FastQCFastQC Report
Mon 5 Dec 2016
JG22_3_TGACCA_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG22_3_TGACCA_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12253940
Sequences flagged as poor quality0
Sequence length50
%GC53

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG6016684.909996295069178No Hit
GCATCGATGGTTCAGTGGTAGAATGCTCTGGAATTCTCGGGTGCCAAGGA4830073.941646523485508RNA PCR Primer, Index 1 (100% over 22bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3066982.5028521438818863RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG3038902.479937065139865RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2483342.0265645172083424RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA1757691.4343876336916943RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1321461.0783960097731833RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1305451.065330824208377RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1234801.0076758985273306RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1160570.9470994635194885RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1094260.892986255849139RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC1013130.8267789788427232RNA PCR Primer, Index 1 (100% over 26bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG963880.7865878239978326No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC867750.7081395861249524No Hit
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT791220.6456862037842522No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC769220.6277327945134381RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA740790.6045320933511997RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT730880.5964448985387557RNA PCR Primer, Index 3 (100% over 34bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG704810.575170108552841RNA PCR Primer, Index 1 (100% over 29bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG682940.5573227876095362RNA PCR Primer, Index 2 (97% over 35bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA645090.5264347630231583No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA583520.4761896989866117RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCGGTAGTATAGTGGTCAGTATCCCCTGGAATTCTCGGGTGCCAAGG580440.47367622168869766Illumina Small RNA Adapter 2 (100% over 21bp)
TCCTCGGTAGTATAGTGGTCAGTATCCCTGGAATTCTCGGGTGCCAAGGA562420.4589707473677854RNA PCR Primer, Index 1 (100% over 22bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA549070.4480762921966323RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC545090.4448283572467304RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA485520.39621542132571236RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC469800.38338689433765794RNA PCR Primer, Index 1 (100% over 26bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC462290.3772582532638482No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA456240.37232106571437434RNA PCR Primer, Index 1 (100% over 32bp)
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA444520.362756794957377No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA439340.35852958313815797RNA PCR Primer, Index 1 (100% over 32bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT429370.35039342448224814RNA PCR Primer, Index 3 (100% over 34bp)
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT407450.3325053003360552No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG381370.3112223497095628RNA PCR Primer, Index 1 (100% over 29bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG325880.265938955144223No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT308780.25198425975645383No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT297580.24284434230949395No Hit
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTTGGAA286590.2338757983146645No Hit
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA277500.22645777602958722RNA PCR Primer, Index 1 (100% over 28bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC269540.21996190612978356RNA PCR Primer, Index 1 (100% over 31bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG267140.2180033523911493No Hit
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT266840.21775853317382No Hit
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT260780.21281318498376847RNA PCR Primer, Index 1 (100% over 30bp)
TCAGTAACTGGAATCTGTCCCTGCTGGACTTCTCGGGTGCCAAGGAACTC257990.21053636626260616RNA PCR Primer, Index 1 (96% over 26bp)
ACACTGCGATCTGCTGAGACTAAGCCTACGACCGGGAGATTTGTTGGAAT256480.20930410953538212No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAA249080.20326523550792644RNA PCR Primer, Index 4 (100% over 40bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC245800.20058854539845958No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG245040.19996833671455874RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA243480.19869527678444648RNA PCR Primer, Index 1 (100% over 28bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC237150.1935295912987986No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA227670.18579330403119323No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA212490.1734054516343315RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGA211000.1721895161882627RNA PCR Primer, Index 2 (97% over 36bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA205120.16739105952860875No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA197500.16117265140844497No Hit
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC189100.15431771332322503RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA188210.1535914163118148RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC187520.15302833211195746RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA183770.1499680918953414No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC180600.14738116883222865No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA179930.1468344059135266No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC177590.14492481601835816No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT176910.14436989245907847RNA PCR Primer, Index 1 (100% over 30bp)
CTACGCCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCC173380.14148918633517055RNA PCR Primer, Index 1 (100% over 27bp)
CTTCGGCTCGTCTCTTGGTGACTCTGAATAACTATAGCCGATCGCACGGT171060.13959591772115745No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC170390.13904915480245536No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC168850.13779241615349838RNA PCR Primer, Index 1 (100% over 26bp)
TCCTCGGTAGTATAGTGGTCAGTATCCCCGCCTTGGAATTCTCGGGTGCC167680.1368376212059142No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG164360.13412828853413677RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT162420.13254512426207407RNA PCR Primer, Index 1 (100% over 30bp)
GGATTCGTAATCCGCACGCGGCTGGAACGGTGTCAAAGGACCCATGGAAT160400.13089667486539022No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGC156730.12790171977339532RNA PCR Primer, Index 4 (100% over 50bp)
AGGTCCCTTATCGGGCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT152280.1242702347163443RNA PCR Primer, Index 3 (100% over 34bp)
GTTCCTGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC150490.12280948005294623No Hit
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC149560.12205054047922546No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTCTGTGGAATTCTCGGGTGCCAAG148780.12141401051416932No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA146910.11988797072615012RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA141990.11587293556194987RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA140710.1148283735680116RNA PCR Primer, Index 1 (100% over 28bp)
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC138860.11331865506114767RNA PCR Primer, Index 1 (100% over 31bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG135210.11034002125030808RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT133570.10900167619557465RNA PCR Primer, Index 1 (100% over 30bp)
GCATCGATGGTTCAGTGGTAGAATGCTGGAATTCTCGGGTGCCAAGGAAC126610.10332187035353527RNA PCR Primer, Index 1 (100% over 24bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT122600.1000494534819005No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCATCGA598750.043.9287641
TCAGTAA405550.043.8870661
CTATGAA607750.043.842156
CCTATGA607600.043.8421175
AACATTC194950.043.779311
TTCAACG177450.043.7586445
TGACCTA608400.043.7583962
GCTTATC144250.043.750183
TCAACGC177550.043.7463846
CAACGCT177550.043.7339977
TATGAAT610400.043.723897
CAGCCAT270600.043.72331217
GACCTAT609450.043.716253
ACCTATG609750.043.691134
ACATTCA196300.043.672052
GAATTGA611000.043.64495510
CAGTAAC407900.043.6410982
ATGAATT611850.043.6382458
CATCGAT602600.043.621032
CATTCAA178700.043.5387153