FastQCFastQC Report
Mon 5 Dec 2016
JG48_1_GCCAAT_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG48_1_GCCAAT_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14339608
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA12140238.466221670773706RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC8951676.242618347726102RNA PCR Primer, Index 1 (100% over 27bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT5440233.7938484789821314No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA5402463.7675088468248226RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG4199372.9285110164796695RNA PCR Primer, Index 1 (100% over 29bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC3173102.2128219962498274No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG2435951.698756339782789RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1821751.2704322182307912RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1318580.919536991527244RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1282010.8940342023296592RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1177650.8212567595990072RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1134940.7914721239241687RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA1122040.7824760621071372RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1048490.7311845623673953RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1048200.7309823253187954RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1010640.7047891406794383RNA PCR Primer, Index 1 (100% over 33bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC960820.670046210468236RNA PCR Primer, Index 1 (100% over 26bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA885620.6176040516588738RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC882880.615693260234171RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC874870.6101073334780143RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA722800.5040584094070075RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA716030.4993372203758987RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG706510.49269826622875607RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA684730.47750956650976795RNA PCR Primer, Index 1 (100% over 28bp)
ACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAG648990.4525855936926588No Hit
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT634900.4427596626072345RNA PCR Primer, Index 1 (100% over 30bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG621290.4332684687056996RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA560070.39057553037712045RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC555860.3876396063267559RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA550120.3836367075027435RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA546890.38138420520282RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA531130.3703936676651133RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT522500.3643753720464325RNA PCR Primer, Index 1 (100% over 30bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC509130.35505154673684247RNA PCR Primer, Index 1 (100% over 27bp)
CTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAAC508650.3547168095529529No Hit
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA501550.34976548870792007RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG498480.34762456546929316RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA484300.33773587116188947RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG480290.3349394209381456RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC469010.32707309711674126RNA PCR Primer, Index 1 (100% over 27bp)
TACGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTA461130.3215778283478879No Hit
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG459870.32069914324017784RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA454010.31661256012019295RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA410790.2864722661874718RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT398150.2776575203450471RNA PCR Primer, Index 1 (100% over 30bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA396770.27669515094136465RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC354040.24689656788386402RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC346960.24195919442149325RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG344720.24039708756334205RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA337950.23567589853223325RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA335080.23367444912022697RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG328400.2290160233110975RNA PCR Primer, Index 6 (100% over 34bp)
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA322140.2246504925378713RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG318300.22197259506675496RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG315770.2202082511600038RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC278800.19442651430917776RNA PCR Primer, Index 1 (100% over 26bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC268930.18754348096544898RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGC262800.18326860817952625RNA PCR Primer, Index 6 (100% over 50bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA262320.18293387099563668RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA258430.18022110506786518RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA252890.17635768007047334RNA PCR Primer, Index 1 (100% over 28bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA250610.174767678446998RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA245450.17116925372018538RNA PCR Primer, Index 1 (100% over 28bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGCTGAAGAACGCAGCT243090.1695234625660618No Hit
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA240170.16748714469740036RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC238660.16643411730641453RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA238560.1663643803931042RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG235780.16442569420307723RNA PCR Primer, Index 1 (100% over 29bp)
ACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAA234360.16343543003407068No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA230040.16042279537906476RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA228630.1594395049013892RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA225550.1572916079714313RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG225320.15713121307081754No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG224920.15685226541757627RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG222640.15526226379410094RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA221300.15432778915574263RNA PCR Primer, Index 1 (100% over 28bp)
ATCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC216450.150945548860192RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA214680.1497112054945993No Hit
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC214650.1496902844206062RNA PCR Primer, Index 1 (100% over 26bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA212880.1484559410550135RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC208910.1456873855965937RNA PCR Primer, Index 1 (100% over 27bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA208470.14538054317802832RNA PCR Primer, Index 1 (100% over 28bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA193710.13508737477342475RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC193650.13504553262543856RNA PCR Primer, Index 1 (100% over 27bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGC192980.13457829530625942RNA PCR Primer, Index 5 (97% over 35bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA191200.13333697824933569RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC188960.13177487139118446RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC184180.12844144693495108RNA PCR Primer, Index 1 (100% over 27bp)
TATGGCTTTTTATTCCTATCTGATGGAATTCTCGGGTGCCAAGGAACTCC181920.1268653926941378RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC180830.12610526033905528RNA PCR Primer, Index 1 (100% over 26bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC180790.12607736557373117RNA PCR Primer, Index 1 (100% over 27bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA177690.12391552126111119RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC175970.12271604635217366RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC175640.12248591453824957RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC173370.12090288660610528RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA173360.12089591291477424RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG172870.12055420203955367RNA PCR Primer, Index 1 (100% over 29bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA168800.11771590966782357RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA167810.11702551422605137RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA167150.11656525059820325RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC160940.11223458828163226RNA PCR Primer, Index 1 (100% over 27bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA158280.11037958638757768RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC156520.10915221671331601No Hit
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA155930.10874076892478511RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA152490.10634181910691004RNA PCR Primer, Index 1 (100% over 28bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA152140.1060977399103239No Hit
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC151000.10530273909858624RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA150200.10474484379210365RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT145870.10172523544576671RNA PCR Primer, Index 1 (100% over 30bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA145510.10147418255784955RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CACTATT1150.044.045241
AACATTC3054550.044.018561
AACTGCC408.381903E-943.965662
TATCCGT1650.043.965662
TTCCCTA302.5436275E-643.9650543
GGAGATA254.466306E-543.965053
CTACATA351.4567013E-743.965053
TGCCGTA551.8189894E-1243.9650463
TCGATAG351.4570287E-743.9638254
GCCCCTA351.4573016E-743.9627535
GATACGC454.838512E-1043.9615215
TACCTTC254.469249E-543.96014414
TAGATAT351.4593024E-743.9550917
AACGTAT650.043.95508617
TTGCGAA302.5481495E-643.953718
GTACGTT551.8189894E-1243.953718
CGATTAC254.4731147E-543.9537059
TCGATAT1950.043.9537057
TATTCAC502.7284841E-1143.9537056
CTACCTA207.900359E-443.95378