FastQCFastQC Report
Mon 5 Dec 2016
JG17_3_ACAGTG_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG17_3_ACAGTG_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8408462
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG4034164.7977382784152445RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3928164.671674796175567RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG3518224.184142117785631No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC2791233.319548806904283RNA PCR Primer, Index 5 (100% over 50bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1883272.2397318320520445RNA PCR Primer, Index 1 (100% over 33bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1428071.698372425302035RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1427381.6975518233893427RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1195641.4219485085381844No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1184861.4091280902500363RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1080001.2844203850835028RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG835060.9931185988591017RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC804410.9566672240416857RNA PCR Primer, Index 1 (100% over 26bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA793430.94360895012667RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC762790.9071694680905974RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA706420.8401298596580444RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC685830.8156426228720544No Hit
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA683890.8133354232914414RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG615640.7321671906229701No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA596710.7096541555399787RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC567280.6746537000464532RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA531100.6316256171461558RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA508010.6041651850243244RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC498890.5933189684391748No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC442680.5264696445081157RNA PCR Primer, Index 5 (100% over 35bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA426790.5075720149535076RNA PCR Primer, Index 1 (100% over 34bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA400100.47583018154806433RNA PCR Primer, Index 1 (100% over 34bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC395270.4700859681592186RNA PCR Primer, Index 1 (100% over 26bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT374320.4451705912448674No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG348490.41445153703495363No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC334820.39819410493857255RNA PCR Primer, Index 1 (96% over 33bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC315620.3753599647593103No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA303990.3615286600569759No Hit
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC291160.3462702215934377RNA PCR Primer, Index 1 (100% over 27bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC285590.3396459423851829No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA267980.3187027544395158RNA PCR Primer, Index 1 (100% over 32bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA265040.31520627672456625No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG264860.3149922066603857RNA PCR Primer, Index 1 (100% over 29bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA257840.30664347415734294No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT255380.30371784994687495No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG247770.2946674433445736No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG243440.2895178690228962RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC237870.28289358981464147No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC231530.2753535664429476No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA220620.26237854199733557RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA215820.25667000695251996RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA207490.2467633200934963RNA PCR Primer, Index 1 (100% over 32bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA205140.24396851647780532RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC194730.23158813109936155No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT193090.22963771495904958No Hit
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT192880.22938796655083893No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT191430.22766351325605086RNA PCR Primer, Index 1 (100% over 30bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC187890.2234534686604994No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG185810.2209797701410793RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA185390.22048027332465794No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGA179490.21346353233207216RNA PCR Primer, Index 5 (100% over 40bp)
GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA175700.2089561682029365No Hit
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT175400.20859938476263554No Hit
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT169010.20099989748422484RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC168840.2007977202013876RNA PCR Primer, Index 1 (100% over 26bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG165110.19636171276031217RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC163130.19400694205432575RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC160130.19043910765131603RNA PCR Primer, Index 1 (100% over 31bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA159060.1891665800475759RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA156970.18668098874681244RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA152580.18146005773707485RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACA151870.1806156702616959RNA PCR Primer, Index 5 (100% over 36bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC146840.17463360124598293No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC146470.1741935683362784No Hit
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA142740.16975756089520294RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT138830.16510748338994694RNA PCR Primer, Index 1 (100% over 30bp)
TCAGTAACTGGAATCTGTCCCTGCTGGACTTCTCGGGTGCCAAGGAACTC134980.16052876257275112RNA PCR Primer, Index 1 (96% over 26bp)
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC133990.1593513772197579No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA133930.1592800205316977RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG130300.15496294090405593RNA PCR Primer, Index 1 (100% over 29bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA129010.15342877211076175No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA127010.15105021584208858No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG125120.14880248016819247No Hit
GTTCCTGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC123860.14730398971892839No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC122730.14596010542712803No Hit
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTTGGAA121940.14502057570100216No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT121310.1442713304763701RNA PCR Primer, Index 1 (100% over 30bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA121060.14397401094278597RNA PCR Primer, Index 1 (100% over 28bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA119170.14172627526888984RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC117720.1400018219741018RNA PCR Primer, Index 1 (100% over 27bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG110280.13115359265463766No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA108290.12878692916730788No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA106530.12669379965087552RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT105150.12505259582549103RNA PCR Primer, Index 1 (100% over 30bp)
GTCTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGA104580.12437470728891918RNA PCR Primer, Index 5 (100% over 40bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA103980.12366114040831724No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC103900.12356599815757031RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA103000.12249564783666739RNA PCR Primer, Index 1 (100% over 28bp)
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC102090.12141340473442112No Hit
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC101290.12046198222695184RNA PCR Primer, Index 1 (100% over 27bp)
GCATGAGTGACTGGTTAATCTTTTGGAATTCTCGGGTGCCAAGGAACTCC100460.1194748813754525RNA PCR Primer, Index 1 (100% over 27bp)
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC100340.1193321679993321RNA PCR Primer, Index 1 (100% over 31bp)
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC99800.11868995780679036No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT99660.11852345886798324No Hit
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT96360.11459884102467252No Hit
TGTAAACATCCTTGACTGGAAGCTTGGACTTCTCGGGTGCCAAGGAACTC93490.11118561277912654RNA PCR Primer, Index 1 (96% over 26bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC93190.11082882933882558RNA PCR Primer, Index 1 (100% over 27bp)
GCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAA91340.1086286647903029No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG90390.10749885056268317RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG89540.10648796414849708RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC88680.10546518495296762No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA88340.10506083038729318RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC85090.10119567645069931No Hit
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA84540.1005415734768142RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC700.044.0241943
CATGATA207.854399E-444.005637
TCTATGT254.4462784E-543.99827235
TTCTCTA254.446591E-543.9977532
ATACATC700.043.99643723
ATAACTA1200.043.99617822
ACCTTCG750.043.99617824
ATACCTT5550.043.99617429
GTTGTTA254.4478395E-543.99565517
TACGTGC408.3309715E-943.9956552
CTTGCGT302.531353E-643.9956517
ATATTAG454.820322E-1043.99382414
ATTCCTA351.4491525E-743.9938212
TCCCCAA207.864988E-443.9935659
TTGCACG207.864988E-443.99356510
ATCTATA4900.043.9935610
TACCATT4900.043.993568
TACGCAA1950.043.9935611
TCCACCG1200.043.9935579
ATAGGCA1400.043.9930416