FastQCFastQC Report
Mon 5 Dec 2016
JG11_1_GTCCGC_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG11_1_GTCCGC_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19671017
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA14297227.268165138589429RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC11930086.064800818381683RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA9077654.614733442607466RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG6243453.1739335083691906RNA PCR Primer, Index 1 (100% over 29bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT5016212.5500511742732974No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3857641.961078067290573RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG3275101.6649367950828369RNA PCR Primer, Index 1 (100% over 29bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC2352351.1958456443812744No Hit
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1743970.8865682948675201RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1743440.8862988629413516RNA PCR Primer, Index 1 (100% over 33bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1558930.792500967286033RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG1553320.7896490557656476RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA1516970.7711700925274987RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1491160.7580492660852258RNA PCR Primer, Index 1 (100% over 27bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1424990.724410944284172RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC1343430.6829489293817397RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1339680.6810425714135675RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA1264630.642889993943882RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1249360.635127304297485RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1166570.5930400039814921RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1092610.5554415412278887RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1054920.5362813727424465RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG973340.49480919059751716RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA946420.48112408219666525RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC941200.47847043190496963RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA928680.4721057381018989RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA911090.4631636483258593RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA888560.451710249653081RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC874370.4444965911015175RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG856460.4353918254455273RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA757320.38499280438830386RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT732750.3725023469808399RNA PCR Primer, Index 1 (100% over 30bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA715900.3639364451771863RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG710530.36120654056676377RNA PCR Primer, Index 6 (100% over 34bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG706310.35906125239991404RNA PCR Primer, Index 1 (100% over 29bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA672040.34163968238144476RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG660990.33602228090189745RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT658290.3346497031648135RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC657230.3341108393124768RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA657200.33409558844873144RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG640650.3256821952825317RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG613540.31190049807795905RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA607450.3088045727376475RNA PCR Primer, Index 1 (100% over 28bp)
ACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAG605520.30782343383669486No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG599680.30485459902759476No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA597590.3037921221866668RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC594550.3022467013271352RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC589370.29961338552043343RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC582170.2959531782215429RNA PCR Primer, Index 1 (100% over 27bp)
CTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAAC551320.2802702066700466No Hit
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG517650.2631536539264848RNA PCR Primer, Index 1 (100% over 29bp)
TACGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTA493300.25077503618648694No Hit
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA488920.24854841007966186RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA441470.2244266272557235RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT438020.22267277792500512RNA PCR Primer, Index 1 (97% over 35bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA434800.2210358518830013RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA422730.21489992103611114RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA418420.2127088802780253RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC411530.20920626523783697RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG409640.20824546082187817RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA408130.20747783401336087RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA404550.2056578976064125RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA394790.20069628326791644RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG356760.18136327166002653RNA PCR Primer, Index 1 (100% over 29bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA346340.17606613831913215RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC338570.17211616460907944RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA326340.16589889582221398RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA323910.16466357585883842RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA321390.16338250330422674RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC317580.1614456436085638RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC315590.16043400298012045RNA PCR Primer, Index 1 (100% over 26bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA315580.160428919358872RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA307630.156387440466347RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC301190.15311358838233935RNA PCR Primer, Index 1 (100% over 27bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA291290.14808080334636486RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGC286760.14577792292081287RNA PCR Primer, Index 18 (100% over 50bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC282440.14358179854147857RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA278700.14168052419455485RNA PCR Primer, Index 1 (100% over 28bp)
ATCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC278060.14135517243465348RNA PCR Primer, Index 1 (100% over 26bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC276620.1406231309748754RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA274730.13966232655891658RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA264060.13423810268681075RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA262870.1336331517582441RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA259540.13194030588250724RNA PCR Primer, Index 1 (100% over 28bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG259540.13194030588250724RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC256340.13031354708300033RNA PCR Primer, Index 1 (100% over 26bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCG256260.13027287811301266RNA PCR Primer, Index 18 (100% over 45bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC255780.13002886429308663RNA PCR Primer, Index 1 (100% over 26bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTC250900.1275480571238386RNA PCR Primer, Index 1 (97% over 36bp)
ACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAA240730.12237801431415571No Hit
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA240580.12230175999542882RNA PCR Primer, Index 1 (100% over 28bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC235860.11990229076615612RNA PCR Primer, Index 1 (100% over 33bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGCTGAAGAACGCAGCT235810.11987687265991383No Hit
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC234410.11916516568512955RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA234210.11906349326016037RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA232710.1183009500728915RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG227200.11549987476499055RNA PCR Primer, Index 1 (100% over 29bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA226720.1152558609450645RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC224750.11425438755911807RNA PCR Primer, Index 1 (100% over 26bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA223020.11337492108313464RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT222770.11324783055192315RNA PCR Primer, Index 1 (100% over 30bp)
TTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCT220270.1119769252398084RNA PCR Primer, Index 18 (100% over 43bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC218070.11085852856514739RNA PCR Primer, Index 1 (100% over 27bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA217500.11056876215398523RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC214060.1088199964445153RNA PCR Primer, Index 1 (100% over 27bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA213110.10833705242591167RNA PCR Primer, Index 1 (100% over 28bp)
TGAGTTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA212110.10782869030106577RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA207000.1052309598431032RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG203130.10326359841994952RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC202860.10312634064624111RNA PCR Primer, Index 1 (100% over 27bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA202620.1030043337362781RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA202560.10297383200878735RNA PCR Primer, Index 1 (100% over 28bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA202330.10285690872007278No Hit
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA200170.10175884653040562RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC197530.10041677052081241RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACTACC20300.044.042031
TTACGTA650.044.0420271
AACATTC3878100.044.0113641
TAAGCCC207.8883674E-443.9673462
CATTTAG254.4649903E-543.9673462
GCGAGTA207.8883674E-443.9673462
CTATTAC1000.043.9668963
CTTAGTA650.043.964894
AGTAAGA2650.043.9648864
AGTTAAC3450.043.9645545
GTAAGAG2750.043.964555
ACCTATC3300.043.96265416
CGGCCTA1900.043.9626515
CGTTAGC5900.043.96198312
CACGAGG207.893109E-443.9619813
CACGAAT207.893109E-443.9619813
CGAATAC254.4682074E-543.9619811
ATGCGAA207.893109E-443.9619810
CGCGTAT850.043.9585217
CGATAAG351.4584475E-743.9585220