FastQCFastQC Report
Mon 5 Dec 2016
JG25_5_CGATGT_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG25_5_CGATGT_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24257944
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA8753943.6086900027471414RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG8504763.505969013697121RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC7874823.2462850107989367RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA7859383.239920085560425RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC7435963.065371080088238RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA6920882.853036514553748RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA5167352.130168162643957RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA4070951.6781925129351438RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA3738401.541103401013705RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3611801.4889143119466348RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2937491.2109393937095412RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA2869731.183006276212032RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2739691.1293990949933763RNA PCR Primer, Index 1 (100% over 33bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA2411160.9939671721560575No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2375920.9794399723241177RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1915050.7894527252598159RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC1830730.7546929781023486RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC1790750.7382117792010733No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA1609900.6636588822201914No Hit
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1566010.6455658402047594RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG1470490.6061890488328278RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG1387960.5721672042774936RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1367810.5638606470523636RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1279060.5272746940136395RNA PCR Primer, Index 1 (100% over 28bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1236260.5096309893369364RNA PCR Primer, Index 1 (100% over 33bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT1133660.4673355664437184RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC1042820.4298880399756879No Hit
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC1030750.4249123503624215RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA998610.41166308241127114RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA910790.3754605089367838RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC875060.3607313134204614RNA PCR Primer, Index 2 (100% over 34bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA825960.34049052137312213RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG804410.33160683362118404RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT800580.3300279693942735RNA PCR Primer, Index 1 (100% over 30bp)
ATGAACTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG787860.32478432632213183RNA PCR Primer, Index 1 (100% over 29bp)
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA777310.32043523556654263RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGA761540.31393427241814065RNA PCR Primer, Index 2 (100% over 36bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA756240.31174942113808163RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA737870.30417664415417894RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA730820.3012703797156099No Hit
ATGAACTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA723540.298269300976208RNA PCR Primer, Index 1 (100% over 28bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA716380.2953176905676755RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG656070.27045573194496614RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA654730.26990333558359275RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC653380.26934681686131356RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA642770.2649729919402898RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC627210.2585585983709089No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA621140.2560563253011055RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG591990.2440396432607809RNA PCR Primer, Index 2 (100% over 35bp)
ACATTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG583180.240407843302796RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG572380.2359556935245625RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC536290.22107809301563233No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC530720.21878193799111748No Hit
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC525290.2165434960192834RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT524090.21604881271059082RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC507700.20929226318603095No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG500120.20616751361945598No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG496380.20462575064069732No Hit
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA487650.20102692956995863RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA478280.1971642774012505RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA469800.19366851535315605RNA PCR Primer, Index 1 (100% over 28bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA464120.19132701435867772RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG457640.18865572449173765RNA PCR Primer, Index 1 (100% over 29bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA456110.18802500327315455RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA451420.18609161600834762RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA443700.18290915338909183RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG438070.18058826419914237RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA433420.1786713663779585RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA419160.172792879726328RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCTGGAATTCTCGGGTGCCAAG410720.16931360712185667No Hit
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC386350.15926741359449095RNA PCR Primer, Index 1 (100% over 27bp)
TTTTGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC384780.1586202029322848RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC384040.15831514822525766No Hit
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC372110.15339717166467198RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA371290.15305913807039873RNA PCR Primer, Index 1 (100% over 28bp)
TACCATGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA363470.14983545184208522RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA359130.14804634720898027RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA356540.1469786557343854RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA352780.14542864803381522RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC352530.14532558901117096RNA PCR Primer, Index 1 (100% over 26bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT342490.14118673866177614RNA PCR Primer, Index 1 (100% over 30bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC337700.13921212778791145RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA333380.13743126787661808No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG323980.13355624862519264RNA PCR Primer, Index 1 (100% over 29bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC297440.12261550278127445RNA PCR Primer, Index 2 (100% over 34bp)
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA289270.11924753392125896RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG287680.11859207853724126RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTATGC286980.11830351327383722RNA PCR Primer, Index 2 (100% over 50bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG284740.11738010443094436RNA PCR Primer, Index 1 (100% over 29bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA283850.11701321431033067RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC283570.11689778820496906No Hit
TTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG276560.11400801321002309RNA PCR Primer, Index 2 (100% over 35bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA265580.10948166093548571RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC265430.10941982552189913RNA PCR Primer, Index 1 (100% over 27bp)
TTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCT262100.10804707934027714RNA PCR Primer, Index 2 (100% over 43bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA258860.1067114344068071RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC250370.1032115499978069RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCCA248570.10246952503476799No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA247370.10197484172607538RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC245770.10131526398115191RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTTCG468400.045.414424
GTTCGCC470850.045.37484426
TTCGCCT476600.045.24913427
CGCCTCT141750.044.58674629
TCGCCTC142550.044.53069728
CGTTCGC482800.044.3377425
AACATTC2258150.043.6954231
AACAGTA421950.043.6578031
ACCATAT900.043.6310272
ATACGTA1100.043.6081853
CGCGTAA1150.043.6081853
TCCTTCA873900.043.602231
TAGCTTA1082750.043.5835651
TGACCTA1997000.043.5764052
TTCAAGT989750.043.555781
CAACGCT2274450.043.5497
ACATTCA2291500.043.54632
TACCCTG1034600.043.5415421
TCAACGC2274650.043.5384526
AGCTTAT1094300.043.537332