FastQCFastQC Report
Mon 5 Dec 2016
JG13_5_GTAGAG_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG13_5_GTAGAG_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17019232
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA10848786.374423945804369RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA7374244.332886466322335RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC7074134.156550659865263RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA5437343.1948210118999496RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3938182.3139587027193707RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA3887052.2839162190162283RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3809322.238244357912272RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3260861.9159853981660278RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC3032681.7819135434548397RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2820641.657325077888356RNA PCR Primer, Index 1 (100% over 33bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG2645621.5544884751556358RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2610011.533565086838231RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC2577731.5145983085488228RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA2103731.236089854113276RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1910371.1224772069621003RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1864491.095519468798592RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG1657330.9737983476575207RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1420560.8346792616729122RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC1401770.8236388104939165RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAGAGATCTCGTATGC1227180.7210548631101568RNA PCR Primer, Index 17 (100% over 50bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC1014650.5961784879599737RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT920700.5409762320649957RNA PCR Primer, Index 1 (100% over 30bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT875000.5141242566057035RNA PCR Primer, Index 1 (100% over 30bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT820450.48207228152245646RNA PCR Primer, Index 1 (100% over 30bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA783560.46039680286396RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG731390.42974324575868056RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG721540.4239556755557478RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA707770.41586482868322144RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC686330.4032673154699342RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA676440.39745624244384237RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA639030.3754752270842774RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG628060.36902957783288926RNA PCR Primer, Index 6 (100% over 34bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG618480.36340065168628055RNA PCR Primer, Index 1 (100% over 29bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG610920.35895861810920726RNA PCR Primer, Index 6 (100% over 34bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG559330.328645851939735RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC541190.31798732163707505RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC527490.3099376047050772No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA513540.3017409951283348RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC512620.3012004301956751RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA505290.29689353785176675No Hit
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG499330.2933916172010582RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTA496260.29158777552359594RNA PCR Primer, Index 3 (97% over 36bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA467330.2745893586737639RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC458250.2692542178166441RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG429900.25259659190261935RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA429210.2521911682031246RNA PCR Primer, Index 1 (100% over 28bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA424550.24945308930508733RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG424120.2492004339561268RNA PCR Primer, Index 1 (100% over 29bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT413190.24277828752789785RNA PCR Primer, Index 1 (97% over 35bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA412310.24226122541839726RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC410200.24102145149675377RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA406140.2386359149461033RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC399550.23476382483063868RNA PCR Primer, Index 1 (100% over 27bp)
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA379020.22270100084422143RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC377440.22177263932943625No Hit
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA371870.21849987120452907RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT368460.21649625553021426No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA355230.20872269677033603RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA350860.20615501334020242RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG335260.19698891230814647RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA325120.19103094663731007RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG323850.19028473200200807RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA320250.18816947791768746RNA PCR Primer, Index 1 (100% over 28bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT306630.18016676663200784RNA PCR Primer, Index 1 (97% over 35bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA301000.176858744272362RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC290310.17057761478308775No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC281000.16510733269280306RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC268700.15788021457137433RNA PCR Primer, Index 1 (100% over 26bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG268320.1576569377513627Illumina Small RNA Adapter 2 (100% over 21bp)
CACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAG265010.15571207913494567RNA PCR Primer, Index 3 (97% over 37bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA260840.15326190982060767RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA255460.15010078010570632RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTTGGAATTCTCGGGTGCCAAGGAACTC254440.14950145811514878RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC250400.14712767297607787No Hit
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG234360.1377030408892716RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA233110.13696857766554918RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC232450.13658078108342372RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC231090.13578168509601374RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC223380.13125151593209378RNA PCR Primer, Index 1 (100% over 26bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG221410.1300940018915072RNA PCR Primer, Index 1 (100% over 29bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA219470.12895411496828998RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC219270.1288366008524944No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC219000.12867795679617036No Hit
TTCACAGTGGTTAAGTTCTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC215210.12645106430184394RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA214370.12595750501550246RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT213720.1255755841391668RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA211570.1243123073943642RNA PCR Primer, Index 1 (100% over 28bp)
TTCACGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA210790.12385400234276142RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG210070.1234309515258973No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA204210.11998778793308654RNA PCR Primer, Index 1 (100% over 22bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA200060.11754937003032806RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC195560.11490530242492729RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA189950.11160903147686099No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC189380.11127411624684357RNA PCR Primer, Index 1 (100% over 26bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA185330.10889445540198288RNA PCR Primer, Index 1 (100% over 28bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC177310.10418213935857974RNA PCR Primer, Index 1 (100% over 27bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA175120.10289535979061805RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA173240.10179072710213952RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG171670.10086824129314413RNA PCR Primer, Index 1 (100% over 29bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA170880.10040406053575156No Hit
CCCAGTGTTCAGACTACCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA170320.10007502101152391RNA PCR Primer, Index 1 (100% over 28bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCTAAA302.4893943E-644.1030431
CTAACGA207.769538E-444.103041
TCCTTAA408.1545295E-944.103041
AACATTC2130100.044.082341
AACAGTA229100.044.0260351
CATAAGT454.802132E-1043.999122
CTATCGT408.3273335E-943.99795518
GCGTGTT254.446659E-543.99795517
GCGCTAA650.043.99795519
CTAGCCG254.446659E-543.9979553
CACGGTA254.447893E-543.99588811
ATATCTA502.7284841E-1143.99588812
GCCAGCG600.043.9958886
ATACGTC408.3309715E-943.9958844
TCCTTCA966650.043.991261
TAGCTTA402900.043.9881021
TTCAAGT1457700.043.9865571
TATTGCA483050.043.975221
TACCCTG804950.043.952371
AAGCTGC619600.043.928651