FastQCFastQC Report
Mon 5 Dec 2016
JG13_3_GTGAAA_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG13_3_GTGAAA_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7947694
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4271265.374212947805993RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG4064215.113697130261935RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3048273.8354143981889592RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2376552.9902384263913535RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2348592.955058410653455RNA PCR Primer, Index 1 (100% over 33bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG2341352.9459488500689632No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1338881.6846144302989017RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1010541.2714883084326094RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC998831.2567544749458144RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA812861.0227620741311882RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA790100.994124836713643RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA779400.9806618120929166RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC774980.9751004505206164RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA703680.8853888939357756RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA520410.6547937049413327RNA PCR Primer, Index 1 (100% over 28bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG513980.6467033079028961No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG507190.6381599492884351RNA PCR Primer, Index 6 (100% over 34bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC503280.6332402832821696RNA PCR Primer, Index 1 (100% over 26bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA489860.6163548823092585No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA465980.5863084310996372RNA PCR Primer, Index 1 (100% over 28bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG445300.5602883050102332Illumina Small RNA Adapter 2 (100% over 21bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG417010.5246930744943124No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT413190.519886648882053RNA PCR Primer, Index 1 (97% over 35bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT385100.48454306368614597No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGAAAA380370.4785916518678248RNA PCR Primer, Index 19 (100% over 40bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG370670.4663868538471662RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA360410.45347744893046965RNA PCR Primer, Index 1 (100% over 22bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT341690.4299234469771987RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC333820.4200212036346644RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA326860.4112639464981918RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG317050.39892074355152574RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG312120.39271768641319105RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG309110.38893042434698666RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTG304790.3834948854346934RNA PCR Primer, Index 15 (97% over 36bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC291690.367012116973804No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC282810.3558390647652011RNA PCR Primer, Index 1 (100% over 26bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC279020.35107038595094375No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA278850.3508564874289322RNA PCR Primer, Index 1 (100% over 32bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT273640.34430112684257846RNA PCR Primer, Index 1 (100% over 30bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG246820.3105554894287576RNA PCR Primer, Index 6 (100% over 34bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG245410.30878138992266185RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA242060.3045663308124344RNA PCR Primer, Index 1 (100% over 28bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT241330.30364782539438484No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGAAAATCTCGTATGC230450.28995831998564614RNA PCR Primer, Index 19 (100% over 50bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC228590.28761801850951985RNA PCR Primer, Index 1 (100% over 27bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG218980.2755264608828674RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA217930.27420532295279615No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT216220.27205375546668004RNA PCR Primer, Index 1 (100% over 30bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG215990.2717643633486644RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC200670.25248833183562425No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC198500.24975798011347694RNA PCR Primer, Index 1 (100% over 27bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC198340.24955666385746608No Hit
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC196980.24784547568137372RNA PCR Primer, Index 1 (100% over 31bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG193890.24395755548716394RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC187160.235489690468707RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA178220.22424114466410003RNA PCR Primer, Index 1 (100% over 28bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA175070.22027773087388616No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA174840.21998833875587057RNA PCR Primer, Index 1 (100% over 28bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA170970.2151190018136078RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC170310.214288572257563No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC165090.20772062940520858RNA PCR Primer, Index 1 (100% over 27bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC161790.20356848162498453No Hit
TTGTTGTGATGAAACTAAACTGAAAATAGCTGGAATTCTCGGGTGCCAAG157680.19839717029870552No Hit
