FastQCFastQC Report
Mon 5 Dec 2016
JG15_1_CCGTCC_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG15_1_CCGTCC_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23649284
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA19010628.038560490879977RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC16605287.021472616253415RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA10827894.578527620540225RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG9048603.82616234808631RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG5171122.1865862831196075RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3870461.6366076875731206RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA2590661.0954496550508674RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2410051.0190794782624286RNA PCR Primer, Index 1 (100% over 33bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2063380.8724915308218211RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC2004120.8474336897472244RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1885790.7973983482967181RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1786620.7554647320400905RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA1782870.7538790603554848RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1625160.687192051987705RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1557410.658544250219161RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG1537610.6501719037244426RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1536000.6494911220145185RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC1469510.621376105932002RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1461450.6179679689245561RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1198230.5066665020387087RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC1181140.499440067614732RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA1149060.48587517491015797RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC1147060.4850294833450348RNA PCR Primer, Index 2 (100% over 34bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1127250.4766529083924909RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1102610.4662339883101746RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG1082130.45757410668331433RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA1077510.45562055916788013RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC1056060.44655051713193517RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1041760.44050382244130526RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA1010950.4274759438805843RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG961240.40645628002945033RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC922070.389893410726515RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA921850.38980038465435146RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA876910.3707976951860361RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG849660.35927514761123425RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT842360.35618837339853504RNA PCR Primer, Index 1 (100% over 30bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA802580.33936756816823715RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC796610.33684317884634474RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA762410.32238185308274026RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG759770.32126554021677783RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA704980.29809781979023126RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG703500.2974720080320402RNA PCR Primer, Index 1 (100% over 29bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCC676030.28585643438507485RNA PCR Primer, Index 5 (97% over 35bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG648310.27413514929246907RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG641210.27113294423628215RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA625020.2642870710166109RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA623830.26378388453536267RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA589750.24937330026566554RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC589320.2491914765791641RNA PCR Primer, Index 1 (100% over 27bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCCG582280.2462146422699309RNA PCR Primer, Index 7 (97% over 36bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA551950.2333897296848395RNA PCR Primer, Index 1 (100% over 28bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA542900.22956297535265763RNA PCR Primer, Index 1 (100% over 28bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC525070.22202363504958542RNA PCR Primer, Index 1 (100% over 33bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC522670.22100880517143773RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA512440.21668309281583326RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA474620.200691065319356RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA473760.20032741794635306RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG469050.19833581431048822RNA PCR Primer, Index 1 (100% over 29bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA452490.1913334881512692RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC445930.18855961981766553RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA439520.18584917835144607RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA427310.18068623134636974RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG422940.17883839527657583RNA PCR Primer, Index 1 (100% over 29bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA421600.17827178192794335RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA420790.17792927684406853RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC409400.17311306338069263RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA407040.17211514733384742RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA388190.16414450433256247RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA388000.16406416363387577RNA PCR Primer, Index 1 (100% over 28bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA383950.16235163821450155RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC377010.1594170884835245RNA PCR Primer, Index 1 (100% over 26bp)
ATCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC376810.15933251932701217RNA PCR Primer, Index 1 (100% over 26bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA372690.15759039470285865RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT372570.15753965320895127RNA PCR Primer, Index 1 (100% over 30bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA362540.15329851000985908RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC351530.14864297794385656RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC341990.14460902917821952RNA PCR Primer, Index 1 (100% over 26bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA337210.14258782633757539RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC335380.14181401855548778RNA PCR Primer, Index 1 (100% over 27bp)
AATATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC334400.14139962968857747RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC329920.13950528058270178RNA PCR Primer, Index 1 (100% over 26bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA329200.13920083161925748RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA326440.13803377725938765RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA310510.1312978439431824RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA302400.1278685646466083RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC295950.12514120934908643RNA PCR Primer, Index 1 (100% over 27bp)
TTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCCGTCCATCT294270.12443082843438305RNA PCR Primer, Index 16 (100% over 43bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC290950.12302698043627876RNA PCR Primer, Index 1 (100% over 27bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA287860.1217203869681636RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG283470.11986409398271845RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA275720.11658703916786657RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA272920.11540307097669426RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC268670.11360597640080773RNA PCR Primer, Index 1 (100% over 27bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA266890.11285331090784821RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCCGTCCATCTCGTATGC266200.11256154731788075RNA PCR Primer, Index 16 (100% over 50bp)
ACCATTGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA265640.1123247536796463RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC263880.11158054510233797RNA PCR Primer, Index 1 (100% over 26bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA260520.11015978327293123RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG252750.1068742715424281RNA PCR Primer, Index 1 (100% over 29bp)
CTACTCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA250270.10582561400167548RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCCGTCCATCTCG241520.10212571340426206RNA PCR Primer, Index 16 (100% over 45bp)
AACATTCATTGCTGTCGCTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC240890.10185932056124829RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCTGGAATTCTCGGGTGCCAAGGAACTCCAG238590.10088677526135675RNA PCR Primer, Index 1 (100% over 29bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGCGTA5900.044.0238231
TACTAGC351.4415491E-744.0238231
TGACCTA1300.044.0107882
CGCGAAA454.802132E-1044.0106933
GCGCTTA454.802132E-1044.0106933
CGCAGTA3500.044.010693
AACATTC5416250.044.001471
TACGCGA1250.043.99571216
CGATAAG502.7284841E-1143.99571220
GTGCGTA502.7284841E-1143.9955258
AGTGAAC1544850.043.9527855
CATTCAA4918450.043.947163
TTCAACG5062200.043.942825
ATTCAAC5008800.043.9362344
GAACCGG1584650.043.933068
TTAGTAG170950.043.932535
ACCGGTC1583900.043.92469810
TCAACGC5203050.043.922866
CAGTGAA1531250.043.9151954
CAACGCT5201600.043.9116067