA PCR Primer, Index 1 (100% over 31bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG205160.2065645563574078RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAGAGATCTCGTATGC201990.20337285405845587RNA PCR Primer, Index 17 (100% over 50bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA197300.19865074560984874RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC196090.1974324617670311RNA PCR Primer, Index 1 (100% over 26bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC191150.19245864178065172RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT188370.18965960948062446RNA PCR Primer, Index 1 (100% over 30bp)
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA181170.18241031719278405No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG171740.1729157579880153No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT170470.17163706337613235RNA PCR Primer, Index 1 (100% over 30bp)
TTTGTTCGTTCGGCTCGCGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG169070.17022747876460784RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA164700.16582756108434912RNA PCR Primer, Index 1 (100% over 28bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA163810.16493146800987998RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT156890.15796409264434447RNA PCR Primer, Index 1 (100% over 30bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAGAGA155370.15643368649468928RNA PCR Primer, Index 17 (100% over 40bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA149790.15081548497161298RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG147920.14893268266907667RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC146830.1478352203643897RNA PCR Primer, Index 1 (100% over 27bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA146700.14770433036474814No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT146240.14724118113524723No Hit
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT146080.14708008575107298RNA PCR Primer, Index 1 (100% over 30bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT144960.14595241806185338No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC142590.14356619268377258RNA PCR Primer, Index 1 (100% over 27bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG142230.14320372806938056RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA141250.1422170188413134RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG140100.1410591457675611RNA PCR Primer, Index 1 (100% over 29bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA140070.14102894038302843No Hit
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC139460.1404147642308642RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCCCGACTGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT137830.1387736050045892RNA PCR Primer, Index 1 (100% over 30bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA136030.1369612819326291RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC131970.13287348655920797RNA PCR Primer, Index 1 (100% over 26bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA130080.13097054733364988No Hit
CAGTCGGTAGAGCATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG127220.1280909673415355RNA PCR Primer, Index 6 (100% over 34bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA125220.12607727503935762RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC123410.12425488350588662No Hit
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT123290.12413406196775595No Hit
ATCTATTGATGAAACAAACACTTCGGATCTGACTTCTGAGTTGGAATTCT122040.12287550427889478No Hit
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA121920.1227546827407641RNA PCR Primer, Index 1 (100% over 28bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT121340.12217071197313252No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG119100.11991537659469327RNA PCR Primer, Index 1 (100% over 29bp)
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG118870.11968380197994281No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC118510.11932133736555081No Hit
TATTGCACTTGTCCCGGCCTGTTTTGGAATTCTCGGGTGCCAAGGAACTC113380.1141562166104645RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA111580.11234389353850442RNA PCR Primer, Index 1 (100% over 28bp)
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAGA111140.11190088123202528RNA PCR Primer, Index 17 (100% over 38bp)
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA110950.11170958046331839RNA PCR Primer, Index 1 (100% over 28bp)
TCTGACACCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAGAGA109750.11050136508201165RNA PCR Primer, Index 17 (100% over 40bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT109300.11004828431402161No Hit
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA108010.10874945277911689RNA PCR Primer, Index 1 (100% over 28bp)
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC107280.10801445508882195RNA PCR Primer, Index 1 (100% over 31bp)
TGTTGTGATGTGATCTTGTGATCCTGATGCTCATGAAGGCTCATACTGAA106600.10732979970608147No Hit
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC105070.10578932509491538RNA PCR Primer, Index 1 (100% over 27bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC100730.10141961279918937No Hit
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC100230.1009161897236449No Hit
TGTAAACATCCTTGACTGGAAGCTTGGACTTCTCGGGTGCCAAGGAACTC99560.1002416028024153RNA PCR Primer, Index 1 (96% over 26bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATCAAAT302.509647E-644.050871
CAGGTAT2000.044.0009717
ATAGGCG3150.044.0009716
ATAGATA408.3218765E-944.0009716
GTTAGCC454.802132E-1044.0009718
GCAGGTA3750.044.0009716
CCTTATT351.4473335E-744.00096517
ATTACCA1300.044.00096516
ATAACTA5950.044.0000822
ACACGGC1450.043.99875314
CTATAGG4050.043.99875312
TAGGATA254.4460503E-543.99875312
GGGATAG254.4460503E-543.99875313
TATATTA850.043.9987513
CAAGATA302.5301742E-643.9987512
AAGTCCG650.043.9987519
ACGTTTA1100.043.9985339
TATAGGC207.860683E-443.9985315
GTTTCGC254.446711E-543.99764628
ATTCGCC950.043.99764326