FastQCFastQC Report
Mon 5 Dec 2016
JG14_3_GTGGCC_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG14_3_GTGGCC_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8847751
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG7221638.162108088258812RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA5918936.689756526828116RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG3164733.576875072546684No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2702333.0542563867360193RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2052032.3192673482786756RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1768991.9993668447495865RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA1370511.5489925066833368No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1062311.2006553981910206RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA999601.1297786296201147RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG985211.113514609531846No Hit
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC910251.0287925146175565RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA870390.9837415180422686RNA PCR Primer, Index 1 (100% over 28bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG836990.9459918119305121No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC792460.8956626378839098No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC703240.7948234528751995RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA653900.7390578690562155RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA645510.7295752332994RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC634800.7174704622677559No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG590020.6668587305406765RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA557630.6302505574580478RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA473020.5346217360773375RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG470420.5316831362003746RNA PCR Primer, Index 6 (100% over 34bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC410310.4637449675064319RNA PCR Primer, Index 1 (100% over 26bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC400720.4529060548833257RNA PCR Primer, Index 1 (100% over 27bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT400240.45236354413680946RNA PCR Primer, Index 1 (97% over 35bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC394750.4461585774735297RNA PCR Primer, Index 1 (96% over 33bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC394420.4457856013352998No Hit
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA378070.42730632903208965RNA PCR Primer, Index 1 (100% over 28bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA361480.4085558013556213No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT355780.4021134862407408No Hit
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC353950.4000451640196475No Hit
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA347930.393241175073756No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT323570.36570875468805575RNA PCR Primer, Index 1 (100% over 30bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA315810.35693816428604286RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA307470.3475120400653228RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG287280.32469268178998256No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC282300.31906413279487633No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT281380.3180243205307202RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC261220.29523886917703723No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA260720.29467375381608274No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG252800.28572232649856444Illumina Small RNA Adapter 2 (100% over 21bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG250750.2834053535186512RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTG242640.2742391823639702RNA PCR Primer, Index 15 (97% over 36bp)
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA241000.2723856039800397No Hit
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA240860.27222737167897243RNA PCR Primer, Index 1 (100% over 28bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG236000.26673445037049526RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG229190.2590375791542958RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG228540.25830292918505504RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC226820.2563589323433718RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT226700.2562233046567427RNA PCR Primer, Index 1 (100% over 30bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT224660.2539176339840486No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA220270.24895592111486864RNA PCR Primer, Index 1 (100% over 32bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC220000.24865075881995322RNA PCR Primer, Index 1 (100% over 26bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT215920.244039417474565No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA213880.24173374680187087RNA PCR Primer, Index 1 (100% over 22bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT209780.2370998008420445RNA PCR Primer, Index 1 (100% over 30bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA202060.22837441966890795RNA PCR Primer, Index 1 (100% over 32bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT200490.22659995743551103No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG194750.22011243309175405No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT193470.2186657377677107No Hit
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC191340.2162583463300448RNA PCR Primer, Index 1 (100% over 26bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA178760.20204004384843108RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA168450.19038736510555054RNA PCR Primer, Index 1 (100% over 28bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA166960.18870332132990633No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC166830.18855639133605817No Hit
CACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCC165170.18668020833768942No Hit
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC163250.18451016535162437RNA PCR Primer, Index 1 (100% over 27bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA157080.1775366417974466No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC153980.1740329265595291RNA PCR Primer, Index 1 (100% over 26bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG149310.16875474908821464RNA PCR Primer, Index 6 (100% over 34bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT144850.16371392006850102No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC142720.1613065286308351RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGGCCATCTCGTATGC142080.16058318096881344RNA PCR Primer, Index 20 (100% over 50bp)
ATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTCA141020.15938513640359003No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG137510.15541802656968987RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC136660.15445733045606733RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC136540.15432170276943824RNA PCR Primer, Index 1 (100% over 31bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA135890.15358705280019747RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG133990.15143961442857062RNA PCR Primer, Index 1 (100% over 29bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT133630.1510327313686834No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG126990.14352799937520846RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA124440.14064591103434082RNA PCR Primer, Index 1 (100% over 28bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT121850.13771861346459682No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC118100.13348024825743854RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG116670.13186401832510883No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA113240.12798732694896137RNA PCR Primer, Index 1 (100% over 28bp)
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC111990.12657453854657527No Hit
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG111600.12613374856503082No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT111360.12586249319177267RNA PCR Primer, Index 1 (100% over 30bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA110950.12539909859579007RNA PCR Primer, Index 1 (100% over 28bp)
TGTTGTGATGTGATCTTGTGATCCTGATGCTCATGAAGGCTCATACTGAA108200.12229096411054063No Hit
ATCTATTGATGAAACAAACACTTCGGATCTGACTTCTGAGTTGGAATTCT107030.12096859416590725No Hit
GAGCAATGAGGATAAAAACTCAACAGAGATGTACTGTGGTGATCGTATAC106030.11983836344399837No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC105870.11965752652849296No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC105120.11880985348706129No Hit
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT102880.11627813666998539No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC102160.115464370550211RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACAAGGATTCATCCTGTGGAATTCTCGGGTGCCAAGGAACTCCA101090.11425502367776852RNA PCR Primer, Index 1 (100% over 28bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGGCCA99680.112661398359877RNA PCR Primer, Index 20 (100% over 40bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC97930.11068349459653645RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA94900.10725889550915256RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCC94450.10675029168429355No Hit
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG93930.10616257170890094RNA PCR Primer, Index 1 (100% over 29bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT93450.10562006096238469RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA92400.10443331870438036RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC91340.10323527413915695RNA PCR Primer, Index 1 (100% over 26bp)
GCCCCAGTCTGATGTTTGGTGACTGATTGGTATCTTCTGATCTGGAATTC89420.1010652311530919No Hit
ATGACCTATGAATTGACAGCCAGTGGAATTCTCGGGTGCCAAGGAACTCC88590.10012713965390752RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATTCGGT502.7284841E-1144.040711
GCTAGTT351.4370744E-744.040711
ACCATCG2400.044.0407071
AATTTAT351.4478428E-743.99889433
CCAATTA302.530087E-643.99889434
CGCTTCG302.530087E-643.99889433
GACGAAT3950.043.9988933
ATAACTA5050.043.99690222
TCACCTC3150.043.99665525
CCAGACG207.8622875E-443.99665526
TAGGGCC8100.043.99665524
TTCGCCA1100.043.99665527
GCATGCG5150.043.99665524
CTAGGCG254.4472617E-543.99665523
ACCTTCG502.7284841E-1143.99665524
CCATTCG454.802132E-1043.99665525
ATTTAGC600.043.9966526
GTATTTA650.043.9966524
GCATACC207.862725E-443.9961628
CTATCGT207.8631623E-443.99566318