FastQCFastQC Report
Mon 5 Dec 2016
JG11_3_GTCCGC_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG11_3_GTCCGC_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8586341
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG3955384.606595521887612RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3329793.8780081061304226RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2993103.485885314827352RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG2687853.130378819103504No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2044472.3810724498363154RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1757202.046506189306947RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA1536911.7899475457590142No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1303671.5183068084531002RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG1108581.291097104109888No Hit
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1094491.2746873202450264RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA1076001.253153118423785RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC995261.159120048924216RNA PCR Primer, Index 1 (100% over 27bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG920621.0721912861369005No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC896601.0442166226568452No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC818380.9531184470777483No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA760440.8856391797157834RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC727960.8478116580741435RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA696660.8113584121571692RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA561120.653503046291779RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC534400.6223838536112182No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC528940.6160249167835286RNA PCR Primer, Index 1 (100% over 26bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG474890.5530761007511814Illumina Small RNA Adapter 2 (100% over 21bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA471850.5495355937995008No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG439610.5119875858645726RNA PCR Primer, Index 6 (100% over 34bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC421560.49096582583896914No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA416410.4849679275491155RNA PCR Primer, Index 1 (100% over 22bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA407200.4742415890540569No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA373680.43520284135RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT357010.4157882851379883RNA PCR Primer, Index 1 (97% over 35bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA355810.4143907166044302RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT332070.386742152448872No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCA326070.3797543097810814RNA PCR Primer, Index 18 (100% over 40bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT294970.34353399195303336No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC290640.3384910988277777RNA PCR Primer, Index 1 (100% over 26bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA288300.3357658401873394RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG267410.3114365012989817RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG260150.30298121167095504RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT254790.2967387388877288RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC252790.29440945799846524RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC252670.2942697011451094RNA PCR Primer, Index 1 (100% over 27bp)
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT246220.28675777027723454No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG243490.2835783018633897RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG242740.28270482152991594RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC235520.27429611751967453RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG233000.2713612235992025RNA PCR Primer, Index 1 (100% over 29bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT220240.2565004115257011No Hit
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA213280.248394514031064No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG208350.24265283663902937No Hit
CACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCC207530.24169783147443133No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA206500.2404982518164606RNA PCR Primer, Index 1 (100% over 32bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG205610.2394617218207383RNA PCR Primer, Index 1 (100% over 29bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA193080.22486877704950226No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT191410.22292382750696715RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA189850.22110698841334162No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC187420.2182769121328864RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA186340.21701910045268408RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGC186030.21665806191484824RNA PCR Primer, Index 18 (100% over 50bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG178280.20763209846895203RNA PCR Primer, Index 6 (100% over 34bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA177740.20700319262885086RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC175160.20399842028170093RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC172770.20121492961903098RNA PCR Primer, Index 1 (100% over 27bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG172660.20108681917012147No Hit
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA171820.20010852119663078No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC168080.195752765933708No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA159660.18594649338990848RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG159460.18571356530098213RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA159430.18567862608764316RNA PCR Primer, Index 1 (100% over 32bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA159280.1855039300209484No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG157410.18332605238948696RNA PCR Primer, Index 1 (100% over 29bp)
ATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTCA153640.1789353579132252No Hit
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT149860.1745330170325171No Hit
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTC147890.1722386753565925RNA PCR Primer, Index 1 (97% over 36bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC147850.17219208973880726No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA145970.1700025657028995RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC145020.16889615728049934No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC144980.16884957166271408RNA PCR Primer, Index 1 (100% over 27bp)
ATCTATTGATGAAACAAACACTTCGGATCTGACTTCTGAGTTGGAATTCT144970.16883792525826774No Hit
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT143700.1673588318935854No Hit
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC141610.164924733364305No Hit
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG140060.16311954067512577RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC139060.161954900230494RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC138600.16141916562596337RNA PCR Primer, Index 1 (100% over 31bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT134400.15652767575850995RNA PCR Primer, Index 1 (100% over 30bp)
ACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCC130070.15148478263325438No Hit
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT129840.15121691533098908No Hit
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA128110.1492020873617761No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA123540.1438796805298089RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT121140.14108454346269267RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA121000.14092149380044422RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA120530.14037411279146728RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC117460.13679866662644774RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA115240.1342131648393652RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC114030.1328039499013608RNA PCR Primer, Index 1 (100% over 26bp)
TGTTGTGATGTGATCTTGTGATCCTGATGCTCATGAAGGCTCATACTGAA112290.1307774755277015No Hit
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT111480.12983411676754975No Hit
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG110950.12921685733189492No Hit
GAGCAATGAGGATAAAAACTCAACAGAGATGTACTGTGGTGATCGTATAC109910.1280056312694779No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA109790.12786587441612207RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA107210.1248611020689721RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG106240.12373140083767929No Hit
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC105480.12284627409975915RNA PCR Primer, Index 1 (100% over 27bp)
AACAGCTGTTGAGAAATAATCGATCTGACATGGAATTCTCGGGTGCCAAG103000.11995796579707235No Hit
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA98440.11464720536955147RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT98110.114262874022823RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC97470.11351750413825866RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCCCGACTGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT97250.11326128324043967RNA PCR Primer, Index 1 (100% over 30bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG95870.11165407942684782RNA PCR Primer, Index 1 (100% over 29bp)
TCTGAATGAATGTGATGAAAATCCAACACCCCTGACTTGGAATTCTCGGG94630.11020992527550444No Hit
GCCCCAGTCTGATGTTTGGTGACTGATTGGTATCTTCTGATCTGGAATTC93890.10934809134647692No Hit
CCCCTTCACTCTCCAATGAGTGAGATCCTCCGTCTGACATGGAATTCTCG93560.10896375999974843No Hit
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTAT92860.1081485116885062RNA PCR Primer, Index 18 (100% over 48bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT91770.10687905360385758RNA PCR Primer, Index 1 (100% over 30bp)
CTGTTGTGATGTGATCTTGTGATCCTGATGCTCATGAAGGCTCATACTGA91100.10609874450595429No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA90530.10543489945251418RNA PCR Primer, Index 1 (100% over 28bp)
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA89980.1047943472079667RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA89370.10408391653674132RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC88880.10351324271887176RNA PCR Primer, Index 1 (100% over 27bp)
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCG88040.10253494474538107No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC87970.10245341991425684No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGCCGC454.765752E-1044.03286744
ATACTTA207.8304845E-444.03286744
TACTTCT454.802132E-1043.99901622
ATAACTA4250.043.99901622
CGATAAT254.4469132E-543.9972220
GCCAATT207.8620005E-443.99696719
TAGGCAA302.53084E-643.99696417
GTATTTA1200.043.99619724
GTTTCGC302.5311438E-643.99619728
TAGGTGC207.8626774E-443.99619723
ACGTGCC12950.043.99619724
GTGACGG502.7284841E-1143.99619726
CCCGCTT3200.043.99619726
ATAGGCG2250.043.9959416
ATAGCCA207.862903E-443.9959416
CCAAAAT302.5312456E-643.9959416
TCGAGTA650.043.9944082
TCACCTA207.864256E-443.9944042
CCATGCG2850.043.99312215
TATAGGC254.4493598E-543.99312215