FastQCFastQC Report
Mon 5 Dec 2016
JG20_1_ACAGTG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG20_1_ACAGTG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12734938
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA9772737.673951769533546RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC6770035.316107546028101RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG5591594.390747720954747RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4400763.4556587554646914RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2193851.7227017516693053RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG2172351.7058190624877796RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1913141.5022766502671627RNA PCR Primer, Index 1 (100% over 33bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1525541.1979171001853326RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1409981.1071746089380254RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1279651.0048341028436887RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1228450.9646297453509393RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC1099370.8632707909532029RNA PCR Primer, Index 1 (100% over 26bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1092210.8576484628350762RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA1000660.7857596165760681RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA956310.7509341623806884RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA951110.7468509073228311RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA918870.7215347259641155RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG914020.7177263053813061RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA857560.6733915783492626RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA804180.631475394697642RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT761660.5980869321860852RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA740560.5815183395474717RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA732930.5755269479914232RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA686600.5391467159086287RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA667310.5239994101266924RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA658640.5171913675590725RNA PCR Primer, Index 1 (100% over 34bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC657980.5166731082632676RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC649500.5100142615535309RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG632260.49647670055401916RNA PCR Primer, Index 1 (100% over 29bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC630930.4954323295488365RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA624900.49069732416443645RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA562050.44134490485937194RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC558400.43847877390529894RNA PCR Primer, Index 1 (100% over 27bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC515370.4046898383015292RNA PCR Primer, Index 5 (100% over 35bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC479570.3765781977108958RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA474530.37262058127020325RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG456790.3586903995920514RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA442340.34734366197935157RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA435710.34213751178058344RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA432890.3399231311530531RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT428510.33648377400816554RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA427270.33551007472513805RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG426050.3345520802692561RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG409400.32147781167053974RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT393230.30878045892331785RNA PCR Primer, Index 1 (100% over 30bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC389550.3058907707285265RNA PCR Primer, Index 1 (100% over 33bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACA341440.2681128090297731RNA PCR Primer, Index 5 (100% over 36bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA339220.26636957321661087RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC328300.2577947375951104RNA PCR Primer, Index 1 (100% over 26bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC325210.25536834180111434RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG312450.24534866208221823RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC307610.24154809391298177RNA PCR Primer, Index 1 (96% over 33bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA296100.23250996589068593RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA290280.2279398611913148RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA286950.2253250074715715RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA264480.207680634173484RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG262390.20603947973676823RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA260540.20458678322579976RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC260200.2043198011643245RNA PCR Primer, Index 1 (100% over 26bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG259430.20371516531921866RNA PCR Primer, Index 1 (100% over 29bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC257580.2022624688082502RNA PCR Primer, Index 1 (100% over 27bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA255520.20064487161225286RNA PCR Primer, Index 1 (100% over 28bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA250250.19650664965938586RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA235240.1847201768866091RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC229810.18045631631657727RNA PCR Primer, Index 1 (100% over 27bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA226580.17791998673256204RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG223370.1753993619756924RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA220230.17293370411383235RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA210650.16541109191108744RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC210510.16530115812106821RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC204890.16088810169315312RNA PCR Primer, Index 1 (100% over 26bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA204830.1608409872117163RNA PCR Primer, Index 1 (100% over 28bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC201820.15847741072630273RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC199880.15695404249317899RNA PCR Primer, Index 1 (100% over 26bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG199800.15689122318459658RNA PCR Primer, Index 1 (100% over 29bp)
ATCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC198770.1560824245865979RNA PCR Primer, Index 1 (100% over 26bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA197750.15528147840217205RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG193590.15201487435588615RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA189010.14841846893954255RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA185950.14601563038626494RNA PCR Primer, Index 1 (100% over 32bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC183880.1443901807766948RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTCTTGGAATTCTCGGGTGCCAAGGAACT178140.13988289538590606RNA PCR Primer, Index 1 (100% over 25bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA172290.13528923344581653RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG171590.13473956449572033RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA170610.1339700279655857RNA PCR Primer, Index 1 (100% over 28bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA168330.1321796776709867RNA PCR Primer, Index 1 (100% over 28bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA168080.13198336733166663RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG162610.12768809710734358No Hit
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA162450.12756245849017875RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA158150.12418592065387361RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA157830.12393464341954392RNA PCR Primer, Index 1 (100% over 34bp)
AACATTCATTGCTGTCGCTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC157150.12340067929659335RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC156410.12281960069220597RNA PCR Primer, Index 1 (100% over 26bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA153750.12073085868184047RNA PCR Primer, Index 1 (100% over 28bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA152220.11952943940520167RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA152070.11941165320160961RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGGAATTCTCGGGTGCCAAGGAACTCCAGT151700.11912111389941593RNA PCR Primer, Index 1 (100% over 30bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG148970.11697740499404082RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC148470.11658478431540067RNA PCR Primer, Index 5 (100% over 50bp)
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA148450.11656907948825507RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA147830.11608222984674131RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA146420.11497503953297612RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC144330.11333388509626038RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC143810.11292555959047464RNA PCR Primer, Index 1 (100% over 27bp)
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA140760.11053057345076983RNA PCR Primer, Index 1 (100% over 28bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA140090.11000446174139207RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC139630.10964325071704313RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA134980.10599187840568992RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG134840.10588194461567067RNA PCR Primer, Index 1 (100% over 29bp)
CTTTTTGCGGTCTGGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG133750.1050260315362352RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGACTTCTCGGGTGCCAAGGAACTCCAGTCAC132740.10423293776538212RNA PCR Primer, Index 1 (96% over 33bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA130590.10254466884722956RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCG130450.10243473505721033RNA PCR Primer, Index 5 (100% over 45bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA129200.10145318336061002RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATATGC408.200004E-944.075151
CACTATT650.044.075151
CGAGGTA207.793706E-444.075151
GCGTACG351.4283432E-744.075151
TTGCGTA1450.044.0751461
TATTACA1000.044.0751461
TTACGTA551.8189894E-1244.0751461
AACATTC2419200.044.059661
TGCGTCC207.839254E-444.02302629
CGTGTTA1250.043.9964072
TATCCGT1150.043.9964072
AGTATTA1050.043.9964032
TGCGTAG1450.043.9964032
CTAGCAT1450.043.9964032
CTATTAC650.043.9958883
AGGTAGG408.3309715E-943.9958843
TGCCCTA207.8630954E-443.9958843
GTATTAC1050.043.9958843
TTCGATA850.043.9958843
ACCTAGA351.4492616E-743.993644