FastQCFastQC Report
Mon 5 Dec 2016
JG19_5_ACAGTG_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG19_5_ACAGTG_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13142159
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA5847284.449253733728225RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC5684714.325552597560264RNA PCR Primer, Index 1 (100% over 27bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT4741513.6078623002506665No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC4607783.5061058080335203RNA PCR Primer, Index 1 (100% over 27bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC3761442.862117251815322No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3084112.346730092064782RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2977282.265442078428666RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2915602.218509150589336RNA PCR Primer, Index 1 (100% over 33bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA2509101.909199241920601RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2398471.8250197703436704RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2168291.6498735101287392RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA2162011.6450949954265506RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1507311.1469272286235466RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1239140.9428739981003121RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1106790.8421675616616722RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA997070.7586805181705685No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG885090.6734738181146644RNA PCR Primer, Index 1 (100% over 29bp)
CTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAAC858690.6533857945258461No Hit
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC814860.6200351099085013RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC769380.5854289238168554No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA766770.5834429487575064RNA PCR Primer, Index 1 (100% over 28bp)
ACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAG753630.5734445915621627No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA675160.5137359850843382RNA PCR Primer, Index 1 (100% over 34bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG675050.5136522849860514RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA666950.5074889141122094RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC562450.4279738207398039RNA PCR Primer, Index 5 (100% over 35bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA553210.42094301248371746RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC542890.4130904214444521RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA522190.39733958476685605RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA520010.39568080100080966No Hit
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA496230.3775863615711848RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA466750.35515473523033775RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT461100.35085559381833686RNA PCR Primer, Index 1 (100% over 30bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC410700.3125057306033202RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC389970.29673206662619134RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA387630.29495153726263695RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA380330.289396894376335RNA PCR Primer, Index 1 (100% over 28bp)
ACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAA379840.2890240484839668No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG379690.288909911986303RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT377560.2872891737194779RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC377420.2871826463216584No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA365230.2779071536115185RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA358430.2727329657174289RNA PCR Primer, Index 1 (100% over 28bp)
GGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGC350430.26664568584202947No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA347140.26414229199327144No Hit
TACGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTA342760.26080950626149024No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA338640.2576745571256595RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC328150.24969261138904192RNA PCR Primer, Index 1 (100% over 27bp)
AACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGA324920.24723487213934942No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC322830.24564457027190129RNA PCR Primer, Index 1 (100% over 26bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA308610.2348244302933787RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG304980.2320623270499162RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT304620.23178839945552326RNA PCR Primer, Index 1 (100% over 30bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA303300.23078399827608237RNA PCR Primer, Index 1 (100% over 28bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA291980.2221704972523921No Hit
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA291180.22156176926485216RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC289940.22061824088416526RNA PCR Primer, Index 5 (100% over 50bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC288870.21980406720083054No Hit
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA288370.2194236122086181RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA287050.21841921102917716RNA PCR Primer, Index 1 (100% over 32bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA283930.2160451718777714RNA PCR Primer, Index 1 (100% over 34bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA278650.21202756716000773RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC275590.20969918260766743No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG275000.20925024571685674RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACA272400.2072718797573519RNA PCR Primer, Index 5 (100% over 36bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA262130.19945733421730785No Hit
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA260180.19797355974767922RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG252890.19242652596122145No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC237260.18053350290465972RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC220380.16768934236756686RNA PCR Primer, Index 1 (100% over 26bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGA215940.16431090203672014RNA PCR Primer, Index 5 (100% over 40bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC215480.16396088344388465No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC209890.1597073966309493RNA PCR Primer, Index 1 (96% over 33bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG205970.15672462949200355RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC205600.15644309279776633RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA205210.1561463379038406RNA PCR Primer, Index 1 (100% over 28bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA202450.1540462263468278No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA200760.15276028847314965RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC200370.15246353357922393RNA PCR Primer, Index 1 (100% over 27bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC196520.14953403013918792No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG192790.14669583589728294RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG184460.14035745572702324RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA183190.13939110004680358RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG176590.13436909414959902RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC175680.13367666606377232No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG171630.13059498062685135No Hit
CCCAGTGTTCAGACTACCTGTTCTGGAATTCTCGGGTGCCAAGGAACTCC171040.13014604373604063RNA PCR Primer, Index 1 (100% over 27bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA169600.12905033335846874RNA PCR Primer, Index 1 (100% over 34bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA161260.12270434408836478RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA159980.12173037930830087RNA PCR Primer, Index 1 (100% over 28bp)
CGCCTTGAAGCCCGGTTGCCGGCCCGTGGAATTCTCGGGTGCCAAGGAAC158190.12036835043618024RNA PCR Primer, Index 1 (100% over 24bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC150330.11438759795860025RNA PCR Primer, Index 1 (100% over 27bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG149540.11378647907090457RNA PCR Primer, Index 1 (100% over 29bp)
CACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAG149270.11358103337510983RNA PCR Primer, Index 5 (100% over 37bp)
CAGTCGGTAGAGCATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA147740.11241684109893968RNA PCR Primer, Index 1 (100% over 34bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA147630.11233314100065293RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC146540.11150374911762977RNA PCR Primer, Index 1 (100% over 26bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG146270.11129830342183503RNA PCR Primer, Index 1 (100% over 29bp)
AAGTTCTGTGATACACTTTGACTTGGAATTCTCGGGTGCCAAGGAACTCC145920.1110319849272863RNA PCR Primer, Index 1 (100% over 27bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC144760.11014932934535339RNA PCR Primer, Index 5 (100% over 35bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA141510.10767637189597234RNA PCR Primer, Index 1 (100% over 28bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA137620.10471643205655935RNA PCR Primer, Index 1 (100% over 32bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG136990.10423705876637164No Hit
TAGCTTATCAGACTGGTGTTGGCTTGGAATTCTCGGGTGCCAAGGAACTC136550.10390225837322467RNA PCR Primer, Index 1 (100% over 26bp)

[WARN]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACAAGTC254.382437E-544.1064341
CTATTCC207.76653E-444.106431
GCGTACC302.4880337E-644.1064261
AACATTC1363500.044.083791
TAGCTTA695700.044.0493741
AACAGTA135850.044.0414961
GCAAGTA1750.043.999032
TATACAG2150.043.999032
TATCCGT700.043.9990272
ATACTTA302.5307218E-643.99752444
GGTATTA207.8619574E-443.997194
TAATGCG207.8619574E-443.997193
CGAGTAA2650.043.9971853
TTCCCTA302.5308545E-643.9971853
GCCCCTA950.043.997025
ATCTACG1400.043.9968538
GCTATCG408.3291525E-943.99685311
TACGCAA1400.043.99685311
CGCTATC408.3291525E-943.99685310
CGTCCTA207.862252E-443.99685311