FastQCFastQC Report
Mon 5 Dec 2016
JG18_5_TGACCA_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG18_5_TGACCA_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15250809
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC7121294.669450650126167RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA6096703.997623994897582RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC4260832.7938386743942565RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3895422.5542382702452047RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3210652.1052325814322375RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA3112042.040573716450058RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA2982041.9553323367960347RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2417241.5849913273453233RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2009771.3178120583635924RNA PCR Primer, Index 1 (100% over 33bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1909021.251749989131724No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1765381.1575648216432322RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1419260.9306129268289964RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1403120.9200298816934892RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1288550.8449059981014778RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1211150.7941545920613129RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC1180230.7738802577620637No Hit
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1089600.7144539020848009RNA PCR Primer, Index 1 (100% over 28bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA937930.615003440145372No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG878330.5759235460886043RNA PCR Primer, Index 1 (100% over 29bp)
GTCTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAA822240.5391451692824951RNA PCR Primer, Index 4 (100% over 40bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC723000.4740732114604543RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC711270.4663818162039797RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG692180.4538644474532466RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA681370.4467762988835543No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA634420.4159910467700435RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT581690.3814158317765307RNA PCR Primer, Index 1 (100% over 30bp)
TCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA549490.36030219773914945No Hit
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA535310.3510043303276567RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA528180.3463291685050937RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC513370.33661820825373917No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT511030.33508386341996677RNA PCR Primer, Index 3 (100% over 34bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA500370.3280940702883368No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA433100.28398493483198173RNA PCR Primer, Index 1 (100% over 28bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA422910.2773033220729471RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC420680.2758411045604204No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA420330.27561160853827493RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA411300.26969061116692233RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT409770.26868738569868655RNA PCR Primer, Index 1 (100% over 30bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG395920.25960590025093094RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC390490.25604543339307445No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG390070.2557700381664999RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGA385250.25260955009009683RNA PCR Primer, Index 2 (97% over 36bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC382330.2506948975624834RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA377000.24720000099666845RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC359680.23584322641507083No Hit
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA347160.22763382585146794RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG345030.2262371786309828RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT338370.2218701971810151RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC324050.2124805313606642RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA320480.21013967193478064RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA310200.2033990459129086RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGC300340.19693381511761113RNA PCR Primer, Index 4 (100% over 50bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG299450.19635023951844127RNA PCR Primer, Index 2 (97% over 35bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA292220.19160950740383675RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC291260.1909800326002378No Hit
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC285280.1870589291361527RNA PCR Primer, Index 1 (100% over 27bp)
TTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC284560.1865868230334535No Hit
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA282750.18540000074750132RNA PCR Primer, Index 1 (100% over 28bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG269790.1769020908989156No Hit
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT267890.17565625535012602RNA PCR Primer, Index 3 (100% over 34bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA264090.17316458425254685RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA263750.1729416452596056No Hit
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG263100.17251543836133545RNA PCR Primer, Index 1 (100% over 29bp)
GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA262970.1724301969816814No Hit
TTCTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAA262760.17229249936839416RNA PCR Primer, Index 4 (100% over 40bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA258680.16961723145309865RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC256160.1679648600936514No Hit
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA254140.16664034019441198RNA PCR Primer, Index 1 (100% over 28bp)
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA253100.1659584091571798RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA252260.16540761870403073RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG249190.16339461073835493RNA PCR Primer, Index 1 (100% over 29bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA244600.16038493433364748RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC233910.15337547011440508RNA PCR Primer, Index 1 (100% over 26bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG221080.14496280164547337RNA PCR Primer, Index 1 (100% over 29bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG218030.14296290773820589Illumina Small RNA Adapter 2 (100% over 21bp)
CGCCTTGAAGCCCGGTTGCCGGCCCGTGGAATTCTCGGGTGCCAAGGAAC207210.13586820213930947RNA PCR Primer, Index 1 (100% over 24bp)
TCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA198080.12988163447591536No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA191840.1257900482525222RNA PCR Primer, Index 1 (100% over 28bp)
TATCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC189360.1241639050098916RNA PCR Primer, Index 1 (100% over 27bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA185100.1213706105689213No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG180680.1184724036606845No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA180630.11843961851466371RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA179750.11786259994469803RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG176660.11583647792061391RNA PCR Primer, Index 1 (100% over 29bp)
AACATTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA174120.11417099250275838RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC172180.11289892883715218No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCCA171770.11263009063978179No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA168040.11018431874663173RNA PCR Primer, Index 1 (100% over 32bp)
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC166700.10930567683327488RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC164110.10760740626939856RNA PCR Primer, Index 1 (100% over 26bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG163710.10734512510123234RNA PCR Primer, Index 1 (100% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC162660.10665663703479598No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC161780.10607961846483029RNA PCR Primer, Index 1 (100% over 27bp)
GTTCCTGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC157450.10324042481943088No Hit
TAGCTTATCAGACTGGTGTTGGCTTGGAATTCTCGGGTGCCAAGGAACTC155110.10170607998565846RNA PCR Primer, Index 1 (100% over 26bp)
CCCAGTGTTCAGACTACCTGTTCTGGAATTCTCGGGTGCCAAGGAACTCC153900.10091267945195562RNA PCR Primer, Index 1 (100% over 27bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATGCGA453.6379788E-1045.2586725
ACGTTCG320400.044.69364524
CGTTCGC324650.043.99006325
TTCGCTA254.542817E-543.8387371
AACAGTA142550.043.823361
AACATTC1458550.043.8041731
CCTACAT1700.043.763712
CGCTAGT254.5890672E-543.7635653
CGCGTAA254.5890672E-543.7635653
TAGCTTA932750.043.7635351
CTACGCA1950.043.76313810
CGCTTCA302.625491E-643.7631347
TCCTTCA490200.043.749311
TCCCATA108000.043.7169651
GCTTATC947900.043.701243
GATAGGT62300.043.69790615
CTTATCA981450.043.680794
AGCTTAT944000.043.6779442
TTCAAGT560600.043.662791
TCAACGC1452100.043.6621786