TGTAAACATCCTTGACTGGAAGCTTGGACTTCTCGGGTGCCAAGGAACTC157570.19825876537269807RNA PCR Primer, Index 1 (96% over 26bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA156580.1970131210386308RNA PCR Primer, Index 1 (100% over 32bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT156430.19682438704862062RNA PCR Primer, Index 1 (100% over 30bp)
ATCTATTGATGAAACAAACACTTCGGATCTGACTTCTGAGTTGGAATTCT154510.19440859197649027No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG154160.19396821266646652No Hit
TGTAAACATCCCCGACTGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT150110.18887239493619157RNA PCR Primer, Index 1 (100% over 30bp)
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA149890.18859558508417662No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT149670.18831877523216167RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA146010.1837136658759132RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC141740.1783410382936233RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA140100.17627754666951195RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC138630.17442795356741211RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA138000.17363527080936936RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT137300.17275451218932183RNA PCR Primer, Index 1 (100% over 30bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC134940.16978509741316158RNA PCR Primer, Index 1 (100% over 27bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT131140.1650038363329036No Hit
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT126640.15934181663259808No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG126370.15900209545057975No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT124590.1567624521024589No Hit
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG120820.15201893782020295RNA PCR Primer, Index 1 (100% over 29bp)
GCTTACGGCCTGGAATTCTCGGGTGCCACGGAACTCCAGTCACGTGAAAA120610.15175471023418868RNA PCR Primer, Index 19 (97% over 40bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA119560.15043357230411739No Hit
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA118850.14954023141806919RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA118690.14933891516205833RNA PCR Primer, Index 1 (100% over 28bp)
AAACCGTTACCATTACTGAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC118190.1487098018620244RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC117250.14752706885796055RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA115510.14533775457384243RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC115470.1452874255098397No Hit
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG114190.1436768954617528No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC108660.13671890236337736RNA PCR Primer, Index 1 (100% over 27bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC107870.13572490334932372RNA PCR Primer, Index 1 (100% over 33bp)
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC107730.1355487516253142RNA PCR Primer, Index 1 (100% over 27bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG107700.13551100482731218RNA PCR Primer, Index 1 (100% over 29bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA107140.13480639793127416RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC106690.1342401959612436No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC105590.1328561467011689No Hit
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA104330.13127078118508337RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC103170.1298112383290046No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA98840.12436311715071063RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG98410.12382207971268144RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA97850.12311747281664343RNA PCR Primer, Index 1 (100% over 28bp)
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA93300.1173925417863345RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT92640.11656211223028969No Hit
TGTAAACATCCTACACTCTCAGCTTGGACTTCTCGGGTGCCAAGGAACTC91060.11457411420218243RNA PCR Primer, Index 1 (96% over 26bp)
AACAGCTGTTGAGAAATAATCGATCTGACATGGAATTCTCGGGTGCCAAG89290.11234705312006224No Hit
TGAGGTAGTAAGTTGTGTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA89270.11232188858806089RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC88850.11179343341603237RNA PCR Primer, Index 1 (100% over 26bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA87700.11034647282595429No Hit
GCCCCAGTCTGATGTTTGGTGACTGATTGGTATCTTCTGATCTGGAATTC87620.11024581469794886No Hit
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC84860.10677310928176148RNA PCR Primer, Index 1 (100% over 27bp)
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC84160.10589235066171396RNA PCR Primer, Index 1 (100% over 27bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA83640.10523807282967865No Hit
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA82990.10442022553963451RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG82910.10431956741162908RNA PCR Primer, Index 1 (100% over 29bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT82730.10409308662361685No Hit
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC81980.10314941667356593RNA PCR Primer, Index 1 (100% over 31bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA81730.10283486002354897RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACTTAA2900.044.0492021
CAAGTCG207.81616E-444.0492021
TTATGCA454.7475623E-1044.0492021
TGCATAT1500.044.0492021
ACCATCG2850.044.04921
ATACTTA207.844082E-444.0173244
TAAGTGA600.044.0004232
ACCCGCG302.5294485E-644.0004232
CGTAACG254.444975E-544.000422
GTGCCTT1150.044.0001518
AATTGCT207.859168E-444.00014517
TAGATAT408.3236955E-944.00014517
AGCGATT750.044.0001418
ATTAGGT351.4477155E-743.99931716
ATAGGCA4750.043.99931316
ATAGATA408.3236955E-943.99931316
GCCAGTA1300.043.99931316
GCGATAT950.043.9987619
ACTTCCC207.8608724E-443.99820723
AGCGAGC302.5303252E-643.99820723